Literature DB >> 35368949

A Novel NCSTN Mutation in a Three-Generation Chinese Family with Hidradenitis Suppurative.

Chengling Liu1, Xingchen Liu2, Rui Wang1, Lang Chen3, Hua Zhao1, Yong Zhou1.   

Abstract

Objective: Hidradenitis suppurativa (HS) is a rare autosomal dominant condition characterized by inflamed nodules, cysts, deep abscesses, draining sinuses in the axillae, inguinal, and anogenital regions. Mutations in the NCSTN gene have been perceived to be responsible for the major underlying changes in the disorder. The purpose of this study is to identify a novel gene mutation in a Chinese family with HS.
Methods: A Chinese family with HS present was investigated. The proband had manifested with multiple draining sinuses on the posterior neck, chest, bilateral axillae, and perineal regions. DNA was isolated from the peripheral blood of the family members. The encoding exons with introns of the NCSTN gene were analyzed by polymerase chain reactions (PCR) and direct DNA sequencing. Sanger sequencing was performed to confirm the next-generation sequencing results and to analyze each mutation's familial segregation. Furthermore, the identified mutation was localized onto a 3D structure model using the DeepView Swiss-PdbViewer 4.1 software.
Results: In this family comprising 10 HS patients, one novel mutation of the NCSTN gene was identified, involving a deletion mutation (c.447delC(p.N150Ifs∗52)) in the NCSTN gene resulting in a frameshift and the new formation of a hydrogen bond.
Conclusion: Our study reports the identification of a novel mutation that causes familial HS and could expand the spectrum of mutations in the γ-secretase genes underlying HS.
Copyright © 2022 Chengling Liu et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35368949      PMCID: PMC8970804          DOI: 10.1155/2022/1540774

Source DB:  PubMed          Journal:  J Healthc Eng        ISSN: 2040-2295            Impact factor:   2.682


1. Introduction

Hidradenitis suppurativa (HS), or acne inversa, is a chronic-recurrent, inflammatory, debilitating skin disease caused by occlusion of the apocrine sweat glands that usually presents after puberty [1]. HS lesions mostly occur in the axillae, inguinal, and anogenital regions involving the apocrine gland-bearing areas of the body. The manifestations of HS are inflamed nodules, cysts, deep abscesses, draining sinuses, and scars which can exert profoundly negative effects on quality of life both psychologically and physically. According to the global epidemiological survey, the prevalence of HS ranges from 0.03% to 4% [2]. The prevalence of HS is high in America reaching 4.1%. While in Asia, the prevalence is about 0.05%. [3-5] Moreover, a significant gender bias with three times more occurrences in women is also observed [6]. The etiology and pathogenesis of HS still remain obscure. Notwithstanding, the factors including genetic susceptibility, immunity, age, BMI, smoking status, employment status, and income are majorly perceived to be associated with the development and exacerbation of HS [7]. HS lesions contain increased expression of inflammatory cytokines such as tumor necrosis factor-α, interleukin(IL)-17, IL-1β, IL-23, interferon-γ. Furthermore, the keratinocytes involved with the damage follicles with HS patients release considerably more chemokines and cytokines (such as TNF-α and IL-1β) [8]. All these findings imply that the disturbed balance of Th1/Th17 as well as the innate immune response may play a critical role in the inflammation of HS [9, 10]. Meanwhile, the biologic agents targeting various cytokines such as TNF-α antagonists (adalimumab) and IL-17 antagonists (secukinumab) as probable therapies have received great effort in the real world [11, 12]. However, over one-third of the patients reporting family history suggests genetic and hereditary factors play a consistently larger role than other factors; furthermore, an autosomal dominant inheritance pattern has been identified [13]. The most predominant culprit of the HS has been noted as mutations of four subunits of γ-secretase (presenilin (PSEN1), presenilin enhancer-2 (PSENEN), nicastrin (NCSTN), and anterior pharynx defective 1 (Aph-1)). γ-secretase mutations were first discovered in the familial HS of six Chinese families in 2010 [14]. Since then, a large number of unique gene mutations have been published in recent years. In a study of a large HS cohort, the prevalence of gamma-secretase was estimated to be 6.4 percent [15]. Patients with HS who have a mutation in the gamma-secretase gene may develop severe and extensive skin lesions [15]. However, the specific mechanism of the correlation between gene mutation and disease severity is unclear. Further mechanisms need to be studied. Here, we report a novel mutation of HS in a three generation Chinese family.

