Yaqi Cao1, ZiFu Dai1, Huizhen Lao1, Huimin Zhao2. 1. College of Life Science and Technology, Guangxi University, Nanning 530005, China. 2. College of Life Science and Technology, Guangxi University, Nanning 530005, China. zhaohuimin-nn@126.com.
Abstract
BACKGROUND: The testis has been reported to be a naturally O2-deprived organ, dimethyloxaloylglycine (DMOG) can inhibit hypoxia inducible factor-1alpha (HIF-1α) subject to degradation under normal oxygen condition in cells. OBJECTIVES: The objective of this study is to detect the effects of DMOG on the proliferation and differentiation of spermatogonial stem cells (SSCs) in Bama minipigs. METHODS: Gradient concentrations of DMOG were added into the culture medium, HIF-1α protein in SSCs was detected by western blot analysis, the relative transcription levels of the SSC-specific genes were analyzed using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Six days post-induction, the genes related to spermatogenesis were detected by qRT-PCR, and the DNA content was determined by flow cytometry. RESULTS: Results revealed that the levels of HIF-1α protein increased in SSCs with the DMOG treatment in a dose-dependent manner. The relative transcription levels of SSC-specific genes were significantly upregulated (p < 0.05) by activating HIF-1α expression. The induction results showed that DMOG significantly increased (p < 0.05) the spermatogenesis capability of SSCs, and the populations of haploid cells significantly increased (p < 0.05) in DMOG-treated SSCs when compared to those in DMOG-untreated SSCs. CONCLUSION: We demonstrate that DMOG can promote the spermatogenesis activity of SSCs.
BACKGROUND: The testis has been reported to be a naturally O2-deprived organ, dimethyloxaloylglycine (DMOG) can inhibit hypoxia inducible factor-1alpha (HIF-1α) subject to degradation under normal oxygen condition in cells. OBJECTIVES: The objective of this study is to detect the effects of DMOG on the proliferation and differentiation of spermatogonial stem cells (SSCs) in Bama minipigs. METHODS: Gradient concentrations of DMOG were added into the culture medium, HIF-1α protein in SSCs was detected by western blot analysis, the relative transcription levels of the SSC-specific genes were analyzed using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Six days post-induction, the genes related to spermatogenesis were detected by qRT-PCR, and the DNA content was determined by flow cytometry. RESULTS: Results revealed that the levels of HIF-1α protein increased in SSCs with the DMOG treatment in a dose-dependent manner. The relative transcription levels of SSC-specific genes were significantly upregulated (p < 0.05) by activating HIF-1α expression. The induction results showed that DMOG significantly increased (p < 0.05) the spermatogenesis capability of SSCs, and the populations of haploid cells significantly increased (p < 0.05) in DMOG-treated SSCs when compared to those in DMOG-untreated SSCs. CONCLUSION: We demonstrate that DMOG can promote the spermatogenesis activity of SSCs.
Spermatogonial stem cells (SSCs) are the foundation of spermatogenesis and together with oocytes, are essential for species continuity. The testis has been reported to be a naturally O2-deprived organ, as the seminiferous tubules of the testes are poorly vascularized and under low oxygen tension [1]. Rat seminiferous tubules are thought to be under lower O2 tension than normal interstitial O2 tension conditions. SSCs are located on the basement membrane of seminiferous tubules and are almost completely surrounded by Sertoli cells, which form a microenvironment. The differentiation of SSCs and multipotent progenitors are affected by complex signals in the microenvironment, including hormones, temperature, and O2 availability. A previous study suggested that hypoxic conditions in the range of 1%–5% O2 supported the maintenance of embryonic stem cells (ESCs) in a pluripotent state, thereby prevented their differentiation and even reprogrammed partially differentiated cells into a stem cell-like state [2]. A separate study showed that hypoxic conditions applied in the range of 0.1%–1% O2 contributed to the differentiation of ESCs [3]. Although hypoxia is an important factor that determines the fate of cell, its effects on the spermatogenesis of SSCs under cell culture conditions in vitro remain unclear.Hypoxia inducible factor-1alpha (HIF-1α) is a master transcriptional factor that responds to hypoxia [4]. HIF-1α is stabilized by dimerization with the β subunit, the dimer binds to target genes, and leads to the downstream activation of the target gene transcription. A previous study demonstrated that HIF-1α played an important role in spermatogenesis, wherein it was robustly expressed in SSCs of both juvenile and adult murine [5]. Reduced HIF-1α levels in testes block sperm production and cause infertility of the mice [6]. Under normoxic conditions, HIF-1α is hydroxylated, ubiquitinated, and degradated by the proteasomes. Prolyl hydroxylase (PHD) is greatly involved in the degradation of HIF-1α. In well-oxygenated cells, the PHD is catalyzed in the presence of Fe (II) and oxygen. Under normal hypoxia conditions when the PHD is blocked due to the lack of oxygen. Therefore, endogenous HIF-1α levels can be increased by the suppression of PHD activity, either by reducing cellular oxygen levels or by combining with Fe (II) competitively. Dimethyloxaloylglycine (DMOG) is a cell penetrant oxoglutarate analogue that inhibits PHD enzymes, thereby subjecting HIF-1α to cellular degradation under normal oxygen tension conditions, and has been demonstrated to stabilize HIF-1α both in vitro and in vivo [7]. The objective of the present study was to study the effect of DMOG on spermatogenesis capability and the proliferation of SSCs in vitro.
