28S rRNA sequences for Linguatula spp.

Identification of specimens belonging to the genus Linguatula (Pentastomida) is relatively easy due to their unique morphology. However, differentiation between species of Linguatula can be challenging for several reasons, including considerable differences between different developmental stages of the parasite within and between species. Currently, 18S rRNA and Cox1 sequences are the only available comparable sequences in GenBank, but recent research has discussed the utility of 28S rRNA for pentastomid phylogenetics. This study presents 28S rRNA gene sequences for two members of the genus Linguatula. Sequences of 28S rRNA were successfully obtained from well-identified samples of L. serrata (collected in Australia) and L. nuttalli (collected in South Africa), with voucher specimens. Phylogenetic analysis of the 28S rRNA region showed 6% difference between L. serrata and L. nuttalli, with low levels of intraspecific variation. In comparison, 18S rRNA and Cox1 sequences from the same specimens showed 0.23% and 13% interspecific differences, respectively. The results of this study show that 28S rRNA has greater genetic diversity to allow for improved differentiation between species of Linguatula than 18S rRNA but is on par with Cox1. Records that do not provide adequate morphological or molecular data to justify independent specific diagnoses must be regarded cautiously, and the need for continued research on species of Linguatula, using a combined morphological and molecular analysis, across a number of different hosts, development stages, geographical regions and molecular markers is highlighted.

Introduction

Linguatula spp., belonging to the Pentastomida, are obligatory arthropod parasites which have an indirect life cycle. When adult, they inhabit the nasal cavity of their definitive hosts, which usually is a carnivorous mammal, such as a canid (Shamsi et al. 2017b) or a felid (Shamsi et al. 2020b). They produce eggs which are expelled to the environment through faeces or nasal discharge. When ingested by the intermediate host, usually a herbivorous mammal (Barton et al. 2020a, 2020b), the eggs hatch and the parasite migrates through various organs such as the lung, liver, and lymph nodes (Basson et al. 1970) where the nymph undergoes development. The parasite life cycle is completed when an infected intermediate host is ingested by the definitive host. Linguatula spp. are known to be pathogenic for both definitive and intermediate hosts (Godara et al. 2013; Shamsi et al. 2018). They are also commonly reported from humans (Tabaripour et al. 2021). Despite their veterinary and medical significance, the taxonomy and classification of these parasites have been confusing and often contradictory (Christoffersen and de Assis 2013; Poore 2012) which, along with the worldwide shortage of taxonomists, has resulted in difficulties in specifically and accurately identifying these parasites.

At present, the genus is comprised of five valid species (Christoffersen and de Assis 2013; Poore 2012): L. arctica Riley et al., 1987; L. multiannulata Haffner, Sachs & Rack, 1967; L. nuttalli Sambon, 1922; L. recurvata (Diesing, 1850); and L. serrata Frölich, 1789. Although identification to genus is relatively easy, differentiation between species of Linguatula can be challenging for a number of reasons. Morphologically, there are considerable differences between different developmental stages of the parasite within and between species. The taxonomic value of these differences is not yet fully understood. As a result, it is not surprising that the taxonomy and classification of these parasites have been problematic (Christoffersen and de Assis 2013; Poore 2012).

Of the reported species, L. serrata seems to be the most widespread and the most studied Linguatula. It is believed that L. serrata has been spread from Europe to other continents through human movements involving movement of infected dogs and cattle (Ortlepp 1934; Shamsi et al. 2020a). However, there are many publications that have based their identification of the parasite on the assumption that any pentastome removed from the nasal cavity of a mammal is L. serrata. Indeed, pentastomes collected from the nasal passages of reindeer were initially reported as L. serrata by Chapin (1926) and others, until differences in morphology and type of definitive host and a putative direct life cycle eventually led to its description as a new species, L. arctica, by Riley et al. (1987). Additionally, many reports of L. serrata are based on the observation of nymphal specimens which, like the adult, are automatically assumed to be L. serrata without corresponding morphological characterisation (see Pérez-Flores et al. 2019).

Recently, genetic identification has been undertaken, but quite often without providing sufficient justification for species identification (e.g., Ghorashi et al. 2016; Naude et al. 2018; Sudan et al. 2018; Mohammadi et al. 2020), leading to the potential of mis-identified genetic sequences to further confuse and compromise future studies. The absence of well identified/described specimens, with representative vouchered museum specimens, prevents the sequences from truly clarifying or verifying taxonomic identifications. This has added to the current poor understanding of the fundamental aspects of these parasites and the ability to accurately diagnose infections.