2. Materials and Methods

2.1. Ethical Statement

The research protocol was approved by the Ethical Committee of the Chinese PLA general hospital, China (No. S2021-199-01). Written informed consent for the diagnostic procedures, including whole-genome sequencing, was obtained from all participants in accordance with the Declaration of Helsinki.

2.2. The Pedigree

One Chinese family was included in the present study. A three-generation pedigree was drawn for the family, as shown in Figure 1. This family with HS was ascertained via identification of the proband at the department of Dermatology of the First Medical Center of Chinese PLA General Hospital. As can be seen from the pedigree, the disease appears in every generation, regardless of male or female. Such characteristics are in line with the genetic law of autosomal dominant inheritance. The family consisted of three generations, including 20 individuals, of which ten developed HS (50% male), and ten did not. Most of the affected individuals presented with a history of multiple draining sinuses on the posterior neck, chest, bilateral axillae, and perineal regions. The onset age of all the affected individuals is about 18–25. All patients of the family met the diagnostic criteria of HS.
Figure 1

The family tree indicates an autosomal dominant inheritance. Solid symbols denote affected individuals, and open symbols denote unaffected individuals. ∗Denotes individuals who were examined for gene mutation.

2.3. DNA Sample Preparation

Blood samples of six affected and one unaffected individual were collected, and genomic DNA was isolated from peripheral blood leukocytes using the QIAamp DNA Blood kit (Qiagen, Hilden, Germany), according to the manufacturer's protocol [16].

2.4. DNA Library Preparation

Each DNA sample is quantified by agarose gel electrophoresis and Nanodrop. Libraries were prepared using the Illumina standard protocol [17].In brief, three micrograms of genomic DNA were fragmented by nebulization; the fragmented DNA was repaired, an “A” was ligated to the 3′ end, Illumina adapters were then ligated to the fragments. The sample size was selected aiming for a 350–400 base pair product. The size selected product is PCR amplified (each sample is tagged with a unique index during this procedure), and the final library fragments were verified by the Nanodrop 2000 sample quantitative detector (Thermo Fisher, USA) and the Agilent 2100 biological analyzer (Agilent Technology, USA) [18, 19].

2.5. Targeted Genes Enrichment and Sequencing

The amplified DNA was captured with a related hidradenitis suppurativa gene panel using biotinylated oligo-probes (MyGenostics GenCap Enrichment technologies) [20]. The capture experiment was conducted according to the manufacturer's protocol. In brief, 1 μg DNA library was mixed with buffer BL and GenCap gene panel probe (MyGenostics, Beijing, China) and heated at 95°C for 7 min and 65°C for 2 min on a PCR machine; 23 μl of the 65°C prewarmed buffer HY (MyGenostics, Beijing, China) was then added to the mix, and the mixture was held at 65°C with PCR lid heat on for 22 hours for hybridization [21]. 50 μl of MyOne beads (Life Technology) were washed in 500 μL of 1X binding buffer three times and resuspended in 80 μl of 1X binding buffer. 64 μl 2X binding buffer was added to the hybrid mix and transferred to the tube with 80 μl of MyOne beads. The mix was rotated for 1 hour on a rotator. The beads were then washed with WB1 buffer at room temperature for 15 minutes once and with WB3 buffer at 65°C for 15 minutes three times. The bound DNA was then eluted with buffer elute. The eluted DNA was finally amplified for 15 cycles using the following program: 98°C for 30 s (1 cycle); 98°C for 25 s, 65°C for 30 s, 72°C for 30 s (15 cycles); and 72°C for 5 min (1 cycle). The PCR product was purified using SPRI beads (Beckman Coulter) according to the manufacturer's protocol [22]. The enrichment libraries were sequenced on the Illumina HiSeq 2000 sequencer for paired-read 100 bp [23].