MATERIALS AND METHODS
Animal
The testes of 20-d-old piglets and 2-mon-old pigs were obtained through routine castration surgery performed at a local farm. Pigs that are castrated at this age to improve the meat quality and enhance growth rates. All procedures involving animals were performed in compliance with the Animal Care and Use Committee of the Germplasm Resource Center of Chinese Experimental Minipig and the Animal Care and Use Committee of Guangxi University (approval No. GXU2016-015).
Immunohistochemistry
Testicular samples from 20-d-old piglets and 2-mon-old pigs were subjected to immunohistochemical analysis. Briefly, testicular tissues were fixed in Bouin’s fixative for 12 h, rinsed in water for 2 h, dehydrated, embedded in paraffin, and sliced into 5-µm-thick sections. Tissue samples were deparaffinized in xylene and rehydrated. Antigen retrieval was carried out by boiling sections in 10 mM sodium citrate (pH = 6.0) for 30 min, washed in phosphate-buffered saline (PBS; pH = 7.2) 3 times, cultured with 0.5% Triton X-100 for 5 min, blocked with 5% bovine serum albumin (BSA) in PBS for 30 min and incubated with the following primary antibodies overnight at 4°C: rabbit anti-human ubiquitin carboxyl-terminal hydrolase 1 (UCHL1) (1:200; AbD Serotec, UK), rabbit anti-CD14 (1:100; Absin, China), rabbit anti-NSE (1:200; Absin), rabbit anti-HIF1-Alpha (1:100; Absin), and rhodamine-labeled Dolichosbiflorus agglutinin (DBA) (1:100; Vector Laboratories, Inc., USA). After washing again, the samples were incubated with Alexa Fluor 594-conjugated donkey anti-rabbit IgG (1:500; Invitrogen Molecular Probes, USA). To identify nuclei, samples were incubated with Hoechst33342. Finally, sections were mounted with Vectashield mounting medium (Vector Laboratories, Inc.) and photographed under a fluorescence microscope (Eclipse 50i; Nikon, Japan). Primary antibodies were replaced with 1% BSA in PBS as the negative control.
Isolation of SSCs and Sertoli cells
The testes from 20-d-old piglets were used for the isolation of SSCs and Sertoli cells. Briefly, tunica albugineae were removed, and testicular tissues was minced, digested with enzymes mixture solution (DNase I and collagenase IV in PBS), and filtered through a 40 µm nylon mesh. Red blood cells (RBCs) were removed by RBC lysis buffer (Sigma-Aldrich, USA). Next, dissociated cells were seeded in 0.2% (w/v) gelatin-coated plates and cultured in Dulbecco’s Modified Eagle Medium: Nutrient F-12 (DMEM/F12) (Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (FBS) at 31°C and 5% CO2. After cultivating for 12 h, the floating cells were collected for SSC isolation using fluorescence-activated cell sorting (FACS). Briefly, the floating cells were incubated with rabbit anti-CD14 (1:100; Absin) for 60 min at 37°C, washed with PBS, and incubated with Alexa Fluor 594- conjugated donkey anti-rabbit IgG for 15 min at 37°C. Cell sorting was performed using a FACSAriaII apparatus (BD Bioscience, USA). Adherent cells were used for the identification of Sertoli cells.