For example, in a study on pentastomid nymphs collected from herbivores in Iran, partial sequences of 18S rRNA were used to assign them to L. serrata (Ghorashi et al. 2016). In a latter study (Shamsi et al. 2020b), sequences of these pentastomid nymphs formed a group distinct from L. serrata reported in Europe, suggesting that they belong to a different, as yet unknown, species. Although adult Linguatula have been collected from dogs in Iran, there has been no morphological description of adult Linguatula in the country to confirm the specific identity and taxonomic status of the parasite in Iran. Indeed, the sequence obtained by Ghorashi et al. (2016) for an adult specimen of Linguatula collected from an Iranian dog did not match with the sequence provided by Gjerde (2013).

Currently, 18S rRNA and Cox1 sequences are the only available comparable sequences in GenBank. Shamsi et al. (2020b), in their work on L. nuttalli, stated that as these two regions are two independent gene targets, they provide independent views of the phylogenetic relationships among species. However, low levels of genetic variability in 18S rRNA sequences, as found for Linguatula spp. (Gjerde 2013; Shamsi et al. 2020a, b), make it difficult to differentiate species level identifications (Literák et al. 2017). In a recent work on Levisunguis subaequalis (Pentastomida), Woodyard et al. (2019a) discussed the utility of the 28S rRNA marker for pentastomid phylogenetics. Therefore, the aim of the present study was to determine the suitability and utility of 28S rRNA for differentiation of Linguatula spp.

Materials and methods

Specimens of Linguatula spp. that have been morphologically identified in the Parasitology Laboratory at Charles Sturt University, Australia, were utilised for the genetic analyses of this study (Table 1). Morphological descriptions, including reference to deposited museum specimens, are available in Barton et al. (2020a), Barton et al. (2020b), Shamsi et al. (2020a) and Shamsi et al. (2020b) (see Online Resource 1).

Table 1

Details of sequences of species of Linguatula used in this study. Except for MN065508, all remaining 28S rRNA sequences were generated from this study. References listed for Linguatula nuttalli and Linguatula serrata are for 18S rRNA and CoxI sequences

ID	Species name	Locality	Host	Developmental stage	GenBank accession number			Reference
					28S	18 s	COI
1	L. nuttalli	Africa	Buffalo	Nymph	OM304814	MN906667	MN905329	Shamsi et al. (2020b)
2	L. nuttalli	Africa	Buffalo	Nymph	OM304815	MN906673	MN905335	Shamsi et al. (2020b)
3	L. nuttalli	Africa	Buffalo	Nymph	OM304816	MN906674	MN905336	Shamsi et al. (2020b)
4	L. nuttalli	Africa	Buffalo	Nymph	OM304817	MN906672	MN905330	Shamsi et al. (2020b)
5	L. nuttalli	Africa	Buffalo	Nymph	OM304818	MN906675	MN905338	Shamsi et al. (2020b)
6	L. nuttalli	Africa	Buffalo	Nymph	OM304819	MN906670	MN905334	Shamsi et al. (2020b)
7	L. nuttalli	Africa	Lion	Adult female	OM304820	MN906671	MN905331	Shamsi et al. (2020b)
8	L. nuttalli	Africa	Lion	Adult	OM304821	MN906668	MN905332	Shamsi et al. (2020b)
9	L. serrata	Australia	Cow	Nymph	OM304822	MN889436	MN893765	Shamsi et al. (2020a)
10	L. serrata	Australia	Cow	Nymph	OM304823
11	L. serrata	Australia	Cow	Nymph	OM304824
12	L. serrata	Australia	Cow	Nymph	OM304825
13	L. serrata	Australia	Dog	Adult female	OM304826
14	L. serrata	Australia	Dog	Adult male	OM304827
15	L. serrata	Australia	Dog	Adult female	OM304828	MN889438	MN893767	Shamsi et al. (2020a)
16	L. serrata	Australia	Dog	Adult male	OM304829
17	L. serrata	Australia	Dog	Adult female	OM304830
18	L. serrata	Australia	Dog	Adult male	OM304831	MN889440	MN893769	Shamsi et al. (2020a)
19	L. serrata	Australia	Fox	Adult male	OM304832	MN889437	MN893766	Shamsi et al. (2020a)
20	L. serrata	Australia	Fox	Adult female	OM304833	MN889439	MN893768	Shamsi et al. (2020a)
21	L. serrata	Australia	Fox	Adult male	OM304834
22	L. serrata	Australia	Fox	Adult female	OM304835
23	L. serrata	Australia	Fox	Adult male	OM304836
24	L. serrata	Australia	Rabbit	Nymph	OM304837	MT196141	MT198822	Barton et al. (2020a, b)
25	L. serrata	Australia	Red-necked wallaby	Nymph	OM304838	MT367681	MT371890	Barton et al. (2020b)
26	L. serrata	Australia	Red-necked wallaby	Nymph	OM304839	MT367682	MT371891	Barton et al. (2020b)
27	L. serrata	Australia	Red-necked wallaby	Nymph	OM304840	MT367683	MT371892	Barton et al. (2020b)
28	L. serrata	Australia	Red-necked wallaby	Nymph	OM304841	MT367685	MT371894	Barton et al. (2020b)
29	Armillifer agkistrodontis	China	Snake	Adult		FJ607339	FJ607340	Chen et al. (2010)
30	Levisunguis subaequalis	USA	Mosquitofish	Nymph	MN065508			Woodyard et al. (2019a, b)

