Xinyu Huang1, Yingcheng Yao1, Xiaoli Hou1, Li Wei1, Yuhan Rao1, Yu Su1, Guo Zheng1, Xiong Z Ruan2, Danyang Li3, Yaxi Chen4. 1. Centre for Lipid Research & Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Institute for Viral Hepatitis, Department of Infectious Diseases, Second Affiliated Hospital, Chongqing Medical University, Chongqing, China. 2. Centre for Lipid Research & Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Institute for Viral Hepatitis, Department of Infectious Diseases, Second Affiliated Hospital, Chongqing Medical University, Chongqing, China; John Moorhead Research Laboratory, Centre for Nephrology, University College London Medical School, Royal Free Campus, University College London, London, United Kingdom. 3. Centre for Lipid Research & Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Institute for Viral Hepatitis, Department of Infectious Diseases, Second Affiliated Hospital, Chongqing Medical University, Chongqing, China. Electronic address: lidycq@cqmu.edu.cn. 4. Centre for Lipid Research & Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Institute for Viral Hepatitis, Department of Infectious Diseases, Second Affiliated Hospital, Chongqing Medical University, Chongqing, China. Electronic address: chenyaxi@cqmu.edu.cn.
Abstract
BACKGROUND & AIMS: Sterol regulatory element binding protein cleavage-activating protein (SCAP) is a cholesterol sensor that confers a broad range of functional effects in metabolic diseases. Lean nonalcoholic fatty liver disease (NAFLD) is characterized by a decrease in subcutaneous fat and ectopic fat deposition in the liver. SCAP may mediate the development of lean NAFLD, but the mechanism of action remains unclear. METHODS: C57BL/6J wild-type and macrophage SCAP-specific knockout mice (SCAPΔMϕ) were subjected to Paigen diet (PD) feeding induced lean NAFLD. Inflammation and lipid metabolism of adipose and liver were evaluated. The STING-NF-κB signaling pathway was examined in vivo and in vitro to explore the underlying mechanism of macrophage SCAP on metaflammation. RESULTS: The data showed heterogeneity of lipid metabolic processes in liver and epididymal white adipose tissue due to inflammation mediated by macrophage infiltration. Meanwhile, we found that the macrophage SCAP was abnormally increased in the adipose and liver tissues of PD-fed mice. Intriguingly, the SCAPΔMϕ mice attenuated PD-induced metaflammation and ectopic lipid deposition by reducing hepatic stimulator of interferon gene (STING)-nuclear factor kappa B (NF-κB) pathway activation. In-depth molecular analysis revealed that SCAP specifically recruits the STING and tank-binding kinase 1 onto the Golgi to activate the NF-κB in macrophages, thereby promoting the release of inflammatory factors. This process ultimately led to an increased lipolysis in adipocytes and lipid uptake and synthesis in hepatocytes. CONCLUSIONS: Our findings suggest that SCAP acts as a novel regulator of the macrophage inflammatory response and the pathogenesis of lean NAFLD by activating the STING-NF-κB signaling pathway. Inhibition of macrophage SCAP may represent a new therapeutic strategy for the treatment of lean NAFLD.
BACKGROUND & AIMS: Sterol regulatory element binding protein cleavage-activating protein (SCAP) is a cholesterol sensor that confers a broad range of functional effects in metabolic diseases. Lean nonalcoholic fatty liver disease (NAFLD) is characterized by a decrease in subcutaneous fat and ectopic fat deposition in the liver. SCAP may mediate the development of lean NAFLD, but the mechanism of action remains unclear. METHODS: C57BL/6J wild-type and macrophage SCAP-specific knockout mice (SCAPΔMϕ) were subjected to Paigen diet (PD) feeding induced lean NAFLD. Inflammation and lipid metabolism of adipose and liver were evaluated. The STING-NF-κB signaling pathway was examined in vivo and in vitro to explore the underlying mechanism of macrophage SCAP on metaflammation. RESULTS: The data showed heterogeneity of lipid metabolic processes in liver and epididymal white adipose tissue due to inflammation mediated by macrophage infiltration. Meanwhile, we found that the macrophage SCAP was abnormally increased in the adipose and liver tissues of PD-fed mice. Intriguingly, the SCAPΔMϕ mice attenuated PD-induced metaflammation and ectopic lipid deposition by reducing hepatic stimulator of interferon gene (STING)-nuclear factor kappa B (NF-κB) pathway activation. In-depth molecular analysis revealed that SCAP specifically recruits the STING and tank-binding kinase 1 onto the Golgi to activate the NF-κB in macrophages, thereby promoting the release of inflammatory factors. This process ultimately led to an increased lipolysis in adipocytes and lipid uptake and synthesis in hepatocytes. CONCLUSIONS: Our findings suggest that SCAP acts as a novel regulator of the macrophage inflammatory response and the pathogenesis of lean NAFLD by activating the STING-NF-κB signaling pathway. Inhibition of macrophage SCAP may represent a new therapeutic strategy for the treatment of lean NAFLD.
In the mouse model of lean NAFLD induced by Paigen diet, macrophage SCAP was abnormally increased and led to severe metaflammation through activating STING–NF-κB signaling pathway. The metaflammation increased lipolysis in the adipose and enhanced hepatic lipid uptake and synthesis, consequently resulting in ectopic lipid deposition in the liver and hepatic injury.Nonalcoholic fatty liver disease (NAFLD) is commonly considered to be associated with obesity. However, NAFLD has also been increasingly reported in persons with lean NAFLD, with a body mass index (BMI) <25 kg/m2 for Western subjects and BMI <23 kg/m2 for Eastern subjects. The current rate of nonobese NAFLD is 36%–45%, and lean NAFLD is 7%–23% in the global NAFLD population,1, 2, 3, 4 and the morbidity of lean NAFLD in Eastern countries is much higher than that of Western countries.4, 5, 6, 7 Lean NAFLD is defined as a “metabolically unhealthy normal weight” NAFLD, which is characterized by a decrease in subcutaneous fat and ectopic fat deposition in the liver. Thus, the location and type of obesity have a more significant impact on an individual’s metabolic health than the total mass of fat. Although patients with lean NAFLD are not obese, they are still susceptible to metabolic syndrome, similar to that of obese NAFLD., There are reports that lean NAFLD has an increased risk for the development and progression of severe liver disease., The pathogenesis of lean NAFLD appears complex and is still poorly understood.Compared with obese patients, adipose tissue dysfunction of patients with lean NAFLD exhibits a higher adverse adipokine profile, ultimately leading to systemic chronic low-grade inflammation, also known as metaflammation., Moreover, enriched cholesterol dietary patterns cause disturbances in the intestinal microbial environment, which may be necessary for the progression of lean NAFLD.15, 16, 17 These phenomena are almost consistent with another study that shows the use of a cholesterol-rich Paigen diet (PD) to induce a NAFLD model with weight loss and significant systemic inflammation. Consequently, it is reasonable to speculate that cholesterol homeostasis and metaflammation play critical roles in the pathogenesis of lean NAFLD.Sterol regulatory element binding protein (SREBP) cleavage-activating protein (SCAP) is a cholesterol sensor that regulates signal transduction for intracellular cholesterol homeostasis., Dysregulation of SCAP could affect the development of metabolic disease. Our previous studies demonstrated that inflammatory factors increase the expression of SCAP and promote the translocation of the SCAP/SREBP2 complex from the endoplasmic reticulum (ER) to the Golgi, which destroys intracellular cholesterol homeostasis and leads to atherosclerosis, and NAFLD. We also discovered that crosstalk between the SCAP/SREBP and TLR4-MyD88-NF-κB inflammatory pathways mediates macrophage foam cell formation in atherosclerosis., Moreover, we found that SCAP overexpression promotes SCAP and NLRP3 inflammasome translocation to the Golgi and increases the activation of the NLRP3 inflammasome pathway, consequently accelerating atherosclerosis. These findings suggest that SCAP is a crucial bridge molecule connecting lipid metabolism and inflammation, which represents an attractive target for the treatment of metabolic diseases. In view of the important role of SCAP in regulating cholesterol metabolism and inflammation, we hypothesize that the abnormal function of SCAP may result in the occurrence of lean NAFLD.In this study, we successfully established a metabolic disease model characterized by lean NAFLD using a PD. Mice fed with PD developed clear weight loss and ectopic lipid deposition in the liver, accompanied by increased SCAP expression in macrophages of adipose and liver tissue. In contrast, knockout of macrophage SCAP (SCAPΔMϕ) in mice attenuated PD-induced metaflammation and ectopic lipid deposition. Mechanistically, macrophage SCAP deletion reduced adipose tissue and liver metaflammation by inhibiting stimulator of interferon gene (STING)/tank-binding kinase 1 (TBK1)–mediated nuclear factor kappa B (NF-κB) inflammatory signaling activation, consequently improving metabolic syndrome. Our findings provide new mechanistic insight into the pathogenesis of lean NAFLD, suggesting that inhibition of macrophage-specific expression of SCAP might be a potential therapeutic target for patients with lean NAFLD.