2.6. Bioinformatics Analysis

After HiSeq 2000 sequencing, high-quality reads were retrieved from raw reads by filtering out the low-quality reads and adaptor sequences using the SolexaQA package and the Cutadapt program (https://code.google.com/p/cutadapt/), respectively [24, 25]. The SOAPaligner program was then used to align the clean read sequences to the human reference genome (hg19; https://genome.ucsc.edu) [26, 27]. After the PCR duplicates were removed by the Picard software, the SNPs were first identified using the SOAPsnp program (https://soap.genomics.org.cn/soapsnp.html) [28]. Subsequently, we realigned the reads to the reference genome using BWA (https://bio-bwa.sourceforge.net/) and identified the insertions or deletions (InDels) using the GATK program (https://www.broadinstitute.org/gsa/wiki/index.php/Home_Page) [29] to filter variants. The filtered standard as follows: (a) variants with mapping qualities <30; (b) the total mapping quality zero reads <4; (c) approximate read depth <5; (d) QUAL < 50.0; (e) phred-scaled pvalue using Fisher's exact test to detect strand bias >10.0. After that the identified SNPs and InDels were annotated using the Exome-assistant program (https://122.228.158.106/exomeassistant) [30]. MagicViewer was used to view the short read alignment and validate the candidate SNPs and InDels [31]. Nonsynonymous variants were evaluated by four algorithms: Ployphen, SIFT, PANTHER, and Pmut, as described previously to determine pathogenicity [32-34].

3. Variants Selected

In this course, five steps using to select the potential pathogenic mutations in downstream analysis: Mutation reads should be more than 10, and mutation ration should be no less than 30% If the mutations existed in in normal database (MyGenostics), then dropped; keep the pathogenic/likely pathogenic variants which are recorded in HGMD, ClinVar, Clingen, ClinGen, or MyGenostics in-house database [35] Filtering the variants by normal population frequency; the standards of population frequency are as follows: the autosomal recessive (AR) minimum allele frequency (MAF) of the variants is ≤2% or absence in these databases, and the autosomal dominant (AD) MAF is ≤0.1% or absence in these databases Removing the synonymous The variants identified as the candidate etiologies were classified into “pathogenic,” “likely pathogenic,” “uncertain significance,” “likely benign,” and “benign” according to the American College of Medical Genetics and Genomics and the Association for Molecular Pathology

3.1. Sanger Sequencing Validation

PCR amplification was optimized in accordance with the standard PCR protocol using FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science) [36]. The sequencing reaction was performed using the BigDye® v.1.1 Terminator cycle sequencing kit and the ABI Prism® 3130xl Genetic Analyzer (Life Technologies) [37, 38]. Forward and reverse primers used are listed in Table 1.
Table 1

Primer sequences.

GenePrimerSequences (5′–3′)
NCSTNForwardCTGCTCATCCCTTCCCTCTC
ReverseCCAGAAGAATGAGCCACCCT

3.2. Molecular Modeling for the NCSTN Protein

We used the computer-generated protein software Swiss-PbdViewer 4.0 (https://www.swissmodel.expasy.org/) to analyze a novel mutation localized in the NCSTN protein [39]. Further structure analyses were performed to predict the possible alternation upon this changed novel mutation.

4. Results

4.1. Clinical Examination

The proband of this family is a 23-year-old Chinese male, who presented with a five-year history of multiple draining sinuses in the posterior neck, chest, bilateral axillae, and perineal regions (Figure 2). He received multiple antibiotics and photodynamic therapy with limited efficiency. The patient had neither a history of smoking nor being overweight.
Figure 2

Clinical features (a) of the hidradenitis suppurative family.(b) The proband showed multiple inflamed nodules, (c) atrophic scarring, cysts, deep abscesses, draining sinuses on the posterior neck, bilateral (d) axillae and buttock. (e) The faher of the proband showed extensive comedones over his neck and chest with exudation, reticulate hyperpigmentation in both side of the axilla.

Skin examination presented prominent hypertrophic scarring of the posterior neck, chest, bilateral axillae, and the buttock, with scattered fluctuant subcutaneous nodules, deep dermal abscess, and sinus tracts on bilateral buttock. Laboratory findings at admission include leukocytosis (12.9 × 10^9/L) with increased neutrophils. Streptococcus sanguis was cultured from the pus of the sinus tracts, and blood cultures were negative.