DNA extraction was performed using DNeasy Blood and Tissue Kits (Qiagen, Australia) according to the modified protocol of the manufacturer detailed in Shamsi et al. (2017a). A pair of primers were newly designed for the nuclear 28S rRNA region. The primer sequences are Ling_28SFm 5′ AGCTCATCGCCGAACCCT 3′ and Ling_28SRm 5′ATAGTTCACCATCTTTCGGGTCC 3′. PCR amplification was performed using GoTaq DNA polymerase (Promega, Australia) as per the manufacturer’s instructions. Cycling was initiated with a 2-min initial denaturation at 95 °C and followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s and extension for 1 min at 72 °C. The cycle was concluded with a final extension at 72 °C for 10 min. PCR amplicons of 28S rRNA region were bidirectionally sequenced using the PCR primers by the Australian Genome Research Facility (Brisbane, Queensland, Australia). Sequences were deposited in GenBank with accession numbers OM304814-OM304821 (L. nuttalli) and OM304822-OM304841 (L. serrata).

Cox1 and 18S rRNA sequences for the same specimens as used for the generation of the 28S rRNA gene sequences were obtained from GenBank (Table 1). All sequences were aligned with ClustalW in BioEdit (Hall 1999). Alignments were manually adjusted and truncated into 941, 1728 and 1256 bp for Cox1, 18S rRNA and 28S rRNA, respectively. Indels were ignored for analysis. Pairwise genetic distances among samples are shown as K2P genetic distance, and a number of differences were calculated by MEGA X (Kumar et al. 2018). Neighbour joining trees showing the grouping of species for the three genes were generated by the same software. Sequences from Levisunguis subaequalis (MN065508 for 28S rRNA) and Armillifer agkistrodontis (FJ607340 for Cox1 and FJ607339 for 18S rRNA) were used as outgroups.

Results and discussion

This study presents 28S rRNA gene sequences for members of the genus Linguatula. Sequences of 28S rRNA were successfully obtained from samples of L. serrata (20 sequences: 9 collected from nymphs from various intermediate hosts and 11 collected from adults from wild dogs (Canis familiaris) and foxes (Vulpes vulpes); all collected in Australia) and L. nuttalli (8 sequences: 6 collected from nymphs from buffalo (Syncerus caffer) and 2 collected from adults from lions (Panthera leo); all collected in South Africa) (Fig. 1A; Table 1).

Fig. 1

Neighbour joining tree showing the grouping of Linguatula serrata and Linguatula nuttalli for A 28S sequences, B 18S sequences and C Cox1 sequences used in this study. All 28S sequences, except the outgroup species, were obtained from this research. Indels were ignored from analysis

Across the three gene regions analysed, there was clear separation of L. serrata and L. nuttalli with 6.17–6.46% (68–70 out of 1256 base pairs) (Fig. 1A; Online Resource 2) and 13.09–13.31% (109–113 out of 941 base pairs) (Fig. 1C; Online Resource 4) interspecific difference for 28S rRNA and Cox1, respectively. This range of interspecific variation for Cox1 was similar to that found in previous research with 9.8% difference between L. serrata and L. arctica (Gjerde 2013) and 12% between L. serrata and L. recurvata (Pérez-Flores et al. 2019). The results for 18S rRNA were much lower with 0.23% (4 out of 1728 base pairs) interspecific difference (Fig. 1B; Online Resource 3). This is consistent, however, with previous research, showing low levels of interspecific differences, with a 0.1% difference (2 of 1830 base pairs) between L. serrata and L. arctica (Gjerde 2013; Mohanta and Itagaki 2017). These results highlight that there may be multiple species of Linguatula in Iran, as suggested by Shamsi et al. (2020a), based on the results of Ghorashi et al. (2016) with interspecific differences within L. serrata sequences ranging from 0 to 2.9% for 18S rRNA.

