| Literature DB >> 35370745 |
Lei Shen1,2,3, Wei Zong1, Wei Feng1, Erlin Chen4, Shuo Ma1,2,3, Jie Yuan1,2,3, Guihua Wang1, Xinliang Gu1,2,3, Xianjuan Shen2,3, Shaoqing Ju1.
Abstract
Objectives: Colorectal cancer (CRC) is a common carcinoma of the gastrointestinal tract with high incidence and mortality worldwide. Studies have shown that long noncoding RNAs (lncRNAs) play important roles in CRC. Our purpose is to investigate the potential of serum Linc01836 as a diagnostic and prognostic marker in CRC.Entities:
Keywords: Linc01836; biomarker; colorectal cancer; diagnosis; long noncoding RNA
Year: 2022 PMID: 35370745 PMCID: PMC8975208 DOI: 10.3389/fphar.2022.840391
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Demographic and clinical characterization of the study population.
| Variables | Preoperational CRC (n = 137) | Postoperational CRC (n = 82) | Benign ( | Healthy ( |
|---|---|---|---|---|
| Age | ||||
| Median (range) | 65 (36.88) | 66 (40.80) | 60 (29.78) | 52 (39.84) |
| Gender | ||||
| Male | 78 | 53 | 28 | 55 |
| Female | 59 | 29 | 23 | 83 |
Primer sequences.
| Primer | Sequence |
|---|---|
| 18S rRNA | F: GTAACCCGTTGAACCCCATT |
| R: CCATCCAATCGGTAGTAGCG | |
| Linc01836 | F: CGAGGAGGACAAGGGAGGGAAC |
| R: TGGTGAGCAGGAGGGACTTAGC |
FIGURE 1Identification of Linc01836. (A) The dysregulated expression level of Linc01836 in The Cancer Genome Atlas (TCGA) database. (B) The expression level of serum Linc01836 in CRC patients (n = 20) and healthy donors (n = 20). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, NS p > 0.05.
FIGURE 3Serum Linc01836 serving as a biomarker for early diagnosis and cancer surveillance. (A) The expression level of serum Linc01836 in colorectal cancer (CRC) patients (n = 137), healthy donors (n = 138), and patients with benign colorectal diseases (n = 51). (B) The expression level of serum Linc01836 in preoperational CRC patients (n = 137) and postoperational CRC patients (n = 82). (C) The expression level of serum Linc01836 in 48 pairs of CRC patients before and after surgical resection. (D) Survival curve verified the prognostic value of Linc01836. (E) The expression level of serum Linc01836 in CRC patients with different stages of lymph node metastasis. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, NS p > 0.05.
FIGURE 2Methodological evaluation of Linc01836. (A) The melting peak of Linc01836 showed a single peak. (B) The qRT-PCR products detected by agarose gel electrophoresis exhibited a single band. (C) Sanger sequencing alignment of the amplification product was confirmed to be Linc01836. (D) The linearity of Linc01836 and 18S rRNA were acceptable. (E, F) The detection of 18S rRNA and Linc01836 at room temperature within 24 h and repeated freeze-thaw cycles showed good stability. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, NS p > 0.05.
Imprecision for Linc01836 and 18S rRNA (N = 12).
| RNA | Ct (mean ± SD) | CV, % | |
|---|---|---|---|
| Intra-assay | 18S rRNA | 18.34 ± 0.35 | 1.91 |
| Linc01836 | 28.76 ± 0.17 | 0.60 | |
| Inter-assay | 18S rRNA | 17.76 ± 0.93 | 5.24 |
| Linc01836 | 28.58 ± 0.40 | 1.40 |
Correlation between Linc01836 expression and clinicopathologic parameters of colorectal cancer (CRC) patients.