Cultivation of SSCs and Sertoli cells
Immediately after cell sorting, CD14+ SSCs were seeded onto sandos inbred mice mouse embryo-derived thioguanine- and ouabain-resistant (STO) feeder layers in a 6-well plate at a density of 2 × 105 cells per well, then cultured in SSC medium, The media was prepared by supplementing DMEM/F12 with 3 mg/mL BSA, 0.05 mg/mL pyruvic acid sodium (Sigma-Aldrich), 0.5 mg/mL L-glutamine, and the following the growth factors: 20 ng/mL GDNF, 10 ng/mL bFGF, and 100 ng/mL GFRα1. Cells were subsequently were cultured at 37°C in 5% CO2. The Sertoli cells were cultured in DMEM/F12 supplemented with 10% FBS at 37°C in 5% CO2.
Transduction of shRNA of HIF-1α
In order to inhibit HIF-1α expression, the shRNA of HIF-1α (forward oligo: 5′-TCCAGTTGAATCTTCAGATATTCAAGAGATATCTGAAGATTCAACTGGTTTTTTC-3′, reverse oligo: 5′-TCGAGAAAAAACCAGTTGAATCTTCAGATATCTCTTGAATATC TGAAGATTCAACTGGA-3′) was constructed with lentivirus vector (Neuron Bio, China). For transduction, SSCs were seeded in a 12-well plate and infected with the vector at a multiplicity of infection of 50. Positive cells were sorted by flow cytometry and cultured for further analysis.
Western blot
Western blot was carried out to determine the effects of DMOG on HIF-1α protein expression in SSCs. HIF-1α protein expression in shHIF-1α SSCs was also analyzed using western blot, and the SSCs infected with empty vector as a negative control. SSCs were treated with gradient concentrations (0, 200, 400, 800, and 1,000 µM) of DMOG in SSC medium for 2 d, the shHIF-1α SSCs and the negative control were treated with 1,000 µM DMOG in SSC medium for 2 d. Then, cells were harvested, homogenized in lysis buffer and incubated on ice for 20 min. The cellular debris was separated by centrifugation at 10,000 × g at 4°C. The protein content was quantified by BCA assay. Then, 50 µg protein was loaded onto a 6% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, transferred to a polyvinylidene fluoride membrane, blocked in 5% milk in TBS-T for 2 h at room temperature, incubated with anti-HIF-1α primary antibody (1:800) overnight, and incubated corresponding secondary antibody was employed at (1:5,000) dilution for 60 min. Membranes were scanned with an Odyssey Scanner (Li-COR Biosciences, USA) and quantified with Odyssey v3.0.
Effect of DMOG on SSC proliferation
In order to evaluate the effects of DMOG on SSC proliferation, SSCs were preconditioned with different concentrations of DMOG (Sigma-Aldrich) (200, 400, 800, and 1,000 µM) in SSC medium. The shHIF-1α SSCs were preconditioned with 1,000 µM DMOG. After culturing for 2 d, the medium was replaced with fresh SSC medium. SSC proliferation was measured using a Cell Counting Kit-8 (CCK-8; Beyotime, China) following the manufacturer’s instructions. The optical density was measured using a microplate reader at 450 nm. DMOG-untreated SSCs cultured in SSC medium as a control.
In vitro spermatogenesis
Normal and shHIF-1α SSCs were seeded respectively onto Sertoli cells, treated with 800 μM DMOG in differentiation medium that consisted of minimum essential media alpha (MEM α; Life Technologies, USA) with 10% knockout serum replacement (10828028; Thermo Fisher Scientific), 3 ng/mL retinoic acid, 100 ng/mL activin A (R&D Systems, USA), 20 ng/mL BMP4 (R&D Systems), 200 ng/mL FSH (Sigma-Aldrich) and 10 µm T (Sigma-Aldrich). Cells were cultured at 37°C in 5% CO2. After culturing for 2 d, the medium was replaced with fresh differentiation medium without DMOG. Six d post-induction, cells were collected for analysis. DMOG-untreated SSCs were cultured in differentiation medium as a control.