4.2. Mutation Analysis and Protein Model Rebuilding

Whole-exome sequencing of peripheral blood genomic DNA from the patients revealed a cytosine deletion in NCSTN (c.447delC(p.N150Ifs∗52)), which produced a frameshift confirmed by Sanger sequencing in Figure 3. The mutation segregated with affected family members (the proband, his brother, his father, his sister, and his female cousin), but not with unaffected family members, and was unobserved in the control individuals. More importantly, the p.N150I mutation does not appear in the Human Genetic Variation Database or in the gnomAD Database. According to the ACMG variant classification guidelines [40-42], the mutation predicts the mutation to be “pathogenic.” We did not identify potentially pathogenic mutations in any other genes implicated in HS. Swiss-PbdViewer 4.0 analysis also confirmed that the mutation causes a critical conformational alteration. In our study, the novel frameshift mutation p.N150I was found to be located near a greasy pocket in the core of the small lobe of the NCSTN gene. The mutant ILE150 is implicated in the formation of a hydrogen bond with MET 152. The charge supplied at this location might create repulsion between the mutant residue and its neighbors. In the presence of the frameshift mutation p.N150I, the lid which contributes to the substrate recruitment could be disturbed after the creation of the new hydrogen bond.
Figure 3

c.447delC(p.N150Ifs52) in (a) the family and wild-type sequence of the (b) gene mutation Structural features of the modeled NCSTN protein on the DeepView Swiss-PdbViewer 4.1 software. (c) Panel displays wild-type NCSTN. (d) Panel displays mutated-type NCSTN. (e) For wild-type. (f) For mutate-type for the partial, enlarged view.

