| Literature DB >> 35370722 |
Min Guo1,2,3, Liwei Gu4, Heping Hui5, Xiaodong Li2,3, Ling Jin1.
Abstract
Alcoholic liver disease (ALD) caused by excessive drinking is a health and economic concern worldwide. Given the high morbidity, mortality, and the progressive nature of ALD, finding effective interventions is essential. Previous studies have confirmed that edible food plants and their bioactive compounds exert a protective effect against ALD. Dracocephalum tanguticum Maxim (DTM) is one of the important traditional Tibetan medicines in China with the effect of clearing away liver heat, used for the treatment of hepatitis. In this study, the DTM chloroform extract (DtM-C), ethyl acetate extract (DtM-E), and n-butanol extract (DtM-B) were obtained by ethanol extraction combined with fractional extraction. Acute ALD was induced in mice given intragastric ethanol. Serum and liver biochemical markers were detected by ELISA. Liver histological observation, Oil Red O, and Masson's trichrome staining were performed. Liver injury cells were induced by ethanol. The cell vitality was detected by using MTT colorimetry. The expressions of Nrf2, NF-κB, STAT3, AP-1, CREB, HIF-1α, HO-1, NQO-1, GSTA1, IKB2, and Keap1 were detected by real-time polymerase chain reaction (PCR) to elucidate the mechanism of hepatoprotective effect, and the results were verified by using Western blot. The results of serum liver function indicators (ALT, AST, and ADH), serum hepatic lipid indicators (TC, TG, HDL-C, and LDL-C), and lipid peroxidation indicators (ADH, MDA, SOD, CAT, and GSH-Px) in liver tissue and liver histological observation showed that DtM-E could improve liver function, alleviate fatty degeneration, edema, cell necrosis, and liver fibrosis caused by alcohol. DtM-E also increased the vitality of EtOH-induced liver injury cells, upregulated the mRNA expression of Nrf2, HO-1, NQO-1, and GSTA1, while downregulated the expression of Keap-1, p65, and NF-κB. Western blot results were consistent with PCR. The results suggest that DtM-E has a protective effect against ALD in vitro and in vivo, and its mechanism of action may be related to the activation of Nrf2/Keap-1 and inhibition of the P65/NF-κB signaling pathways.Entities:
Keywords: Dracocephalum tanguticum Maxim; Tibetan medicine; acute alcoholic liver disease; extract; transcription factors
Year: 2022 PMID: 35370722 PMCID: PMC8966672 DOI: 10.3389/fphar.2022.830532
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
List of primers for real-time polymerase chain reaction (PCR).
| Target | Full gene name | Primer | Sequence (5′→3′) |
|---|---|---|---|
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | FP | GAGTCAACGGATTTGGTCGT |
| RP | GACAAGCTTCCCGTTCTCAG | ||
| Nrf2 | Nuclear factor-erythroid 2-related factor 2 | FP | GCACATCCAGTCAGAAACCA |
| RP | GCCGAAGAAACCTCATTGTC | ||
| NF-kB p65 | Nuclear factor kappa-B p65 | FP | GGAGCACAGATACCACCAAGA |
| RP | CGGCAGTCCTTTCCTACAAG | ||
| STAT3 | Signal transducer and activator of transcription 3 | FP | TGGAGGAGAGAATCGTGGAG |
| RP | TTTGACCAGCAACCTGACTTT | ||
| AP-1 | Activator protein 1 | FP | TGACTGCAAAGATGGAAACG |
| RP | CAGGTTCAGGGTCATGCTC | ||
| CREB | cAMP-response element-binding protein | FP | AACCAGCAGAGTGGAGATGC |
| RP | AGTTACGGTGGGAGCAGATG | ||
| HIF-1α | Hypoxia-inducible factor 1-alpha | FP | GCAGCAACGACACAGAAACT |
| RP | AGCGGTGGGTAATGGAGAC | ||
| HO-1 | Heme oxygenase 1 | FP | TCCGATGGGTCCTTACACTC |
| RP | TAAGGAAGCCAGCCAAGAGA | ||
| NQO-1 | NAD(P)H quinone dehydrogenase 1 | FP | GGGTCCAGTCCCATGACCTT |
| RP | TCCCCATGTTTGTCAGTGAA | ||
| GSTA1 | Glutathione S-transferase alpha 1 | FP | GCCATCCTGTGCTACATTGC |
| RP | CAGCTGATTGGAGACGTCCAT | ||
| Keap1 | Kelch-like ECH-associated protein 1 | FP | GCTGTCCTCAATCGTCTCCT |
| RP | ATTCGCCACTCGTTCCTCT |
FIGURE 1Results of the detection of biochemical indicators. (A) Detection of serum liver function indicators: alanine transaminase (ALT), aspartate transaminase (AST), and alcohol dehydrogenase (ADH). (B–E) Detection of serum hepatic lipids: total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C). (F–H) Detection of lipid peroxidation: alcohol dehydrogenase (ADH), malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) in liver tissue. All data are presented as mean ± SD (n = 10). *p < 0.05 and **p < 0.01 (vs. control group); # p < 0.05 and ## p < 0.01 (vs. model group).
FIGURE 2Histological photomicrographs of liver sections stained with hematoxylin and eosin (H&E) (A), oil red O (B), and Masson’s trichrome (C); cell necrosis (black arrow), fatty degeneration (green arrow), fibrosis (yellow arrow).
FIGURE 3EtOH-induced cytotoxicity at different concentrations (A) and the effect of n-butanol extract (DtM-B), chloroform extract (DtM-C), and ethyl acetate extract (DtM-E) on normal (B) and Et-OH induced (C) cells. All data are presented as mean ± SD (n = 6). *p < 0.05 (vs. control group); p < 0.05 and ## p < 0.01 (vs. model group).
FIGURE 4Effects of DtM-E on nuclear transcription factors of Nrf2, NF-κB, STAT3, AP-1, CREB, and HIF-1α (A), the signaling pathways of Nrf2/HO-1(B), and P65/NF-κB (C). All data are presented as mean ± SD (n = 6). **p < 0.01 (vs. control group); p < 0.01 (vs. model group).
FIGURE 5The Western blot of Nrf2 and NF-κB signaling (A). Quantification of HO-1 (B), NQO-1 (C), GSTA1 (D), Keap-1 (E), Nrf2 (F), NF-κB P65 (G), and IKB2 (H) expression. All data are presented as mean ± SD (n = 6). **p < 0.01, *p < 0.05 (vs. control group); ## p < 0.01 (vs. model group).
FIGURE 6The Western blot of nuclear and cytoplasmic NF-κBP65 (A), nuclear and cytoplasmic Nrf2 (C). Quantification of nuclear and cytoplasmic NF-κBP65 (B), nuclear and cytoplasmic Nrf2 (D) expression. All data are presented as mean ± SD (n = 6). **p < 0.01, (vs. control group); ## p < 0.01 (vs. model group).