Immunocytochemistry
Cultured cells were fixed in 1 mL 4% paraformaldehyde, washed for 5 min in 1 mL PBS 3 times, permeabilized with 1 mL 0.5% Triton X-100 in PBS for 10 min, and incubated with 1 mL 10% normal goat serum in DMEM/F12 for 30 min at room temperature to block non-specific binding. Next, cells were incubated with the following primary antibodies at 4°C overnight to identify SSC clusters: rabbit anti-human UCHL1 (1:200; AbD Serotec), rabbit anti-CD14 (1:100; Absin), rabbit anti-HIF1α (1:100; Absin), and DBA (1:100; Vector Laboratories, Inc.). The primary antibodies used to identify Sertoli cells were rabbit anti-WT1 (1:200; Sigma-Aldrich) and rabbit anti-NSE (1:200; Sigma-Aldrich). The primary antibodies used to identify differentiated cells were rabbit anti-mouse Stra8 (1:200, ab49602; Abcam) and rabbit anti-human SCP3 (1:100, ab15093; Abcam).After incubating with primary antibodies, the samples were washed in PBS 3 times and exposed to 300 μL Alexa Fluor 594-labeled donkey anti-rabbit IgG (1:500) for 30 min at room temperature. After a final wash with 1 mL PBS, cells were stained with 300 μL 10 µg/mL Hoechst33342 to visualize nuclei, mounted with Vectashield mounting medium (Vector Laboratories, Inc.), and photographed under a fluorescence microscope (Eclipse 50i; Nikon). Primary antibodies were replaced with 3% BSA in PBS as the negative control.
RNA extraction and reverse transcription polymerase chain reaction (RT-PCR) analysis
RT-PCR analysis was performed to identify sorted cells by FACS. After isolation, the total cellular RNA was isolated using the RNeasy Mini Kit (Qiagen, USA) following the manufacturer’s instructions. Isolated RNA was transcribed to cDNA using a Quantitect RT kit (Qiagen) and purified using a QIAquick PCR purification kit (Qiagen). For each RT-PCR reaction, 20 ng cDNA template was used in a 25 mL reaction volume with HotStar Taq Plus (Qiagen) and the associated primers. All targets were amplified for 30 cycles. Amplification products were identified by size on a 2% agarose gel.SSC-related and spermatogenesis-genes were detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR), which was carried out using SYBR Premix Ex Taq I (Tli RNaseH Plus, RR820A; Takara, China) and a LightCycler 96 instrument (Roche Diagnostics, Switzerland). The total 20 L reaction volume was composed of SYBR Premix Ex Taq II (10 μL), forward primer (1 μL, 2 μM), reverse primer (1 μL, 2 μM), cDNA (2 μL), and ddH2O (6 μL). The qPCR reaction was conducted as follows: 95°C for 30 sec, 40 cycles at 95°C for 5 sec, and 60°C for 30 sec. Melting curve analysis was conducted following instrument-specific procedures. The relative quantitative data were calculated by the 2−ΔΔCt method. All values were normalized to the house-keeping gene, GAPDH. The primers used in this study are listed in Table 1.
Table 1
The primers used in reverse transcription polymerase chain reaction
Gene
Forward primer (5′-3′)
Reverse primer (5′-3′)
UCHL1
GATTGAAGAGCTGAAGGGAC
TCAGAACCGATCCATCCTCA
CDH1
CGACGGTGTGGTTACAGTCA
GTCACCTTGGTGGACAGCTT
OCT4
AAGCTGGACAAGGAGAAGCT
TCGTTTGGCTGAACACCTTC
CD14
ACCACCCTCAGACTCCGTAAT
ATAGGTCCAGGGTGGTGAGAG
NANOS2
AATCTCGCCACGTGTACTCC
CGGGCAGTACTTGAGTGTGT
DDX4
TCAAAGGAACAGCGCCAAAC
AACGACCAGTACGCCCAATTC
ID4
TGCCTGCAGTGCGATATGAA
GGCAGGATCTCCACTTTGCT
Stra8
CTCTTCAGCAACCTCAGGAA
CATCCTCCAGGTTGAAGGAT
Tnp1
CAGAAAGTACAATGTCGACC
TTGCGATTGGCATCATCGCA
ACROSIN
CATCTTGCTGAACTCGCACT
CAACAAATCTCTCCTGCAGG
GAPDH
CTCTGGCAAAGTGGACATTG
TCTCGCTCCTGGAAGATGGT
Flow cytometry analysis
Flow cytometry analysis was performed to determine the cell content of in vitro inducted cell mixtures, the testicular mixtures of 20-d-old piglets, and 2-mon-old pigs. Briefly, the cells were collected by gently pipetting, re-suspended in PBS, fixed in 75% alcohol, permeabilized with 0.5% Triton X-100, incubated in 40 µg/mL RNase A, stained with 10 µg/mL Hoechst33342 and analyzed by flow cytometry.