Results
Nonobese Metabolic Syndrome Induced by PD Feeding Features Lean NAFLD
After C57/BL6 mice were fed either normal chow (NCD) or PD for 12 weeks, compared with the NCD control group, the body weight of the mice was clearly decreased in the PD-fed group (Figure 1A), which was accompanied by marked manifestations of metabolic syndrome, hyperlipidemia, impaired glucose tolerance, and insulin sensitivity (Figure 1B–D). To clarify the cause of weight loss in PD-fed mice, we evaluated the weight of critical internal organs. PD-fed mice displayed increased liver weight with significant reduction in epididymal white adipose tissue (eWAT) weight (Figure 1E and F). Further analysis of these 2 organs revealed evident morphologic alterations in tissue architecture. H&E staining showed that adipocytes were smaller in eWAT, and hepatocyte steatosis and lobular inflammatory infiltration were clearer in the PD-fed mice than in NCD-fed mice (Figure 1E and F). Meanwhile, Oil Red O staining showed obvious intracellular hepatocyte accumulation of neutral lipids in the PD-fed mice (Figure 1G). Increased intrahepatic total cholesterol (TC) and triglyceride (TG) contents confirmed these morphologic changes in liver of PD-fed mice (Figure 1H). These data indicate that nonobese metabolic syndrome induced in PD-fed mice features lean NAFLD, hyperlipidemia, glucose intolerance, and impaired insulin sensitivity.
Figure 1
Nonobese metabolic syndrome induced by PD feeding features lean NAFLD. (A) Body weight gain curves of mice fed 12-week NCD and PD (n = 6). (B) Levels of total TG, TC, HDL cholesterol, and LDL in plasma (n = 6). Intraperitoneal GTT levels (C) and intraperitoneal ITT levels (D) in NCD- and PD-fed mice (n = 6). (E) Representative pictures and H&E staining of eWAT, and the histogram represents eWAT/body weight (n = 6). (F) Representative pictures and H&E staining of liver tissues, and the histogram represents liver/body weight (n = 6). (G) Representative images of Oil Red O staining in liver tissues (n = 6). (H) Levels of intrahepatic TC and TG (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs and two-way analysis of variance in body weight, GTT, and ITT curves).
Nonobese metabolic syndrome induced by PD feeding features lean NAFLD. (A) Body weight gain curves of mice fed 12-week NCD and PD (n = 6). (B) Levels of total TG, TC, HDL cholesterol, and LDL in plasma (n = 6). Intraperitoneal GTT levels (C) and intraperitoneal ITT levels (D) in NCD- and PD-fed mice (n = 6). (E) Representative pictures and H&E staining of eWAT, and the histogram represents eWAT/body weight (n = 6). (F) Representative pictures and H&E staining of liver tissues, and the histogram represents liver/body weight (n = 6). (G) Representative images of Oil Red O staining in liver tissues (n = 6). (H) Levels of intrahepatic TC and TG (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs and two-way analysis of variance in body weight, GTT, and ITT curves).
Lean NAFLD Induced by PD Feeding Displays Evident Inflammation and Lipid Metabolism Disorders in eWAT and Liver
Previous studies indicated that PD-fed mice had more severe systemic inflammation. We observed similar phenomena in the mouse models. Our data showed that macrophages significantly infiltrated in eWAT and liver tissues of the PD-fed mice. The expression and secretion of interleukin (IL) 1β, IL6, tumor necrosis factor (TNF) α, and monocyte chemoattractant protein-1 (MCP-1) were increased in both tissues of PD-fed mice (Figure 2A–G). Meanwhile, plasma alanine aminotransferase (ALT) levels were significantly elevated in the PD-fed mice (Figure 2H).
Figure 2
Lean NAFLD induced by PD feeding displays evident inflammation in eWAT and liver. (A) Immunohistochemical staining of F4/80+ cells in eWAT (n = 6). (B) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in eWAT (n = 6). (C) Immunohistochemical staining of F4/80+ cells in liver tissues (n = 6). (D) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). Enzyme-linked immunosorbent assay analysis of protein expression of IL1β, IL6, and TNF-α in eWAT (E) and in liver tissues (F) (n = 6). (G) Protein levels of TNF-α, IL1β, and IL6 in liver tissues (n = 6). (H) Levels of ALT and aspartate aminotransferase in plasma (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Lean NAFLD induced by PD feeding displays evident inflammation in eWAT and liver. (A) Immunohistochemical staining of F4/80+ cells in eWAT (n = 6). (B) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in eWAT (n = 6). (C) Immunohistochemical staining of F4/80+ cells in liver tissues (n = 6). (D) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). Enzyme-linked immunosorbent assay analysis of protein expression of IL1β, IL6, and TNF-α in eWAT (E) and in liver tissues (F) (n = 6). (G) Protein levels of TNF-α, IL1β, and IL6 in liver tissues (n = 6). (H) Levels of ALT and aspartate aminotransferase in plasma (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).Because the subtle balance among lipid uptake, synthesis, and lipolysis is relevant for intracellular lipid content in adipocytes and hepatocytes, we further examined the mRNA levels of key genes of lipid metabolism. Interestingly, we found that eWAT and liver tissues exhibited different phenotypes of lipid metabolism disorders under PD-induced inflammation state; the adipose tissue was characterized by increased lipolysis (ATGL, HSL, and MGL mRNA were significantly up-regulated), synthesis (SCD1, SREBP2, and FASN mRNA were increased), and lipid uptake (CD36 and FATP5 mRNA were increased) (Figure 3A–C). However, the liver was characterized by decreased lipolysis (ATGL, HSL, MGL, and PLIN1 mRNA were significantly down-regulated) and increased synthesis (SCD1, SREBP2, ACC1, and FASN mRNA were increased) and lipid uptake (CD36 and FATP5 mRNA were increased) (Figure 3D–F). These data suggest that PD-induced inflammation in the liver and eWAT, as well as consequent different features of lipid disorders between the organs, is a critical process in the pathogenesis of lean NAFLD.
Figure 3
Lean NAFLD induced by PD feeding displays evident lipid metabolism disorders in eWAT and liver. Relative mRNA levels of lipolysis (A), lipid synthesis (B), and lipid uptake (C) in eWAT (n = 6). Relative mRNA levels of lipolysis (D), lipid synthesis (E), and lipid uptake (F) in liver tissues (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Lean NAFLD induced by PD feeding displays evident lipid metabolism disorders in eWAT and liver. Relative mRNA levels of lipolysis (A), lipid synthesis (B), and lipid uptake (C) in eWAT (n = 6). Relative mRNA levels of lipolysis (D), lipid synthesis (E), and lipid uptake (F) in liver tissues (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP Expression Is Abnormally Increased in eWAT and Liver Tissues of PD-Fed Mice
Systemic inflammation and dysregulation of metabolic homeostasis are the key events in the initiation of lean NAFLD. SCAP has been previously documented as a signaling hub integrating cholesterol metabolism with inflammation in macrophages. We further observed the expression of macrophage SCAP in PD-fed mice. Macrophage SCAP expression was higher in the eWAT and liver tissues of PD-fed mice using the detection method of immunofluorescence and flow cytometry (Figure 4A–C). To conclusively establish the role of abnormally activated macrophage SCAP in lean NAFLD, we generated macrophage/monocyte-specific SCAP knockout mice LysM-Cre+SCAPfl/fl (SCAPΔMϕ). The genotype of mice was determined by polymerase chain reaction using tail tissues. Successful deletion of macrophage SCAP in SCAPΔMϕ mice was confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) analysis using isolated primary bone marrow-derived macrophage cells from the marrow (Figure 4D–F). The SCAPΔMϕ mice and the SCAPfl/fl control mice were subjected to a 12-week PD-feeding protocol to observe improvement in steatohepatitis and a 16-week PD-feeding protocol to observe improvement in liver fibrosis (Figure 4G).