Levels of intraspecific variation also differed between the three gene regions. Both L. serrata and L. nuttalli showed 0% intraspecific variation in the 18S sequences. However, L. serrata showed 0–0.26% and 0–0.43% intraspecific variation, while L. nuttalli showed 0–0.17% and 0–0.86% intraspecific variation at 28S and Cox1, respectively. Given the high level of differences between the two recognised species at both the 28S and Cox1 genes, it is unlikely that this level of intraspecific variation is due to a species complex. However, more research needs to be undertaken, obtaining sequences from different life cycle stages and hosts across a wide geographical range, and for different species of Linguatula, to ensure all potential variabilities have been accounted for.

The intraspecific variation for 28S rRNA sequences for L. serrata was generally 0%, except for three sequences which showed consistent differences: two sequences obtained from nymphs collected from a cow (Bos taurus) (OM304824, OM304825) (0.17%) and an adult female collected from a fox (OM304835) (up to 0.26%). Sequences for L. nuttalli showed similar levels of intraspecific variation, with most having 0% difference, except for sequences obtained from three of the nymphal specimens. These nymphs showed 0.09% (OM304817, OM304819) and 0.17% (OM304814) difference to the other sequences (Online Resource 2).

Within L. serrata, most Cox1 sequences varied by 0.11–0.21%, with a few sequences having no variation; the sequence obtained from the nymph collected from the rabbit (Oryctolagus cuniculus) (MT198822) showed 0.21–0.43% difference to all the other L. serrata sequences (Online Resource 4). Within L. nuttalli, most sequences had no variation except for two nymphs which consistently had 0.86% difference to the other sequences (MN905334, MN905336); one of these was the same nymph that showed variation in the 28S rRNA sequences. Intraspecific variation in Cox1 sequences for L. serrata from various Iranian samples show lower values of differences. Despite finding a 9–10.9% difference between L. serrata and L. arctica sequences, Ghorashi et al. (2016) found only 0.4–3.1% differences within Iranian samples, and an overall diversity of 0.7–1.8% to the L. serrata sequence of Gjerde (2013). As with some of the sequences obtained in this study, Ghorashi et al. (2016) noted differences in sequences between samples collected from different host animals. Sudan et al. (2018) also found intra-specific variability in the sequences of L. serrata, with different groupings of samples: one group showed nymphs from Indian buffaloes with a nymph from a Bangladeshi cow and an Iranian sheep (from Kerman); another group were all collected from the Kerman region of Iran, from cattle, sheep and goats; the last group was a mix of sequences from specimens collected from various hosts and geographical locations, including Peru, Bangladesh and Iran. External to these groups were nymphs collected from sheep from Tabriz, Iran (KF830143 & KF830144; Ghorashi et al., 2016), and the L. serrata adult from the dog in Norway (Gjerde 2013). However, Sudan et al. (2018) reported that there was only a 0–0.2% difference between the sequences. Bootstrap support for all the trees created in this study was confident (> 70%). The Cox1 tree had higher support than the 28S and 18S trees, probably due to the higher number of fixed mutations. The clade of L. serrata in the 28S tree had slightly lower bootstrap support, probably due to a few unique point mutations in sequences OM304824, OM304825 and OM304835, as discussed above.

As has been shown in this study, there are substantially different levels of intra and inter-specific variability between sequences across the three different markers examined. However, the levels of variability appear to match results found for other pentastome genera. For example, intraspecific variability for nymphs of Sebekia mississippiensis was reported as 0–0.09% for 28S and 0–1.03% for Cox1 (Woodyard et al. 2019a, b) and < 1% for Alofia merki for Cox1 (J. Morgan, pers. comm.), whereas there were no differences within Reighardia sternae for 18S rRNA (Literák et al. 2017). Thus, it appears that there are low levels of intraspecific variability within the three genetic markers across many pentastomid genera. Interspecific differences for the genus Sebekia (as presented in Barton and Morgan (2016)) were > 5% for 28 s rRNA and > 14% for Cox1 but < 0.5% for 18S rRNA (J. Morgan, pers. comm.). These results, as well as the results reported in this study, show that 28S rRNA and Cox1 have higher levels of interspecific variability, showing potentially better species-level differentiation compared to the results for 18S rRNA.

Woodyard et al. (2019b) stressed that host records that do not provide adequate morphological or molecular data to justify independent specific diagnoses must be regarded cautiously. In earlier studies, we have provided comprehensive morphological measurements in combination with molecular characterisation. More research is required to sample specimens of Linguatula from as wide a host and geographical range as possible, utilising a combination of morphological and molecular characterisation to ultimately determine the levels of intraspecific variability across the various molecular markers.

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 21 KB)

Supplementary file2 (DOCX 27 KB)

Supplementary file3 (DOCX 20 KB)

Supplementary file4 (DOCX 20 KB)