Statistics
Statistical analyses were calculated using GraphPad software (GraphPad software, USA). All the experiments were repeated for three times. Significant differences between experimental samples were determined by a one-way analysis of variance followed by Tukey’s post hoc test. A p value of < 0.05 was considered statistically significant.
RESULTS
Immunohistochemical staining of testicular sections
Immunohistochemical staining was performed to identify the cells in testis tissue sections. In testicular tissue sections of 20-d-old piglets, UCHL1 expression was observed in SSCs located on the basement membrane of seminiferous tubules and varied in different SSCs measured by fluorescence intensity. Roughly 17% of SSCs showed low UCHL1 expression (Fig. 1A). The CD14+ staining was observed in the cytomembrane of germ cells (Fig. 1B). The NSE-positive staining was also observed in seminiferous tubules (Fig. 1C). In testicular tissues of 2-mon-old pigs, HIF-1α was highly expressed in SSCs and spermatocytes (Fig. 1D), HIF-1α-positive SSCs showed strong DBA-positive staining (Fig. 1E, arrow), while HIF-1α-positive spermatocytes showed weak DBA-positive staining (Fig. 1E, triangle).
Fig. 1
In testes sections of 20-d-old piglets, UCHL1 positive-staining was observed on cytoplasm of SSCs (A), CD14 expressed in cytomembrane of SSCs (B), NSE expression was observed in seminiferous tubules (C). Double immnolabelling of testes sections of 2-mon-old pig testes was carried out by DBA and HIF-1α. HIF-1α-positive staining was observed in SSCs (D, arrow) and spermatocyte (D, triangle). HIF-1α-positive SSCs also showed DBA specific affinity (E, arrow). Nuclear counterstaining was carried out by Hoechst33342. Scale bars = 50 μm.
In testes sections of 20-d-old piglets, UCHL1 positive-staining was observed on cytoplasm of SSCs (A), CD14 expressed in cytomembrane of SSCs (B), NSE expression was observed in seminiferous tubules (C). Double immnolabelling of testes sections of 2-mon-old pig testes was carried out by DBA and HIF-1α. HIF-1α-positive staining was observed in SSCs (D, arrow) and spermatocyte (D, triangle). HIF-1α-positive SSCs also showed DBA specific affinity (E, arrow). Nuclear counterstaining was carried out by Hoechst33342. Scale bars = 50 μm.
The SSCs used in this study were isolated from 20-d-old piglets. After Immunohistochemical staining of testicular sections, we found that CD14 was a surface marker of SSCs, which was consistent with the finds of a previous study [8]. Therefore, we hypothesized that CD14 was a marker that can be used for isolating SSCs by FACS. Immunofluorescence staining revealed that only 0.5% ± 0.1% of testicular cells expressed CD14. After isolation, sorted cells were analyzed by RT-PCR. Results revealed that the sorted cells expressed SSC specific markers such as DEAD box polypeptide 4 (DDX4), POU transcription factor (Oct4), UCHL1, CD14, and NANOS2; CDH1 was not detected (Fig. 2). The results demonstrated that the sorted cells were SSCs.
Fig. 2
OCT4, NANOS2, DDX4, CD14, and UCHL1 genes transcription were detected. CDH1 transcription was not detected.
The effects of DMOG on SSC proliferation
The effects of DMOG on SSC proliferation were measured by CCK-8 (Fig. 3). Results revealed that 200 µM DMOG increased the SSC proliferative ability to 32% ± 3%, and 400 µM DMOG increased the SSC proliferative ability to 60% ± 2%, when compared to the control. SSC proliferation increased to stable levels when the DMOG concentration reached 400 µM. After treatment with 800 and 1,000 µM DMOG, the cells proliferation did not significantly differ when compared to 400 µM DMOG, while the proliferation of shHIF-1α SSCs treated with 1,000 µM DMOG was significantly decreased (p < 0.05) when compared to the control.