Figure 4
Macrophage SCAP expression is abnormally increased in eWAT and liver tissues of PD-fed mice. (A) Immunofluorescence staining of SCAP and F4/80 in eWAT and liver tissues (n = 3). (B) Flow cytometry was used to analyze expression of SCAP in F4/80+CD11c+ macrophages of eWAT (n = 3). (C) Flow cytometry was used to analyze expression of SCAP in F4/80+CD11b+ macrophages of liver tissues (n = 3). (D) Mice with macrophage/monocyte-specific deletion of SCAP (SCAPΔMϕ mice) were generated by crossing SCAPfl/fl mice with LysM Cre mice. (E) Genotyping SCAP knockout mice by PCR showed different genotypes: SCAP+/+, SCAP+/−, SCAP−/−. (F) Relative mRNA levels of SCAP in bone marrow-derived macrophage cells. (G) Schematic outline of experimental approaches and analyses. Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP expression is abnormally increased in eWAT and liver tissues of PD-fed mice. (A) Immunofluorescence staining of SCAP and F4/80 in eWAT and liver tissues (n = 3). (B) Flow cytometry was used to analyze expression of SCAP in F4/80+CD11c+ macrophages of eWAT (n = 3). (C) Flow cytometry was used to analyze expression of SCAP in F4/80+CD11b+ macrophages of liver tissues (n = 3). (D) Mice with macrophage/monocyte-specific deletion of SCAP (SCAPΔMϕ mice) were generated by crossing SCAPfl/fl mice with LysM Cre mice. (E) Genotyping SCAP knockout mice by PCR showed different genotypes: SCAP+/+, SCAP+/−, SCAP−/−. (F) Relative mRNA levels of SCAP in bone marrow-derived macrophage cells. (G) Schematic outline of experimental approaches and analyses. Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP Deletion Improves Metabolic Syndrome and Lean NAFLD in PD-Fed Mice
First, we checked the effect of macrophage-specific SCAP knockout on the lipid homeostasis and inflammation in eWAT and liver; the results indicate that there were no differences in eWAT and liver tissue weight, pathology, inflammation, and lipid content of SCAPΔMϕ mice and SCAPfl/fl mice under NCD-feeding condition (Figure 5). Then, we observed that metabolism-related indicators, hyperlipidemia, impaired glucose tolerance, and insulin sensitivity were significantly ameliorated in SCAPΔMϕ mice of 12 weeks PD-fed, although the weight loss was not reversed (Figure 6A–D). The weight of eWAT and the size of adipocytes were increased in PD-fed SCAPΔMϕ mice (Figure 6E). Liver weight, hepatocyte lobular inflammatory infiltration, lipid accumulation, plasma TG, and intrahepatic levels were reduced in SCAPΔMϕ mice compared with SCAPfl/fl control mice (Figure 6F–H). These findings suggest that macrophage-specific deficiency of SCAP can improve metabolic syndrome and lean NAFLD in PD-fed mice.
Figure 5
Macrophage SCAP deletion does not alter eWAT and liver phenotype in NCD-fed mice. (A) Representative pictures and H&E staining of eWAT, and the histogram represents eWAT/body weight (n = 6). (B) Representative pictures and H&E staining of liver tissues, and the histogram represents liver/body weight (n = 6). (C) Immunohistochemical staining of F4/80+ cells in eWAT (n = 6). (D) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in eWAT (n = 6). (E) Immunohistochemical staining of F4/80+ cells in liver tissues (n = 6). (F) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). (G) Representative images of Oil Red O staining in liver tissues (n = 6). (H) Levels of intrahepatic TC and TG (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Figure 6
Macrophage SCAP deletion improves metabolic syndrome and lean NAFLD in PD-fed mice. (A) Body weight gain curves of SCAPfl/fl and SCAPΔMϕ mice fed 12 weeks of PD (n = 6). (B) Levels of TC, HDL, and LDL in plasma (n = 6). GTT levels (C) and ITT levels (D) in SCAPΔMϕ and SCAPfl/fl mice (n = 6). (E) Representative pictures and H&E staining of eWAT, and the histogram represents eWAT/body weight (n = 6). (F) Representative pictures and H&E staining of liver tissues, and the histogram represents liver/body weight (n = 6). (G) Representative images of Oil Red O staining in liver tissues (n = 6). (H) Levels of TG in plasma and intrahepatic TG levels (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs and two-way analysis of variance in body weight, GTT, and ITT curves).
Macrophage SCAP deletion does not alter eWAT and liver phenotype in NCD-fed mice. (A) Representative pictures and H&E staining of eWAT, and the histogram represents eWAT/body weight (n = 6). (B) Representative pictures and H&E staining of liver tissues, and the histogram represents liver/body weight (n = 6). (C) Immunohistochemical staining of F4/80+ cells in eWAT (n = 6). (D) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in eWAT (n = 6). (E) Immunohistochemical staining of F4/80+ cells in liver tissues (n = 6). (F) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). (G) Representative images of Oil Red O staining in liver tissues (n = 6). (H) Levels of intrahepatic TC and TG (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).Macrophage SCAP deletion improves metabolic syndrome and lean NAFLD in PD-fed mice. (A) Body weight gain curves of SCAPfl/fl and SCAPΔMϕ mice fed 12 weeks of PD (n = 6). (B) Levels of TC, HDL, and LDL in plasma (n = 6). GTT levels (C) and ITT levels (D) in SCAPΔMϕ and SCAPfl/fl mice (n = 6). (E) Representative pictures and H&E staining of eWAT, and the histogram represents eWAT/body weight (n = 6). (F) Representative pictures and H&E staining of liver tissues, and the histogram represents liver/body weight (n = 6). (G) Representative images of Oil Red O staining in liver tissues (n = 6). (H) Levels of TG in plasma and intrahepatic TG levels (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs and two-way analysis of variance in body weight, GTT, and ITT curves).
Macrophage SCAP Deletion Has Ameliorative Effects on Lipid Disorders and Metaflammation in the eWAT and Liver Tissue of PD-Fed Mice
Furthermore, we observed that the macrophages infiltration and expression of proinflammatory cytokines (IL1β, IL6, TNF-α, and MCP-1) were reduced in eWAT and liver tissues of SCAPΔMϕ mice (Figure 7A–G). Plasma ALT level was reduced (Figure 7H). We detected lipid uptake, synthesis, and lipolysis in eWAT and liver tissues of SCAPΔMϕ mice. In eWAT, lipolysis gene mRNA (ATGL, HSL, MGL, PLIN1) and the lipid uptake gene mRNA (CD36 and FATP5) were clearly reduced, whereas the lipid synthesis gene mRNA (FASN) was increased in PD-fed SCAPΔMϕ mice (Figure 8A–C), indicating that the lipid storage function of adipocytes was restored. In the liver, the lipid uptake gene mRNA (CD36 and FATP5) and the lipid synthesis gene mRNA (SCD1, SREBP2, ACC1, and FASN) expression levels were reversed because of macrophage SCAP deletion but had no effect on the lipolysis gene mRNA (ATGL, HSL, MGL, and PLIN1) expression (Figure 8D–F). All these data suggest that SCAP deletion in macrophages could reverse lipid disorders and metaflammation in the eWAT and liver tissue of PD-fed mice.
Figure 7
Macrophage SCAP deletion has ameliorative effects on metaflammation in eWAT and liver tissue of PD-fed mice. (A) Immunohistochemical staining of F4/80+ cells in eWAT (n = 6). (B) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in eWAT (n = 6). (C) Immunohistochemical staining of F4/80+ cells in liver tissues (n = 6). (D) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). Enzyme-linked immunosorbent assay analysis of protein expression of IL1β, IL6, and TNF-α in eWAT (E) and in liver tissues (F) (n = 6). (G) Protein levels of TNF-α, IL1β, and IL6 in liver tissues (n = 6). (H) Levels of ALT and aspartate aminotransferase in plasma (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Figure 8
Macrophage SCAP deletion has ameliorative effects on lipid disorders in eWAT and liver tissue of PD-fed mice. Relative mRNA levels of lipolysis (A), lipid synthesis (B), and lipid uptake (C) in eWAT (n = 6). Relative mRNA levels of lipolysis (D), lipid synthesis (E), and lipid uptake (F) in liver tissues (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP deletion has ameliorative effects on metaflammation in eWAT and liver tissue of PD-fed mice. (A) Immunohistochemical staining of F4/80+ cells in eWAT (n = 6). (B) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in eWAT (n = 6). (C) Immunohistochemical staining of F4/80+ cells in liver tissues (n = 6). (D) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). Enzyme-linked immunosorbent assay analysis of protein expression of IL1β, IL6, and TNF-α in eWAT (E) and in liver tissues (F) (n = 6). (G) Protein levels of TNF-α, IL1β, and IL6 in liver tissues (n = 6). (H) Levels of ALT and aspartate aminotransferase in plasma (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).Macrophage SCAP deletion has ameliorative effects on lipid disorders in eWAT and liver tissue of PD-fed mice. Relative mRNA levels of lipolysis (A), lipid synthesis (B), and lipid uptake (C) in eWAT (n = 6). Relative mRNA levels of lipolysis (D), lipid synthesis (E), and lipid uptake (F) in liver tissues (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Expression Levels of SCAP in Macrophages Also Influence Lipid Homeostasis and Inflammatory Response of Adipocytes/Hepatocytes in Vitro
Next, we attempted to identify macrophage SCAP could regulate the lipid metabolism process in vitro using the macrophage-adipocytes/hepatocytes cell coculture system. We cocultured overexpression or knockdown of SCAP in RAW264.7 macrophage cells with 3T3-L1 adipocyte cells in low-density lipoprotein (LDL) cholesterol loading medium (Figure 9A). RAW264.7 cells SCAP overexpression reduced the lipid accumulation in 3T3-L1 cells by promoting inflammatory response and up-regulating lipolysis and down-regulating lipid synthesis, although the lipid uptake was modestly increased (Figure 9B–F). These results were further supported in SCAPi RAW264.7 cells, which increased lipid accumulation by reducing inflammatory response, lipolysis, and lipid uptake, while promoting lipid synthesis in 3T3-L1 cells due to SCAP knockdown (Figure 9G–K).