| Characteristics | No. of patients | Linc01836 expression |
| |
|---|---|---|---|---|
| Low | High | |||
| Gender | ||||
| Male | 78 | 42 | 36 | 0.349 |
| Female | 59 | 27 | 32 | |
| Age | ||||
| ≤65 | 69 | 35 | 34 | 0.932 |
| >65 | 68 | 34 | 34 | |
| Tumor size, cm | ||||
| <4 | 69 | 34 | 35 | 0.797 |
| ≥4 | 68 | 35 | 33 | |
| Histological stage | ||||
| Poor | 20 | 5 | 15 | 0.002 |
| Moderate | 100 | 50 | 50 | |
| Well | 17 | 14 | 3 | |
| T stage | ||||
| T1–T2 | 46 | 24 | 22 | 0.763 |
| T3–T4 | 91 | 45 | 46 | |
| Lymph node metastasis | ||||
| Yes | 49 | 17 | 32 | 0.006 |
| No | 88 | 52 | 36 | |
| Nerve/vascular invasion | ||||
| Positive | 55 | 28 | 27 | 0.917 |
| Negative | 82 | 41 | 41 | |
| Location | ||||
| Colon | 71 | 37 | 34 | 0.671 |
| Rectum | 66 | 32 | 34 | |
| Morphological characteristic | ||||
| Ulcerative | 98 | 50 | 48 | 0.808 |
| Protrusive | 39 | 19 | 20 | |
| TNM stage | ||||
| I–II | 78 | 44 | 34 | 0.104 |
| III–IV | 59 | 25 | 34 | |
FIGURE 4Diagnostic value of Linc01836 and other commonly used tumor biomarkers for CRC. (A–D) The expression levels of serum CEA, CA19-9, CA72-4, and Cyfra21-1 in CRC patients (n = 137) and healthy donors (n = 138) (E,F) Receiver operating characteristic (ROC) curve analysis of Linc01836, CEA, CA19-9, CA72-4 ,and Cyfra21-1 in independent diagnosis of CRC patients and healthy donors. (G) ROC curve analysis of Linc01836, CEA, and Cyfra21-1 in joint diagnosis of CRC patients and healthy donors. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, NS p > 0.05.
Independent or joint diagnostic value of Linc01836 and other commonly used tumor biomarkers for distinguishing CRC patients from healthy population.
| SEN, % | SPE, % | ACCU, % | PPV, % | NPV, % | |
|---|---|---|---|---|---|
| Linc01836 | 65.0 (89/137) | 87.0 (120/138) | 76.0 (209/275) | 83.2 (89/107) | 71.4 (120/168) |
| CEA | 71.5 (98/137) | 76.1 (105/138) | 73.8 (203/275) | 74.8 (98/131) | 72.9 (105/144) |
| Cyfra21-1 | 40.9 (56/137) | 96.4 (133/138) | 68.7 (189/275) | 91.8 (56/61) | 62.1 (133/214) |
| CA19-9 | 35.8 (49/137) | 82.6 (114/138) | 59.3 (163/275) | 67.1 (49/73) | 56.4 (114/202) |
| CA72-4 | 8.8 (12/137) | 97.1 (134/138) | 53.1 (146/275) | 75.0 (12/16) | 51.7 (134/259) |
| Linc01836 + CEA | 90.5 (124/137) | 65.2 (90/138) | 77.8 (214/275) | 72.1 (124/172) | 87.4 (90/103) |
| Linc01836 + Cyfra21-1 | 81.0 (111/137) | 83.3 (115/138) | 82.2 (226/275) | 82.8 (111/134) | 81.6 (115/141) |
| Linc01836 + CEA + Cyfra21-1 | 92.0 (126/137) | 62.3 (86/138) | 77.1 (212/275) | 70.8 (126/178) | 88.7 (86/97) |
Note. Sensitivity (SEN), specificity (SPE), overall accuracy (ACCU), positive predictive value (PPV), and negative value (NPV).
FIGURE 5Exploration of the downstream regulatory ceRNA network of Linc01836 in CRC. (A) Detection of Linc01836 localization in NCM 460 and SW480 cells by nuclear and cytoplasmic RNA separation assay. (B) Schematic illustration exhibiting the overlap between the target miRNAs predicted by RNAhirbd and RNAhybrid database. (C) Prediction of lncRNAs–miRNAs–mRNAs network map of Linc01836.