Fig. 3
Cell proliferation was evaluated using CCK-8. Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant (p<0.05).
DMOG, dimethyloxaloylglycine.
Cell proliferation was evaluated using CCK-8. Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant (p<0.05).
DMOG, dimethyloxaloylglycine.Western blot analysis was carried out to evaluate the effects of different concentrations of DMOG on the expression of HIF-1α in SSCs. The results revealed that DMOG increased the HIF-1α protein levels in SSCs dose dependent (Fig. 4A). HIF-1α expression increased by 3-, 7-, 10-, and 11-fold under 200, 400, 800, and 1,000 µM DMOG treatment. The increased HIF-1α expression was not significant when comparing 1,000 to 800 µM DMOG (Fig. 4B). HIF-1α protein was not detected in shHIF-1α SSCs, however detected in the control, which was infected with empty vector (Fig. 4C). The results demonstrated HIF-1α expression in shHIF-1α SSCs was inhibited by shRNA of HIF-1α.
Fig. 4
The results of western blot analysis showed that DMOG significantly increased the protein levels of HIF-1α (A). The results of statistics suggested that the increase expression of HIF-1α in SSCs by DMOG was in a dose-dependent manner, there was no notable increase between the groups adding 800 μM and 1,000 μM DMOG, respectively (B). Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant. HIF-1α protein was detected in shHIF-1α SSCs, and detected in SSCs transfected with empty vector (C) (p<0.05).
The results of western blot analysis showed that DMOG significantly increased the protein levels of HIF-1α (A). The results of statistics suggested that the increase expression of HIF-1α in SSCs by DMOG was in a dose-dependent manner, there was no notable increase between the groups adding 800 μM and 1,000 μM DMOG, respectively (B). Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant. HIF-1α protein was detected in shHIF-1α SSCs, and detected in SSCs transfected with empty vector (C) (p<0.05).
Immunocytochemical analysis of SSCs and Sertoli cells
Immunocytochemical analysis was performed to identify the cultured SSC, and Sertoli cell, the results of which showed that the cultured cell clusters expressed SSC specific factors, such as CD14, UCHL1, and HIF-1α, and showed DBA specific binding (Fig. 5A-D). which demonstrated that the cell clusters were formed of SSCs. Sertoli cell specific markers, such as NSE and WT1, were detected in the cytoplasm and nucleus of the adherent cells, respectively (Fig. 5E and F). The results demonstrated that the adherent cells were Sertoli cells. Therefore, the in vitro cultured cells, including SSCs and Sertoli cells, remained the cell characters as in testis, and could be used for following experiments.
Fig. 5
The results showed the SSCs were positive staining for CD14 (A), UCHL1 (B), DBA (C), and HIF-1a (D). The Sertoli cells expressed NSE in cytoplasm (E), and WT1 in nuclear (F). Scale bar = 50 μm.
The results showed the SSCs were positive staining for CD14 (A), UCHL1 (B), DBA (C), and HIF-1a (D). The Sertoli cells expressed NSE in cytoplasm (E), and WT1 in nuclear (F). Scale bar = 50 μm.
After treatment with different concentrations of DMOG (0, 200, 400, 800, and 1,000 µM), the SSC-related genes were detected by qRT-PCR (Fig. 6). The results revealed that DMOG markedly increased (p < 0.05) the expression levels of UCHL1, CD14, NANOS2, OCT4, DDX4, and ID4 in a dose-dependent manner; the enhancement was not significant between 800 and 1,000 µM DMOG. Thus, the results indicated that 800 µM DMOG was the most appropriate concentration for maintaining the stemness of SSCs. Therefore, 800 µM DMOG was selected for subsequent experiments. The relative expression levels of UCHL1, CD14, NANOS2, OCT4, DDX4, and ID4 decreased in shHIF-1α SSCs cultured in the medium adding 1,000 µM DMOG when compared to the control, suggesting that the increased transcription of these genes can be attributed to the overexpression of HIF-1α stabilized by DMOG.