Figure 9
Expression levels of SCAP in macrophages also influences lipid homeostasis and inflammatory response of adipocytes in vitro. (A) Schematic diagram of cocultivation of 3T3-L1 cells and RAW264.7 cells. (B) Oil Red O staining of LDL-treated 3T3-L1 cells cocultured with NC-SCAP or OE-SCAP RAW264.7 cells (n = 3). Relative mRNA levels of inflammation cytokine (C), lipolysis (D), lipid synthesis (E), and lipid uptake (F) in LDL-treated 3T3-L1 cells cocultured with NC-SCAP or OE-SCAP RAW264.7 cells (n = 5). (G) Oil Red O staining of LDL-treated 3T3-L1 cells cocultured with Vec-SCAP or SCAPi-RAW264.7 cells (n = 3). Relative mRNA levels of inflammation cytokine (H), lipolysis (I), lipid synthesis (J), and lipid uptake (K) in LDL-treated 3T3-L1 cells cocultured with Vec-SCAP or SCAPi-RAW264.7 cells (n = 5). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Expression levels of SCAP in macrophages also influences lipid homeostasis and inflammatory response of adipocytes in vitro. (A) Schematic diagram of cocultivation of 3T3-L1 cells and RAW264.7 cells. (B) Oil Red O staining of LDL-treated 3T3-L1 cells cocultured with NC-SCAP or OE-SCAP RAW264.7 cells (n = 3). Relative mRNA levels of inflammation cytokine (C), lipolysis (D), lipid synthesis (E), and lipid uptake (F) in LDL-treated 3T3-L1 cells cocultured with NC-SCAP or OE-SCAP RAW264.7 cells (n = 5). (G) Oil Red O staining of LDL-treated 3T3-L1 cells cocultured with Vec-SCAP or SCAPi-RAW264.7 cells (n = 3). Relative mRNA levels of inflammation cytokine (H), lipolysis (I), lipid synthesis (J), and lipid uptake (K) in LDL-treated 3T3-L1 cells cocultured with Vec-SCAP or SCAPi-RAW264.7 cells (n = 5). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).The same observations were done by using the THP-1/HepG2 cell coculture system (Figure 10A). SCAP overexpression in THP-1 cells increased HepG2 cells lipid content, proinflammatory cytokines, lipid uptake, synthesis, and lipolysis (Figure 10B–F). Conversely, SCAP knockdown in THP-1 cells reduced HepG2 cells lipid content, proinflammatory cytokines, lipid uptake, lipid synthesis, and lipolysis (Figure 10G–K). These in vitro data support the in vivo observations and further indicate that macrophage SCAP regulates lipid homeostasis and the inflammatory response in adipocytes and hepatocytes.
Figure 10
Expression levels of SCAP in macrophages also influences lipid homeostasis and inflammatory response of adipocytes in vitro. (A) Schematic diagram of cocultivation of HepG2 cells and THP-1 cells. (B) Oil Red O staining of LDL-treated HepG2 cells cocultured with NC-SCAP or OE-SCAP THP-1 cells (n = 3). Relative mRNA levels of inflammation cytokine (C), lipolysis (D), lipid synthesis (E), and lipid uptake (F) in LDL-treated HepG2 cells cocultured with NC-SCAP or OE-SCAP THP-1 cells (n = 5). (G) Oil Red O staining of LDL-treated HepG2 cells cocultured with Vec-SCAP or SCAPi-THP-1 cells (n = 3). Relative mRNA levels of inflammation cytokine (H), lipolysis (I), lipid synthesis (J), and lipid uptake (K) in LDL-treated HepG2 cells cocultured with Vec-SCAP or SCAPi-THP-1 cells (n = 5). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Expression levels of SCAP in macrophages also influences lipid homeostasis and inflammatory response of adipocytes in vitro. (A) Schematic diagram of cocultivation of HepG2 cells and THP-1 cells. (B) Oil Red O staining of LDL-treated HepG2 cells cocultured with NC-SCAP or OE-SCAP THP-1 cells (n = 3). Relative mRNA levels of inflammation cytokine (C), lipolysis (D), lipid synthesis (E), and lipid uptake (F) in LDL-treated HepG2 cells cocultured with NC-SCAP or OE-SCAP THP-1 cells (n = 5). (G) Oil Red O staining of LDL-treated HepG2 cells cocultured with Vec-SCAP or SCAPi-THP-1 cells (n = 3). Relative mRNA levels of inflammation cytokine (H), lipolysis (I), lipid synthesis (J), and lipid uptake (K) in LDL-treated HepG2 cells cocultured with Vec-SCAP or SCAPi-THP-1 cells (n = 5). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP Deletion Alleviates the Inflammatory Response in the eWAT and Liver Tissue of PD-Fed Mice via Inhibition of STING–NF-κB Signaling
To further explore the mechanisms of macrophage SCAP-induced metaflammation, we examined NF-κB inflammatory signaling pathway. First, we quantified the levels of p65 activation (phosphor-p65 and nuclear localization of p65) and found the levels of p65 phosphorylation and P65 nuclear translocation were increased in the liver of PD-fed mice, whereas they were reversed by macrophage SCAP deletion (Figure 11A). Activated IκB kinase (IKK) complex induces phosphorylation and degradation of IκBα and subsequent activation of p65 and translocation of p65 into the nucleus. We next examined the activation status of IKK. The data showed that IKK complex (IKKα and IKKβ) was phosphorylated and targeted IκBα (phosphor- IκBα) for degradation, but SCAP deletion inhibited this process (Figure 11B). We further determined that the liver and eWAT inflammation resulted from the p65 nuclear translocation in macrophage by immunofluorescence microscopy using macrophage-specific probe F4/80 and anti-P65 (Figure 11C).
Figure 11
Macrophage SCAP deletion alleviates inflammatory response in liver tissue of PD-fed mice via inhibition of STING–NF-κB signaling. (A) Protein levels of P65 and P-P65 in total liver tissues, P65 in liver nuclear and cytosol (n = 6). (B) Protein levels of IKKα, IKKβ, P-IKKα/β, IκBα, and P-IκBα in liver tissues (n = 6). (C) Immunofluorescence staining of F4/80 and P65 in liver tissues (n = 3). (D) Schematic diagram of mechanisms by which STING activates NF-κB signaling. (E) Protein levels of STING, P-TBK1, and TBK1 in liver tissues (n = 6). (F) Immunohistochemical staining of STING in liver tissues (n = 6). (G) Immunofluorescence staining of F4/80 and STING in liver tissues (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP deletion alleviates inflammatory response in liver tissue of PD-fed mice via inhibition of STING–NF-κB signaling. (A) Protein levels of P65 and P-P65 in total liver tissues, P65 in liver nuclear and cytosol (n = 6). (B) Protein levels of IKKα, IKKβ, P-IKKα/β, IκBα, and P-IκBα in liver tissues (n = 6). (C) Immunofluorescence staining of F4/80 and P65 in liver tissues (n = 3). (D) Schematic diagram of mechanisms by which STING activates NF-κB signaling. (E) Protein levels of STING, P-TBK1, and TBK1 in liver tissues (n = 6). (F) Immunohistochemical staining of STING in liver tissues (n = 6). (G) Immunofluorescence staining of F4/80 and STING in liver tissues (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).STING/TBK1 is a classical innate immune signaling pathway, and recent evidence suggests that STING/TBK1 is important for the inflammatory response in metabolic diseases by activating NF-κB (Figure 11D)., We observed elevated expression of STING and P-TBK1 in liver of PD-fed mice, which depended on the presence of SCAP (Figure 11E). Because STING is expressed specifically in macrophages (Figure 11F and G), the increased STING expression in liver tissue is associated with the presence of macrophage infiltration. These results were not significantly different in NCD-fed SCAPΔMϕ mice and SCAPfl/fl mice (Figure 12). Similar results were found in eWAT (Figure 13). These data suggest that p65 activation results from the activities of STING/TBK1 signal and thus activates the inflammatory response in the liver and eWAT of PD-fed mice. This process can be blocked by macrophage SCAP deletion.