5. Discussion

In this study, we examined gamma-secretase complex variants in 7 familial HS patients and found one pathogenic variant in the NCSTN gene. The variant, which is a heterozygous single-nucleotide deletion in exon 5, has not been reported before. The nucleotide change causes a frameshift, and it is predicted to result in a new hydrogen bond and repulsion between the mutant and its neighbors. HS is a chronic recurrent inflammatory follicular occlusive disease with deep-seated, inflamed, and painful lesions involving draining sinuses, bridged scars, and tombstone open comedones in the apocrine gland-bearing areas of the body. At the moment, according to the European Academy of Dermatology and Venerology and the United States and Canadian Hidradenitis Suppurativa Foundations [11, 43], the diagnostic criteria for HS contain the history of repetitive suppurating or painful inflammatory lesions; typical clinical manifestations; a family history of HS; and the typical histopathology of the lesions. Patients with HS can be diagnosed with the first two criteria. Patients with familial HS can be diagnosed with the third criteria. The last criteria is valuable for discriminating HS from other similar disorders. From the abovementioned criteria, our proband was diagnosed with familial HS. The incidence of suppurative keratitis is high in America; however, Wu et al. [44] concluded that in a summary of the cases of mutated NSCTN gene in HS, Asian cases accounted for 16 out of 27 (Chinese and Japanese) which may imply that the NSCTN mutation has a high incidence in Asian HS patients for unknown reasons. The pathology of HS remains unclear. HS is conceived to be related to substantial factors, including obesity, smoking, and genetic susceptibility. In the early stage, Wang et al. [14] found that mutations in γ-secretase genes are related to the pathogenesis of the HS. Mature γ-secretase is a four-component intramembrane protease (including PSEN1, PSENEN, NCSTN, and Aph-1) and catalyzes the cleavage of a wide range of transmembrane proteins, including β-amyloid precursor and Notch [45]. Simultaneously, nicastrin is a 709-residue, type-I membrane protein and is the largest of the four domains and essential component of the γ-secretase complex, which encodes an integral membrane protein associating with the catalytic subunit of γ-secretase, Presenilin [46]. The type I transmembrane (TM) glycoprotein has three lobes: a big, a small, and a single TM. Nicastrin ectodomain contains about 11 glycans and comprises the extracellular portion of γ-secretase, which could experience a dramatic conformational shift during assembly into the γ-secretase complex and contribute significantly to the substrate recognition and binding [47-49]. Notably, most of the missense, nonsense, and frameshift mutations reported in the gene NCSTN are all located within the nicastrin ectodomain [50]. In the wild-type of the NCSTN, Tyr 152, together with the other four amino, forms a hydrophilic pocket covered by a lid. In contrast, the mutate type alters the Tyr 152 to the Met 152, which could influence the stability of the pocket. In light of the function that nicastrin ectodomain is related to the substrate recruitment, recognition, and binding, researchers perceive that the mutations of NCSTN alter the spatial structure of nicastrin ectodomain, breaking the pocket or preventing the lid from opening, impeding substrate binding, and intramembrane cleavage of specific proteins by γ-secretase [51]. The intracellular domain of Notch must be cleaved by γ-secretase complex for signal transduction. After that, the Notch enters the nucleus and transactivates the expression of genes involved in epidermal and follicular differentiation and proliferation [52]. In recent studies, either deletion of γ-secretase or inhibition of Notch could produce a phenotype similar to HS in humans, followed by abnormal follicular keratinization and epidermal hyperplasia. Analogously, a recent study demonstrated that defective expression of NCSTN leading to the decreased miR-100-5p expression could promote proliferation and inhibit differentiation of keratinocytes mainly through the Notch and PI3K-AKT signaling pathways [53-57]. Homoplastically, Yang first established a K5-specific NCSTN conditional knockout mouse model to find IL-36a, along with Sprr2 (member of the small proline-rich protein two family), which might play a critical role in the pathogenesis of HS [58]. Additionally, Vossen [59] found that NCSTN and its coexpressed genes ARNT and PPARD have immunobiological roles that relate genetics to the most frequent environmental and metabolic HS risk factors, which include smoking and obesity. Mutations in the NCSTN gene are commonly found in HS, with multiple research studies reporting their involvement in hidradenitis suppurativa pathogenesis. According to the documents in the PubMed concerning the novel mutations in the HS, more than 40 mutations in the NCSTN gene have been identified [50, 59, 60], of which ten mutations resulted in the frameshift. The majority of NCSTN mutations could result in a frameshift and premature translation halt, potentially impairing the γ-secretase complex's stability. So far, four mutations in exon 5 of NCSTN that cause HS have been documented, including two frameshifts, one nonsense mutation, and one missense variant [44, 53, 61, 62]. The frameshift mutation, c.487delC, in exon 5 produced haploinsufficiency and reductions in NCSTN transcript levels in HS patients, resulting in early termination of the codon (p.Gln163SerfsX39) [62]. Equally, we identified another novel frameshift mutation (c.447delC(p.N150Ifs∗52)) in exon 5 of NCSTN in our research, which has never been identified. Furthermore, in the family, the patients with the NCSTN mutation all had the manifestation of the HS, the unaffected family member who lacked the mutation was normal, identifying the genotype-phenotype relationship in this HS family and this new mutation might provide clues and directions for further mechanism studies. As for the treatments, unfortunately, biological agents have yet to be approved in the treatment of HS by the State Administration in China, and it is only a matter of time. Little research has been carried out on new locus mutations and biotherapy. However, Cao et al. [63] found that the expression of genes involved in the type I interferon response pathway was considerably elevated in the keratinocyte NCSTN knockdown cell line. Hence, it can be safe and efficient to treat HS patients with NSCTN gene mutation by the TNF-α antagonists (adalimumab). However, more in vitro and in vivo trials and clinical studies are needed to investigate the relationship between biological agents and mutations. And future experiments will focus on the mechanism by which the new mutation takes effect on the NCSTN gene by the cell lines in vitro and whether the new mutation will be a driver gene to guideline the treatment for HS in the future.

6. Conclusion

In conclusion, we investigated a three-generation Chinese family with HS and autosomal dominant inheritance. Our research extends the gene database of HS in China and allows people to understand the possible mechanism of the development of HS. In light of the critical phenotypic heterogeneity, a larger size of the samples is required to identify other mutations, and the ongoing efforts to find the downstream signaling pathways could benefit from finding more novel therapeutic targets.
  63 in total

Review 1.  The many substrates of presenilin/γ-secretase.

