| Literature DB >> 35369498 |
Tao-Feng Lu1, Bo Sun2, Tai-Yong Yu3, Yan-Jun Wu1, Jie Zhou4, Shu-Guang Wu1.
Abstract
Domestic pigs has served not only as one of the most important economy livestock but also as ideal organ-source animals owing to similarity in anatomy, physiology, and organ size to humans. Howerer, the barrier of the cross-species transmission risk of porcine endogenous retrovirus (PERVs) blocked the pig-to-human xenotransplantation. PERVs are integrated into pigs' genomes and cannot be eliminated by designated or specified pathogen-free breeding. PERVs are an important biosafety issue in xenotransplantation because they can be released from normal pig cells and infect human cells in vitro under certain conditions. Screening and analyzing the presence of PERVs in pig genome will provide essential parameters for pig breed sources. In China, four miniature pig breeds, such as Guizhou miniature pig (GZ), Bama miniature pig (BM), Wuzhishan miniature pig (WZS), and Juema miniature pig (JM), were the main experimental miniature pig breeds, which were widely used. In this study, PCR was performed to amplify env-A, env-B, and env-C for all individuals from the four breeds. The results revealed that PERV env-A and env-B were detected in all individuals and the lowest ratios of PERV env-C was 17.6% (3/17) in the GZ breed. Then, PERV pol and GAPDH were detected using the droplet digital PCR (ddPCR) method. As the reference of GAPDH copy number, the copy numbers of PERVs were at the median of 12, 16, 14, and 16 in the four miniature pig breeds (GZ, BM, WZS, and JM), respectively. Furthermore, the copy number of the PERV pol gene in many organs from the GZ breed was analyzed using ddPCR. The copy numbers of PERV pol gene were at the median of 7 copies, 8 copies, 8 copies, 11 copies, 5 copies, 6 copies, and 7 copies in heart, liver, spleen, lung, kidney, muscle, and skin, and the maximum number was 11 copies in the lung. The minimum number was 5 copies in the kidney as the reference of GAPDH. These data suggest that GZ breed has the lower PERVs copy number in the genome, and may be an ideal organ-source miniature pig breed for the study of the pig-to-human xenotransplantation.Entities:
Keywords: PERV; copy number; ddPCR; miniature pig model; quantification
Year: 2022 PMID: 35369498 PMCID: PMC8965148 DOI: 10.3389/fmicb.2022.840347
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers and probes for PERV detection.
| Primer, probe | Sequence | Accession number | Position (nt–nt) | Reference |
| PERV-EnvA-F | 5′-TGGAAAGATTGGCAACAGCG-3′ | Y12238 | 742–761 |
|
| PERV-EnvA-R | 5′-AGTGATGTTAGGCTCAGTGG-3′ | 1,101–1,082 | ||
| PERV-EnvB-F | 5′-TTCTCCTTTGTCAATTCCGG-3′ | Y12239 | 1,376–1,395 |
|
| PERV-EnvB-R | 5′-TACTTTATCGGGTCCCACTG-3′ | 1,639–1,620 | ||
| PERV-EnvC-F | 5′-CCCCAACCCAAGGACCAG-3′ | AM229312 | 9,601–9,618 |
|
| PERV-EnvC-R | 5′-AAGTTTTGCCCCCATTTTAGT-3′ | 9,692–9672 | ||
| PERV-pol-F | 5′-CGACTGCCCCAAGGGTTCAA-3′ | HM159246 | 3,568–3,587 |
|
| PERV-pol-R | 5′-TCTCTCCTGCAAATCTGGGCC-3′ | 3,803–3,783 | ||
| PERV-pol-probe | 5′-[FAM]CACGTACTGGAGGAGGGTCACCTG[BHQ1]-3′ | 3,678–3,655 | ||
| Pig-GAPDH-F | 5′-CCGCGATCTAATGTTCTCTTTC-3′ | 396823 | 3,951–3,970 |
|
| Pig-GAPDH-R | 5′-TTCACTCCGACCTTCACCAT-3′ | 4,022–4,001 | ||
| Pig-GAPDH-probe | 5′-[HEX]CAGCCGCGTCCCTGAGACAC[BHQ1]-3′ | 3,991–3,972 |
FIGURE 1The classical PCR method detects env-A, env-B, and env-C genes in the four miniature pig breeds. Panel (A) was the detection result for the GZ breed. Panel (B) was the detection result for the BM breed. Panel (C) was the detection result for the WZS breed. Panel (D) was the detection result for the JM breed. The quantification data of the prevalence of PERV env A, B, C in each pig breeds was listed on the right.
FIGURE 2The copy number of PERV in the four different miniature pig breeds from China is based on the ddPCR method. Each point indicates one animal. The median and the standard deviations are shown. Guizhou miniature pig (GZ, red), Bama miniature pig (BM, blue), Wuzhishan miniature pig (WZS, green), and Juema miniature pig (JM, pink). The symbols of significant difference between comparisons of different pig breeds was marked (**P < 0.01).
FIGURE 3The copy number of PERV in the different organs from the GZ breed is based on the ddPCR method. Each point indicates one test. The median and the standard deviations are shown. Three GZ breed cases were tested.