Figure 12
Macrophage SCAP deletion does not alter STING–NF-κB signaling in liver tissue of NCD-fed mice. (A) Protein levels of P65 and P-P65 in total liver tissues, P65 in liver nuclear and cytosol (n = 6). (B) Protein levels of IKKα, IKKβ, P-IKKα/β, IκBα, and P-IκBα in liver tissues (n = 6). (C) Immunofluorescence staining of F4/80 and P65 in liver tissues (n = 3). (D) Protein levels of STING, P-TBK1, and TBK1 in liver tissues (n = 6). (E) Immunohistochemical staining of STING in liver tissues (n = 6). (F) Immunofluorescence staining of F4/80 and STING in liver tissues (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Figure 13
Macrophage SCAP deficiency inhibits expression of STING and P65 in eWAT of PD-fed mice. (A) Immunofluorescence staining of F4/80 and P65 in eWAT (n = 3). (B) Immunohistochemical staining of STING in eWAT (n = 6). (C) Immunofluorescence staining of F4/80 and STING in eWAT (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP deletion does not alter STING–NF-κB signaling in liver tissue of NCD-fed mice. (A) Protein levels of P65 and P-P65 in total liver tissues, P65 in liver nuclear and cytosol (n = 6). (B) Protein levels of IKKα, IKKβ, P-IKKα/β, IκBα, and P-IκBα in liver tissues (n = 6). (C) Immunofluorescence staining of F4/80 and P65 in liver tissues (n = 3). (D) Protein levels of STING, P-TBK1, and TBK1 in liver tissues (n = 6). (E) Immunohistochemical staining of STING in liver tissues (n = 6). (F) Immunofluorescence staining of F4/80 and STING in liver tissues (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).Macrophage SCAP deficiency inhibits expression of STING and P65 in eWAT of PD-fed mice. (A) Immunofluorescence staining of F4/80 and P65 in eWAT (n = 3). (B) Immunohistochemical staining of STING in eWAT (n = 6). (C) Immunofluorescence staining of F4/80 and STING in eWAT (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
SCAP Promotes Inflammatory Response Through STING–NF-κB Signaling Activation in Vitro
Moreover, we also validated the effect of SCAP on the STING–NF-κB signaling pathway in vitro. We overexpressed or knocked down the SCAP in RAW264.7 murine macrophage cells. The gene expression of inflammatory cytokines was lower in SCAPi-RAW264.7 cells than in Vec-RAW264.7 cells. Conversely, the expression of inflammatory cytokines was increased by SCAP overexpressed treatment (Figure 14A and B). We demonstrated that P-p65 expression was increased in OE-SCAP-RAW264.7 cells but reduced in SCAPi-RAW264.7 cells (Figure 14C). We observed enhanced nuclear translocation of P65 in OE-SCAP-RAW264.7 cells but decreased translocation in SCAPi-RAW264.7 cells (Figure 14D–F). Meanwhile, we verified the expression of STING–NF-κB signaling pathway. The data showed that SCAP overexpression could not change STING expression but strongly stimulated the phosphorylation TBK1–NF-κB, whereas knockdown of SCAP resulted in the opposite effect (Figure 14G). These data suggest that SCAP activates the STING–NF-κB signaling pathway in macrophages to stimulate the inflammatory response.
Figure 14
SCAP promotes inflammatory response through STING–NF-κB signaling activation in vitro. RAW264.7 macrophages were stimulated with LPS (300 ng mL−1) for 16 hours. (A) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in Vec-SCAP and SCAPi-RAW264.7 cells (n = 5). (B) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in NC-SCAP and OE-SCAP RAW264.7 cells (n = 5). (C) Protein levels of P-P65, P65, and SCAP in RAW264.7 cells (n = 3). (D) Protein levels of P65 in cytosolic and nuclear fractions (n = 3). Immunofluorescence staining of p65 nuclear translocation in SCAPi-RAW264.7 cells (E) and OE-SCAP RAW264.7 cells (F) (n = 3). (G) Protein levels of STING, P-TBK1, TBK1, IKKα, IKKβ, P-IKKα/β, IκBα, and P-IκBα in RAW264.7 cells (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
SCAP promotes inflammatory response through STING–NF-κB signaling activation in vitro. RAW264.7 macrophages were stimulated with LPS (300 ng mL−1) for 16 hours. (A) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in Vec-SCAP and SCAPi-RAW264.7 cells (n = 5). (B) Relative mRNA levels of IL1β, IL6, TNF-α, and MCP-1 in NC-SCAP and OE-SCAP RAW264.7 cells (n = 5). (C) Protein levels of P-P65, P65, and SCAP in RAW264.7 cells (n = 3). (D) Protein levels of P65 in cytosolic and nuclear fractions (n = 3). Immunofluorescence staining of p65 nuclear translocation in SCAPi-RAW264.7 cells (E) and OE-SCAP RAW264.7 cells (F) (n = 3). (G) Protein levels of STING, P-TBK1, TBK1, IKKα, IKKβ, P-IKKα/β, IκBα, and P-IκBα in RAW264.7 cells (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
SCAP Recruits STING and TBK1 to the Golgi and Activates NF-κB Signaling
STING recruits and phosphorylates TBK1 on the Golgi, and then phosphorylates IKK to initiate transcription of NF-κB. Because SCAP and STING/TBK1 similarly play biological roles in the Golgi, we observed a correlation between the SCAP and STING/TBK1 (Figure 15A). We tested whether SCAP might directly interact with STING and TBK1. Immunofluorescence confirmed the co-localization of SCAP with STING in liver and RAW264.7 cells (Figure 15B and C). Co-immunoprecipitation (Co-IP) experiments showed that SCAP interacted intensely with STING but not with TBK1 (Figure 15D). We confirmed that knockdown of SCAP dramatically reduced STING and TBK1 colocalization with the Golgi in RAW264.7 cells via confocal microscopy (Figure 15E). Meanwhile, blocking SCAP translocation on the Golgi by 25-hydroxycholesterol (25-HC), a SCAP translocation inhibitor from the ER to the Golgi, inhibited the colocalization of STING and TBK1 with the Golgi, although in the presence of SCAP overexpression (Figure 15F). Consistently, we found that P65 nuclear translocation and the STING–NF-κB signaling pathway were inhibited by 25-HC treatment in overexpression of SCAP–RAW264.7 cells (Figure 15G and H). Taken together, these data indicate that the location of SCAP on the Golgi is required for activation of the STING–NF-κB signaling pathway.
Figure 15
SCAP recruits STING and TBK1 to the Golgi and activates NF-κB signaling. RAW264.7 macrophages were stimulated with LPS (300 ng ml−1) for 16 hours and 50 μmol/L 25-HC for 3 hours. (A) Schematic diagram of mechanisms by which macrophage SCAP activates STING–NF-κB. Immunofluorescence staining of STING and SCAP in liver tissues (B) or RAW264.7 cells (C). (D) Immunoblotting of immunoprecipitation with anti-SCAP, anti-TBK1, and anti-STING in OE-SCAP RAW264.7 cells. (n = 3). (E) Immunofluorescence staining of STING, TBK1, and Golgi 97 in RAW264.7 cells treated with LPS (n = 3). (F) Immunofluorescence staining of STING, TBK1, and Golgi 97 in RAW264.7 cells treated with LPS (n = 3). (G) Protein levels of P65 in cytosolic and nuclear fractions (n = 3). (H) Protein levels of TBK1, P-TBK1, P-P65, P65, and STING in RAW264.7 cells (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
SCAP recruits STING and TBK1 to the Golgi and activates NF-κB signaling. RAW264.7 macrophages were stimulated with LPS (300 ng ml−1) for 16 hours and 50 μmol/L 25-HC for 3 hours. (A) Schematic diagram of mechanisms by which macrophage SCAP activates STING–NF-κB. Immunofluorescence staining of STING and SCAP in liver tissues (B) or RAW264.7 cells (C). (D) Immunoblotting of immunoprecipitation with anti-SCAP, anti-TBK1, and anti-STING in OE-SCAP RAW264.7 cells. (n = 3). (E) Immunofluorescence staining of STING, TBK1, and Golgi 97 in RAW264.7 cells treated with LPS (n = 3). (F) Immunofluorescence staining of STING, TBK1, and Golgi 97 in RAW264.7 cells treated with LPS (n = 3). (G) Protein levels of P65 in cytosolic and nuclear fractions (n = 3). (H) Protein levels of TBK1, P-TBK1, P-P65, P65, and STING in RAW264.7 cells (n = 3). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP Deletion Ameliorates the Degree of Liver Fibrosis in PD-Fed Mice
The prognosis of NAFLD closely correlates with the degree of liver fibrosis, which is the most important clinical challenge in NAFLD. The patients with lean NAFLD have a faster fibrosis progression, compared with the obese NAFLD patients. We further examined the effects of SCAP deletion on a 16-week PD-feeding protocol induced steatohepatitis and liver fibrosis. After PD feeding for 16 weeks, hepatocyte steatosis, lobular inflammatory infiltration, macrophage infiltration, fibrosis, and plasma levels of ALT in SCAPΔMϕ mice were significantly ameliorated, compared with control SCAPfl/fl mice (Figure 16A–C). Consistently, the degree of fibrosis and proinflammatory cytokines in SCAPΔMϕ mice was significantly lighter than in SCAPfl/fl mice (Figure 16D–F). Meanwhile, the STING expression, phosphorylated TBK1 and p65 levels were lower in SCAPΔMϕ mice than in SCAPfl/fl mice (Figure 16G). These results suggest that macrophage SCAP deficiency ameliorates liver fibrosis and reduces the hepatic STING–NF-κB signaling pathway activation.