Authors:  Annakaisa Haapasalo; Dora M Kovacs
Journal:  J Alzheimers Dis       Date:  2011       Impact factor: 4.472

2.  European S1 guideline for the treatment of hidradenitis suppurativa/acne inversa.

Authors:  C C Zouboulis; N Desai; L Emtestam; R E Hunger; D Ioannides; I Juhász; J Lapins; L Matusiak; E P Prens; J Revuz; S Schneider-Burrus; J C Szepietowski; H H van der Zee; G B E Jemec
Journal:  J Eur Acad Dermatol Venereol       Date:  2015-01-30       Impact factor: 6.166

3.  Necrotic enteritis challenge regulates peroxisome proliferator-1 activated receptors signaling and β-oxidation pathways in broiler chickens.

Authors:  Kosar Gharib-Naseri; Sara de Las Heras-Saldana; Sarbast Kheravii; Lihong Qin; Jingxue Wang; Shu-Biao Wu
Journal:  Anim Nutr       Date:  2020-12-17

4.  Analysis of cf-mtDNA and cf-nDNA fragment size distribution using different isolation methods in BV-2 cell supernatant of starvation-induced autophagy.

Authors:  Yuxiang Gong; Qin Huang; Yuping Deng; Liyan Zhou; Xiaoqing Yi; Jiajin Zhu; Wenhe Wu
Journal:  Biochim Biophys Acta Mol Cell Res       Date:  2021-09-30       Impact factor: 4.739

5.  Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Authors:  Sue Richards; Nazneen Aziz; Sherri Bale; David Bick; Soma Das; Julie Gastier-Foster; Wayne W Grody; Madhuri Hegde; Elaine Lyon; Elaine Spector; Karl Voelkerding; Heidi L Rehm
Journal:  Genet Med       Date:  2015-03-05       Impact factor: 8.822

6.  SNP Mining in Functional Genes from Nonmodel Species by Next-Generation Sequencing: A Case of Flowering, Pre-Harvest Sprouting, and Dehydration Resistant Genes in Wheat.

Authors:  Zhong-Xu Chen; Mei Deng; Ji-Rui Wang
Journal:  Biomed Res Int       Date:  2016-03-14       Impact factor: 3.411

7.  Identification of a novel GJA3 mutation in a large Chinese family with congenital cataract using targeted exome sequencing.

Authors:  Yihua Yao; Xuedong Zheng; Xianglian Ge; Yanghui Xiu; Liu Zhang; Weifang Fang; Junzhao Zhao; Feng Gu; Yihua Zhu
Journal:  PLoS One       Date:  2017-09-06       Impact factor: 3.240

8.  Hidradenitis suppurativa/acne inversa: a practical framework for treatment optimization - systematic review and recommendations from the HS ALLIANCE working group.

Authors:  C C Zouboulis; F G Bechara; J L Dickinson-Blok; W Gulliver; B Horváth; R Hughes; A B Kimball; B Kirby; A Martorell; M Podda; E P Prens; H C Ring; T Tzellos; H H van der Zee; K R van Straalen; A R J V Vossen; G B E Jemec
Journal:  J Eur Acad Dermatol Venereol       Date:  2018-10-23       Impact factor: 6.166

9.  Sequence variations, flanking region mutations, and allele frequency at 31 autosomal STRs in the central Indian population by next generation sequencing (NGS).

Authors:  Hirak Ranjan Dash; Kamlesh Kaitholia; R K Kumawat; Anil Kumar Singh; Pankaj Shrivastava; Gyaneshwer Chaubey; Surajit Das
Journal:  Sci Rep       Date:  2021-12-01       Impact factor: 4.379

10.  Composition of fecal microbiota in low-set rectal cancer patients treated with FOLFOX.

Authors:  Jing Li; Jingtao Li; Na Lyu; Yue Ma; Fei Liu; Yuqing Feng; Li Yao; Zhiyong Hou; Xiaofeng Song; Hongchuan Zhao; Xiaoya Li; Yingdian Wang; Cheng Xiao; Baoli Zhu
Journal:  Ther Adv Chronic Dis       Date:  2020-02-26       Impact factor: 5.091

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.