Fig. 6
Expression levels of UCHL1, CD14, NANOS2, OCT4, DDX4, and ID4 in SSCs were enhanced in response to DMOG in a dose-dependent manner. However, the relative expression levels of these genes decreased in shHIF-1α SSCs exposed to 1,000 µM DMOG. Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant (p<0.05).
Expression levels of UCHL1, CD14, NANOS2, OCT4, DDX4, and ID4 in SSCs were enhanced in response to DMOG in a dose-dependent manner. However, the relative expression levels of these genes decreased in shHIF-1α SSCs exposed to 1,000 µM DMOG. Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant (p<0.05).
DMOG improved the spermatogenesis potential of SSCs
Next, we determined the effects of 800 µM DMOG on the differentiation potential of SSCs and determined the genes related to spermatogenesis by qRT-PCR (Fig. 7). The results showed that 800 µM DMOG significantly increased (p < 0.05) the transcript levels of Stra 8, Tnp1, and ACROSIN in SSCs when compared to the control. The transcript levels of Stra 8 and Tnp1 decreased in shHIF-1α SSCs treated with 800 µM DMOG, while ACROSIN significantly decreased (p < 0.05) when compared to the control. The results of immunocytochemical staining showed that the inducted cells expressed Stra 8 and Scp3 protein in the cytoplasm and nucleus, respectively (Fig. 8). Flow cytometry analysis showed that the haploid peak was not observed in the testicular cell mixture of 20-d-old piglets (Fig. 9A), but was observed in adult testicular cell mixture (Fig. 9B), the haploid peak appeared in the DMOG-untreated SSCs (Fig. 9C). The populations of haploid cells significantly increased (p < 0.05) in DMOG-treated SSCs (Fig. 9D), compared to those in DMOG-untreated SSCs.
Fig. 7
The expression levels of Stra8, Tnp1, and ACROSIN were significantly enhanced in SSCs in response to 800 µM DMOG, however the expression levels of these genes decreased in shHIF-1α SSCs treated with 800 µM DMOG. Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant (p<0.05).
The inducted cells expressed Stra8 in cytoplasm and Scp3 in nuclear. Nuclear counterstaining was carried out by hoechst33342. Scale bars = 50 μm.
Fig. 9
DNA content of the testicular cell mixture from piglets was measured by flow cytometry (A). Haploid peak (1N) was not observed in the cell mixture, diploid peak (2N) and tetraploid peak (4N) were observed. DNA content of the testicular cell mixture from 2-mon-old pig was determined by flow cytometry (B). Haploid peak (1N), diploid peak (2N), and tetraploid peak (4N) were observed. DMOG-untreated SSCs were inducted and the cell content was measured (C). DMOG-treated SSCs were inducted and the cell content was measured, the populations of haploid cells were significantly increased in DMOG-treated SSCs, when compared to DMOG-untreated SSCs (D).
The expression levels of Stra8, Tnp1, and ACROSIN were significantly enhanced in SSCs in response to 800 µM DMOG, however the expression levels of these genes decreased in shHIF-1α SSCs treated with 800 µM DMOG. Different letters showed that the difference among the groups was significant, the same letters showed that the difference among the groups was not significant (p<0.05).
DNA content of the testicular cell mixture from piglets was measured by flow cytometry (A). Haploid peak (1N) was not observed in the cell mixture, diploid peak (2N) and tetraploid peak (4N) were observed. DNA content of the testicular cell mixture from 2-mon-old pig was determined by flow cytometry (B). Haploid peak (1N), diploid peak (2N), and tetraploid peak (4N) were observed. DMOG-untreated SSCs were inducted and the cell content was measured (C). DMOG-treated SSCs were inducted and the cell content was measured, the populations of haploid cells were significantly increased in DMOG-treated SSCs, when compared to DMOG-untreated SSCs (D).