Figure 16
Macrophage SCAP deletion ameliorates the degree of liver fibrosis in PD-fed mice. (A) Representative pictures of H&E staining and immunohistochemical staining of F4/80+ cells in mice fed a 16-week PD (n = 6). (B) Representative pictures of Sirius red staining and immunohistochemical staining of α-SMA in mice fed a 16-week PD (n = 6). (C) Levels of ALT and aspartate aminotransferase in plasma (n = 6). (D) Relative mRNA levels of fibrosis in liver tissues (n = 6). (E) Relative mRNA levels of inflammation cytokine in liver tissues (n = 6). (F) Protein levels of α-SMA, Col1a1, IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). (G) Protein levels of P-P65, P65, P-TBK1, TBK1, and STING in liver tissues (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Macrophage SCAP deletion ameliorates the degree of liver fibrosis in PD-fed mice. (A) Representative pictures of H&E staining and immunohistochemical staining of F4/80+ cells in mice fed a 16-week PD (n = 6). (B) Representative pictures of Sirius red staining and immunohistochemical staining of α-SMA in mice fed a 16-week PD (n = 6). (C) Levels of ALT and aspartate aminotransferase in plasma (n = 6). (D) Relative mRNA levels of fibrosis in liver tissues (n = 6). (E) Relative mRNA levels of inflammation cytokine in liver tissues (n = 6). (F) Protein levels of α-SMA, Col1a1, IL1β, IL6, TNF-α, and MCP-1 in liver tissues (n = 6). (G) Protein levels of P-P65, P65, P-TBK1, TBK1, and STING in liver tissues (n = 6). Data are expressed as mean ± SD. ∗P < .05; ∗∗P < .01; ∗∗∗P < .0001; ns, nonsignificant (2-tailed unpaired t test in bar graphs).
Discussion
SCAP is recognized as an important regulator of cholesterol metabolism. In the current study, we provide novel evidence that abnormally increased macrophage SCAP plays a critical role in the development of metaflammation during lean NAFLD progression. We confirmed that macrophage SCAP-specific knockout significantly ameliorates PD-induced hyperlipidemia, insulin resistance, and lean NAFLD by reducing tissue inflammation. The mechanism is that macrophage SCAP-specific knockout improved local inflammation in the liver and adipose tissue by attenuating STING–NF-kB signaling pathway activation. Our findings provide new mechanistic insight into the pathogenesis of lean NAFLD.Various diets, including PD, high-fat diet, and methionine-choline deficient, could induce a mouse NAFLD model; therefore, they are used to study the pathogenesis and treatment of NAFLD. Interestingly, PD-induced NAFLD was accompanied by weight loss, which closely resembled the model of lean NAFLD. Compared with the other feeds, PD contains higher cholesterol, which leads to intestinal flora disorders and severe tissue inflammation., In this study, we successfully applied PD to construct a lean NAFLD model accompanied by severe metaflammation. Meanwhile, we observed an overt inflammatory response in eWAT and liver tissues of PD-fed mice that was mediated by macrophage infiltration, resulting in separate phenotypes of lipid metabolism disorder and increasing the influx of lipids from adipose tissue to the liver. These data indicated that cholesterol seems to be more lipotoxic than TG and may be a trigger for the progression of lean NAFLD.Compared with obese NAFLD, lean NAFLD is mainly characterized by a decrease in subcutaneous adipose tissue. Adipose tissue is a critical lipid storage and release site, where lipids are primarily stored as TG in adipocytes. However, when the limit for storage of lipids is reached or adipocyte lipolysis is dysregulated, lipids can accumulate in ectopic tissues such as the liver, leading to insulin insensitivity and NAFLD. Lipodystrophy is associated with an inflammatory environment, especially inflammatory factors released by activated macrophages, which stimulate lipolysis by increasing the expression of lipolysis-related enzymes and activating the JAK/STAT pathway., Our study also confirmed that massive macrophage infiltration in adipose tissue leads to severe inflammation, resulting in adipose tissue lipolysis and increased lipid uptake and synthesis by the liver, which is the main cause of ectopic lipid deposition in PD-fed mice.Like adipose tissue, there are substantial macrophage infiltration and clear inflammation in the liver. Interestingly, this severe inflammatory response leads to the uptake of lipids from circulating blood and increased lipid synthesis within the liver. Inflammation mediates the heterogeneity of lipid metabolism in eWAT, and liver tissue may be a potential mechanism for the development of lean NAFLD. The activation of hepatic macrophages and subsequent secretion of proinflammatory mediators lead to increased lipid accumulation and damage in hepatocytes, which are critical events in the development and progression of NAFLD., PD causes macrophage infiltration and abnormal SCAP expression in macrophages, producing a severe inflammatory response. Therefore, metabolic disturbances manifest as increased adipose tissue lipolysis, and increased accumulation in the liver tissue mediated by inflammation is central to ectopic lipid deposition.High levels of metaflammation have a major impact on the development of lean NAFLD, forcing us to explore the origins of metaflammation mediated by a high cholesterol diet. As a cholesterol sensitizer, SCAP has been of interest to us as a key bridging molecule between metabolism and inflammation. Cholesterol homeostasis disorder and the large amount of lipopolysaccharide (LPS) that originated from the intestine caused by PD stimulated an abnormal increase in macrophage SCAP, which further had an amplifying effect on the production of inflammatory factors. SCAP has been shown to play a key role in metabolic diseases through the regulation of inflammatory signaling pathways such as NLRP3 and NF-κB.24, 25, 26 In this study, we found that the macrophage NF-κB signaling pathway was significantly activated in PD-fed mice but rescued in SCAPΔMϕ mice. Therefore, we determined that the modulatory effect of SCAP on the NF-κB signaling pathway is an important mechanism for triggering metaflammation in PD-fed mice.STING plays an important role in infectious diseases by acting as a crucial regulator of the DNA sensing pathway. The STING/TBK1 signaling pathway has been found to be responsible for the development of metabolic disease in recent years28, 29, 30; however, the mechanism of activation in metaflammation is still unknown. In our work, the intrahepatic STING–NF-κB signaling pathway was significantly activated in PD-induced NAFLD, and this phenotype was rescued in SCAPΔMϕ mice. Previous reports and our data confirm that STING is not present in human and mice hepatocytes but expressed at high abundance in hepatic non-parenchymal cells., The decrease of STING expression in SCAPΔMϕ mice may be attributed to the reduction of macrophage infiltration. Inflammation is key to drive NAFLD to nonalcoholic steatohepatitis and fibrosis. In the present study, we verified that SCAPΔMϕ mice can alleviate PD-induced hepatic steatosis and inflammation by inhibiting the STING–NF-κB pathway. The prognosis of NAFLD closely correlates with the degree of liver fibrosis, which is the most important clinical challenge in NAFLD, whereas the lean NAFLD patients have a faster fibrosis progression, compared with the obese NAFLD patients. We also demonstrated that SCAPΔMϕ mice can reduce the extent of liver fibrosis by the same mechanism.It has been reported that in NAFLD, STING activation markedly increases macrophage proinflammatory status, which in turn increases hepatocyte fat deposition and proinflammatory responses and enhances hepatic stellate cell activation. Mechanistically, LPS can trigger the perinuclear translocation of STING and activate STING in a cytosolic DNA-dependent manner., In the lean NAFLD model induced by PD, perinuclear translocation and activation of STING may be mediated by extensive LPS production from intestinal microecological disorders. Upon activation, STING translocates from the ER to the Golgi, where it recruits TBK1 and then activates the NF-κB signaling pathway, driving the release of inflammatory factors.,, Coincidentally, the Golgi is also an important platform for the biological function of SCAP, where it is involved in the cleavage activation of SREBPs and the maintenance of cholesterol homeostasis. This suggests the possible interaction of SCAP with STING, and our extensive data provide ample evidence for this possibility. The interaction between SCAP and STING was confirmed by Co-IP and immunofluorescence, and the knockdown of SCAP inhibited the colocalization of STING with the Golgi and suppressed the activation of the TBK1–NF-κB signaling pathway mediated by LPS. Notably, the SCAP translocation inhibitor 25-hydroxycholesterol (25-HC) significantly reduced the localization of STING and TBK1 to the Golgi and inhibited the NF-κB signaling pathway, which provides strong evidence that SCAP contributes to the optimal activation of STING signaling. Our study makes an important addition to the mechanism for the role of STING in metaflammation and provides major theoretical support for subsequent studies.In conclusion, our findings reveal that abnormally increased macrophage SCAP amplifies the inflammatory response in adipose and liver tissues, leading to metabolic disorders with distinct phenotypes in both tissues, eventually resulting in the development of metabolic syndrome and lean NAFLD. The mechanism involves the inflammatory response after SCAP-mediated activation of the STING–NF-κB signaling pathway in macrophages. Therefore, inhibition of macrophage SCAP may represent a new therapeutic strategy for the treatment of lean NAFLD.
Materials and Methods
Animals and Treatments
Macrophage SCAP-specific knockout mice (LysM-Cre SCAPfl/fl) were generated by breeding LysM-Cre mice (Shanghai Model Organisms Center, Inc, Shanghai, China) with SCAPfl/fl mice (The Jackson Laboratory, Bar Harbor, ME). Cre-negative SCAPfl/fl littermates were used as controls. Mice were genotyped by PCR; genotyping of SCAPfl/fl mice resulted in a 450 base pair product for the loxP-targeted allele and a 400 base pair product for the wild-type allele. All genotypes were generated on a pure C57BL/6 background.Male SCAPΔMϕ (LysM-Cre SCAPfl/fl) mice and Cre-negative SCAPfl/fl littermates (6–8 weeks of age) were randomly assigned to feeding with NCD (4% fat, D12102C; Research Diets, New Brunswick, NJ) or PD (40% fat, 1.25% cholesterol, 0.45% sodium cholate, D12109C; Research Diets) for 12 weeks (n = 6 per group). All mice were maintained in ventilated cages under controlled conditions of 12-hour light/dark cycles at 22°C and ad libitum feeding. The animals were euthanized under deep anesthesia by intraperitoneal injection with an overdose of pentobarbital sodium (200 mg/kg) to obtain their samples. All experimental protocols adhered to the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health (National Research Council, 8th Edition, 2011). All animal studies were approved by the Animal Ethics Committee of Chongqing Medical University.
Cell Culture and Adipocyte Differentiation
Mouse Raw264.7 macrophages and human THP1 monocytes were cultured in RMPI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 100 U/mL penicillin-streptomycin. Human hepatocellular carcinoma HepG2 cells were grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10% FBS and 100 U/mL penicillin-streptomycin.3T3-L1 pre-adipocytes were grown in DMEM containing 10% newborn calf serum and 1% antibiotics until confluence and induced to differentiation as previously described. Two days after confluence (day 0, D0), cells were induced by standard hormone cocktails. Briefly, cells were induced with DMEM containing 0.5 mmol/L isobutylmethylxanthine (ST1398; Beyotime), 1 μmol/L dexamethasone (ST1258; Beyotime), 10 μg/mL insulin (I6634; Sigma-Aldrich, St Louis, MO), and 10% FBS for 3 days. At the end of day 3, cells treated with DMEM supplemented only with 10 μg/mL insulin and 10% FBS and replenished every other day. On day 10, mature adipocytes were harvested for further experiments.
Overexpression of SCAP
Lentivirus containing the mouse full-length cDNA of SCAP was purchased from Obio Technology (Shanghai, China). The lentiviruses were transfected into RAW264.7 at a multiplicity of infection of 30 and THP-1 at a multiplicity of infection of 50. Cells infected with empty lentivirus served as normal expression controls.
siRNA Transfection
siRNAs against human SCAP (sense: 5′-CCUCCUGGCAG UAGAUGUAdTdT-3′, antisense: 5′-UACAUCUACUGCC AGGAGGdTdT-3′), mouse SCAP (sense: 5′-CCUCCUGGCAG UAGAUGUAdTdT-3′), antisense: (5′-UACAUCUACUGCCA GGAGGdTdT-3′), and siRNA negative control (Vec) were purchased from Obio Technology. SCAP was knocked down by transfecting 60%–70% confluent cells with siRNA by using Lipofectamine RNAi MAX (13778150; Invitrogen, Waltham, MA) according to the manufacturer’s protocol.
Co-culture
HepG2 hepatocytes were incubated for 24 hours with overexpression of SCAP/SCAPi or normal expression controls/Vec-SCAP THP-1 cells in the presence of LDL (200 μg/mL). 3T3-L1 mature adipocytes were incubated for 24 hours with overexpression of SCAP/SCAPi or normal expression controls/Vec-SCAP RAW264.7 cells in the presence of LDL (200 μg/mL).
qRT-PCR
qRT-PCR was performed as described previously. In brief, total RNA of the tissues and cells was extracted by TRIzol reagent (9109; Takara, Kusatsu, Japan). qRT-PCR was performed using the SYBR Green PCR Master Mix (9109; Takara) with specific primer sets shown in Tables 1 and 2. The relative expression of the genes was analyzed using the 2-ΔΔ Ct method, and β-actin was used as the internal reference gene.
Table 1
Information on Primers (Mouse) Used in This Study
mRNA
Forward (5′-3′)
Reverse (5′-3′)
β-actin
CCTGAGGCTCTTTTCCAGCC
TAGAGGTCTTTACGGATGTCAACGT
TNF-α
CCTGTAGCCCACGTCGTAG
GGGAGTAGACAAGGTACAACCC
IL1β
GAAATGCCACCTTTTGACAGTG
TGGATGCTCTCATCAGGACAG
IL6
TCTATACCACTTCACAAGTCGGA
GAATTGCCATTGCACAACTCTTT
MCP-1
TTAAAAACCTGGATCGGAACCAA
GCATTAGCTTCAGATTTACGGGT
SCD1
TTCTTGCGATACACTCTGGTGC
CGGGATTGAATGTTCTTGTCGT
SREBP2
GCAGCAACGGGACCATTCT
CCCCATGACTAAGTCCTTCAACT
ACC1
ATGGGCGGAATGGTCTCTTTC
TGGGGACCTTGTCTTCATCAT
FASN
GGAGGTGGTGATAGCCGGTAT
TGGGTAATCCATAGAGCCCAG
ATGL
GGATGGCGGCATTTCAGACA
CAAAGGGTTGGGTTGGTTCAG
HSL
TCCCTCAGTATCTAGGCCAGA
GGCTCATTTGGGAGACTTTGTTT
MGL
CGGACTTCCAAGTTTTTGTCAGA
GCAGCCACTAGGATGGAGATG
CD36
TTGAAGGCATTCCCACGTATC
CGGACCCGTTGGCAAA
PLIN1
GGGACCTGTGAGTGCTTCC
GTATTGAAGAGCCGGGATCTTTT
FATP1
CGCTTTCTGCGTATCGTCTG
GATGCACGGGATCGTGTCT
FATP4
ACTGTTCTCCAAGCTAGTGCT
GATGAAGACCCGGATGAAACG
FATP5
CTACGCTGGCTGCATATAGATG
CCACAAAGGTCTCTGGAGGAT
Table 2
Information on Primers (Human) Used in This Study
mRNA
Forward (5′-3′)
Reverse (5′-3′)
β-actin
CCTGGCACCCAGCACAAT
GCCGATCCACACGGAGTA
TNF-α
GGAGAAGGGTGACCGACTCA
TGCCCAGACTCGGCAAAG
IL1β
TTCGACACATGGGATAACGAGG
TTTTTGCTGTGAGTCCCGGAG
IL6
ACTCACCTCTTCAGAACGAATTG
CCATCTTTGGAAGGTTCAGGTTG
MCP-1
CAGCCAGATGCAATCAATGCC
TGGAATCCTGAACCCACTTCT
SCD1
TTCCTACCTGCAAGTTCTACACC
CCGAGCTTTGTAAGAGCGGT
SREBP2
TCCGCCTGTTCCGATGTAC
TGCACATTCAGCCAGGTTCA
ACC1
GGATCCGGCGCCTTACTT
CTCCGATCCACCTCATAGTTGAC
FASN
AAGGACCTGTCTAGGTTTGATGC
TGGCTTCATAGGTGACTTCCA
ATGL
ATGGTGGCATTTCAGACAACC
CGGACAGATGTCACTCTCGC
HSL
TCAGTGTCTAGGTCAGACTGG
AGGCTTCTGTTGGGTATTGGA
MGL
AATGCAGACGGACAGTACCTC
GAGCCAGCTCTTCATAGCGG
CD36
TTCCTGCAGCCCAATGGT
TTGTCAGCCTCTGTTCCAACTG
PLIN1
CCATGTCCCTATCAGATGCCC
CTGGTGGGTTGTCGATGTC
FATP1
CTTCGATGGCTATGTCAGCGA
AGCACGTCACCTGAGAGGTAG
FATP4
GTACTCAAGCAGTGTAGCCAAC
CTCATTGCGGTTCTCCATGAA
FATP5
GCTTCGGTCCTATTCGGATCT
CAGCGCCCCACATAGTTGA
Information on Primers (Mouse) Used in This StudyInformation on Primers (Human) Used in This Study
Oil Red O Staining
After treatment, the cells were collected, washed, and permeabilized with 4% paraformaldehyde for 20 minutes. Oil red O staining was performed according to the manufacturer’s instructions (C0158S; Beyotime). Image analysis procedures were performed with Image J software.