SSC is the unique kind of cell that can transmit genetic information to next generation. Genetic manipulation of SSCs and differentiation of the transgenic SSCs into spermatoblast is a potential strategy to produce transgenic animal. In testes, physiological hypoxia maintains SSC self-renewal and spermatogenesis. To date, the SSCs had been mostly cultured in ambient air, and are unlikely to be optimally maintained for their spermatogenesis potential. A previous study suggested that the derivation of novel stem cell populations could be enhanced by culturing in the range of 3%–5% O2 [9]. Thus, we speculated that moderate hypoxia was crucial for the in vitro culturing of SSCs.DMOG is a proly1-4-hydroxylase inhibitor that upregulates HIF-1α protein levels under normoxic condition. HIF-1α activates a broad array of genes and therefore modulates cell proliferation, differentiation, and pluripotency. In this study, we demonstrated that HIF-1α was expressed in SSCs and spermatocyte in Bama minipig testes, which suggests that HIF-1α plays an important role in SSC proliferation and differentiation.Enriching SSCs is the first step toward establishing SSC cell lines. Differential plating is a widely used technique for SSC enrichment, however, the SSCs enriched by this method can be contaminated with testis somatic cells. Recently, CD14 was found to be a membrane marker in pig SSCs [8], and we confirmed this result in the present study, which made it possible to isolate pig SSCs by FACS. In this study, CD14+ SSCs were isolated using FACS, which guaranteed the high purity of SSCs.It had been demonstrated that DMOG had no obvious cytotoxic effects on adipose-derived stem cells [10]. Therefore, DMOG was chose in this study to mimic hypoxia microenvironment of seminiferous tubules. We found that DMOG could enhance SSC proliferation, this result was in consistent with the findings of a previous study [11]. However, the proliferation of shHIF-1α SSCs decreased when the cells cultured in the medium adding DMOG, which indicated that the SSC proliferation was attributed to accumulation of HIF-1α protein.A number of SSC-specific genes had been found so far. UCHL1 was found to be a conservative SSC marker of different species [12131415]. DDX4 is conserved in the germ cell development of many species [16]. NANOS2 is an intrinsic regulator that maintains undifferentiated state of SSCs in mice [17]. ID4, a key regulator of mammary stem cell self-renewal, was found to be a marker of SSCs in mice [18]. OCT4, a pluripotency marker, was also detected in SSCs [19]. Recently, CD14 had been discovered to be a membrane marker of pig SSC. In the present study, the transcriptional levels of aforesaid genes were significantly improved in DMOG-treated SSCs, the results demonstrated that DMOG could enhance the stemness activity of SSCs. However, the transcriptional levels of these genes were inhibited in DMOG-treated shHIF-1α SSCs, indicating that DMOG enhanced the expression of these genes by activating HIF-1α expression.In the present study, we demonstrated that the SSC proliferation ability increased to stable levels when the DMOG concentration reached 400 µM, while the expression of SSC-related genes increased to stable levels under 800 µM DMOG. This result indicated that the optimal concentrations of DMOG for activating different signaling pathways varied. Thus, we speculated that the higher expression levels of SSC-related genes reflected the enhanced stemness activity of SSCs. Therefore, 800 µM of DMOG was selected for the differentiation experiment, the results of which revealed that 800 µM DMOG could improve the transcriptional levels of Stra8, Tnp1, and ACROSIN. These 3 genes were respectively expressed in early, intermediate, and late stages of spermatogenesis. Stra8 is a meiosis gatekeeper [20]. Tnp1 is a post-meiotic gene and participates in nuclear transition [21]. ACROSIN is expressed in the head of elongated sperm. Upregulation of these 3 genes indicated that DMOG improved SSC spermatogenesis capability, and the cell content analysis also confirmed this result. However, the transcriptional levels of these 3 genes decreased when shHIF-1α SSCs were inducted in the medium adding 800 µM DMOG, which indicated that DMOG enhanced spermatogenesis capability was attributed to HIF-1α protein.In conclusion, we demonstrated that DMOG increased the expression of SSC-marker genes and improved the spermatogenesis capability of SSCs by stabilizing HIF-1α. This provides evidence for further applications of DMOG in SSC cultivation and differentiation.
Authors: Hanna Valli; Meena Sukhwani; Serena L Dovey; Karen A Peters; Julia Donohue; Carlos A Castro; Tianjiao Chu; Gary R Marshall; Kyle E Orwig Journal: Fertil Steril Date: 2014-06-02 Impact factor: 7.329
Authors: Natsumi Takahashi; Philip M C Davy; Lauren H Gardner; Juanita Mathews; Yuki Yamazaki; Richard C Allsopp Journal: PLoS One Date: 2016-05-05 Impact factor: 3.240