Immunofluorescence Staining and Confocal Microscopy
RAW264.7 cells were fixed with 4% paraformaldehyde (E672002; Sangon Biotech, Shanghai, China) for 15 minutes at room temperature and washed with phosphate-buffered saline (PBS) (E607008; Sangon Biotech) 3 times. After blocking, the cells were incubated with the primary antibodies for overnight at 4°C. The cells were then rinsed 3 times in PBS and incubated with the secondary antibody for 1–2 hours at 37°C. After washing with PBS, the cells were counterstained with DAPI (D9542; Sigma-Aldrich) for 5 minutes and visualized using fluorescent microscopy. The Pearson correlation (R value) and colocalization rate were analyzed from 3 different fields in each sample using Leica (Wetzlar, Germany) confocal microscope software. Antibodies are shown in Table 3.
Table 3
Information About Antibodies
Name
Source
Product number
SCAP
Abcam
ab153933
P65
Santa Cruz
sc-8008
P-P65
Santa Cruz
sc-136548
IKKα
Santa Cruz
sc-52932
IKKβ
Santa Cruz
sc-8014
P-IKKα/β
Affinity Biosciences
AF3013
IκB-α
Santa Cruz
sc-4094
P-IκB-α
Santa Cruz
sc-8404
Lamin b1
Proteintech
12987-1-AP
TBK1
Proteintech
67211-1-Ig
P-TBK1
Beyotime
AF5959
STING
Proteintech
66680-1-Ig
Golgin 97
Abcam
ab84340
GAPDH
Proteintech
10494-1-AP
Col1a1
Wanleibio
WL0088
IL1β
Proteintech
16806-1-AP
TNF-α
Proteintech
17590-1-AP
IL6
Proteintech
21865-1-AP
α-SMA
Proteintech
14395-1-AP
ACTIN
Proteintech
20536-1-AP
Information About Antibodies
Biochemical Analysis
Serum samples and various tissues were collected from anesthetized mice, and the levels of total TG (A110-1-1; Nanjing JianCheng, Nanjing, China), cholesterol (A111-1-1; Nanjing JianCheng), high-density lipoprotein (HDL) cholesterol (A112-1-1; Nanjing JianCheng), and LDL (A113-1-1; Nanjing JianCheng) cholesterol were measured by enzymatic methods. Levels of IL1β (EH001-48; Bioworlde), IL6 (EM004-96; Bioworlde), and TNF-α (ER006-96; Bioworlde) in mouse tissues were detected by using enzyme-linked immunosorbent assay kits according to the manufacturer’s instructions.
Insulin Tolerance Test and Glucose Tolerance Test
After 16 hours of fasting, mice were accepted to a glucose tolerance test (GTT), receiving an intraperitoneal injection of glucose solution (1.5 g glucose per kg body weight). Blood was collected from the tail, and glucose was measured at 0, 15, 30, 60, and 120 minutes after injection using a handheld glucometer (Roche, Basel, Switzerland). For the intraperitoneal insulin tolerance test (ITT), mice were fasted for 6 hours and injected with insulin (0.75 U kg−1).
Adipose Tissue Macrophage Isolation
eWAT was collected into ice-cold PBS to remove debris. The tissue was mechanically dissociated by mincing and treated with 0.1% collagenase (C5138; Sigma-Aldrich) in PBS for 1 hour at 37°C with gentle agitation. Digested samples were centrifuged at 300g at 4°C for 5 minutes to separate adipocytes and nonparenchymal cells. The cell pellet was resuspended in red blood cell lysis buffer (C3702; Beyotime) at 4°C for 5 minutes, then washed with PBS, and centrifuged at 1000g at 4°C for 5 minutes to obtain macrophages.
Liver Macrophage Isolation
Liver tissue was collected into ice-cold PBS to remove debris. The tissue was mechanically dissociated by mincing and treated with 0.1% collagenase in PBS for 1 hour at 37°C with gentle agitation. The cell suspensions were filtered through a 70-μm nylon cell strainer. The filtered cells were centrifuged at 500g at 4°C for 5 minutes to separate nonparenchymal cells and hepatocytes. The cell pellet was resuspended in red blood cell lysis buffer at 4°C for 5 minutes, then washed with PBS, and centrifuged at 1000g at 4°C for 5 minutes to obtain macrophages.
Flow Cytometry
The macrophages from eWAT and liver were isolated as described above. The isolated cells were fixed with 4% paraformaldehyde for 30 minutes. Adipose tissue macrophages were stained with anti-CD11C and anti-F4/80; liver macrophages were stained with anti-CD11b and anti-F4/80 for 30 minutes. Then cells were permeabilized with permeabilization wash buffer (abs9111; absin) and stained with anti-SCAP. Data acquisition was performed using the Airal2 flow cytometer (BD Biosciences, Franklin Lakes, NJ) and analyzed with Flowjo software (Tree Star Inc, Ashland, OR).
Histology
Histology was done as described previously. Sections of 5-μm thickness were paraffin-embedded and prepared for H&E staining, immunohistochemistry, or immunofluorescence.
Co-IP and Western Blotting
RAW264.7 cells were lysed in NP40 buffer (P0013F; Beyotime) supplemented with protease and phosphatase inhibitors. After 2 hours of incubation with agarose beads, the cell lysates were incubated overnight with immunoglobulin G or anti-SCAP antibody. The immunocomplexes were washed 3 times with PBS and collected proteins from the magnetic beads. Finally, the proteins were detected by Western blotting analysis.Western blotting was performed as described previously. Total proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to a polyvinylidene difluoride membrane (IEVH85R; Millipore, Burlington, MA). Then, the membranes were blocked with 3% bovine serum albumin for 1 hour. After primary antibodies overnight incubation, the membranes were incubated with horseradish peroxidase–labeled corresponding secondary antibodies. Finally, detection was visualized by using the ECL chemical luminescent detection kit (Bio-Rad, Hercules, CA), and the bands were further analyzed using Quantity One software. Antibodies are shown in Table 3.
Statistical Analysis
The results are reported as means ± standard deviation (SD). Differences between groups were determined using 2-tailed Student t test, and statistical significance in body weight and GTT and ITT curves were tested by two-way analysis of variance, using GraphPad Prism 8 (San Diego, CA) software. P <.05 was considered significant.
Authors: Qiang Ye; Yaxi Chen; Han Lei; Qing Liu; John F Moorhead; Zac Varghese; Xiong Z Ruan Journal: Inflamm Res Date: 2009-06-17 Impact factor: 4.575
Authors: Y Tojima; A Fujimoto; M Delhase; Y Chen; S Hatakeyama; K Nakayama; Y Kaneko; Y Nimura; N Motoyama; K Ikeda; M Karin; M Nakanishi Journal: Nature Date: 2000-04-13 Impact factor: 49.962
Authors: Jessica L Mellinger; Karol M Pencina; Joseph M Massaro; Udo Hoffmann; Sudha Seshadri; Caroline S Fox; Christopher J O'Donnell; Elizabeth K Speliotes Journal: J Hepatol Date: 2015-03-14 Impact factor: 25.083