| Literature DB >> 35359850 |
Yi Zhang1, Ning Sun1, Meng Zhang1,2, Qian Ding1,2, Qian Wang1, Yuguang Liang1, Huan He1, Yuxin Yang1, Chunyan Guo1,2.
Abstract
The Fuyou (Fy) formula is an in-hospital preparation consisting of traditional Chinese medicine (TCM) that has been used for treating precocious puberty (PP) for more than 20 years. In this study, we aimed to clarify the effect of the Fy formula and its major components on PP. To confirm the effect of the Fy formula on the release of hypothalamic gonadotropin-releasing hormone (GnRH), GT1-7 cells were treated with estrogen to build the model group and subsequently treated with the Fy formula and its major components to explore their effects on the secretion of GnRH. The level of GnRH in GT1-7 cells was determined using enzyme-linked immunosorbent assay. The results illustrated that, compared to the model group, the Fy formula inhibited the release of GnRH. In addition, the expression levels of proteins related to GnRH secretion, including GnRH, gonadotropin-releasing hormone receptor (GnRHR), Kiss-1 metastasis-suppressor (Kiss1), G-protein coupled receptor 54 (GPR54), estrogen receptor α (ERα), insulin-like growth factor-1 (IGF-1), and insulin-like growth factor-1 receptor (IGF-1R), were detected by real-time polymerase chain reaction (RT-qPCR). The results demonstrated that the Fy formula significantly reduced the level of GnRH secretion in the GT1-7 cell lines compared with the model group. Moreover, it significantly downregulated the expression of GnRH, GnRHR, Kiss1, GPR54, ERα, IGF-1, and IGF-1R. In summary, our results indicate that the Fy formula and its major components may inhibit the effects of estrogen, which alleviates PP through transcriptional regulation of target genes.Entities:
Keywords: ER; GnRH; KISS1; fuyou formula; gene expression; precocious puberty
Year: 2022 PMID: 35359850 PMCID: PMC8962374 DOI: 10.3389/fphar.2022.852550
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primer sequences used in quantitative real-time polymerase chain reaction.
| Gene | Forward primer (5′—3′) | Reverse primer (3′—5′) |
|---|---|---|
|
| ACTCTTCCAGCCTTCCTTC | ATCTCCTTCTGCATCCTGTC |
|
| GGGAAGACATCAGTGTCCCAG | CTCGAGCTTCCGTTGGTAGG |
|
| TGCAGGACCACAGAACTACAG | GTCCAGCAGACGACAAAGGA |
|
| GATGTCTGCAGCCTGAGTCCC | AGGCATTAACGAGTTCCTGGG |
|
| CTGTCAGCCTCAGCATCTGG | AGCAGCGGCAGCAGATATAG |
|
| AAGACGCTCTTGAACCAGCA | CGAGTTACAGACTGGCTCCC |
|
| AAGGCAGTTTACCCAGGCTC | GGCCGAGGTGAACACAAAAC |
|
| TACCAGCATTAACTCCGCTG | GCTCGCCTCTCTCGAGTTC |
GnRH, gonadotropin-releasing hormone; GnRHR, gonadotropin-releasing hormone receptor; Kiss1, Kiss-1 metastasis-suppressor; GPR54, G-protein coupled receptor 54; ERα, estrogen receptor α; IGF-1, insulin-like growth factor-1; IGF-1R, insulin-like growth factor-1 receptor.
Composition of the Fy formula.
| Chinese name | Scientific name | Family | Lot no | Place of origin | Parts of plant used |
|---|---|---|---|---|---|
| Xia Ku Cao |
|
| 20201010 | Jiangsu, China | Driod orial parts |
| Cu Bie Jia |
|
| 20201018 | Hubei, China | Carapace |
| Long Dan |
|
| 20200927 | Yunnan, China | Dried roots and rhizomes |
| Ju Hua |
|
| 20201027 | Anhui, China | Capitulum |
| Di Gu Pi |
|
| 20201105 | Hebei, China | Dried root bark |
| Ze Xie |
|
| 20201126 | Fujian, China | Dried tuber |
| Xuan Shen |
|
| 20201019 | Zhejiang, China | Dried root tuber |
| Mu Dan Pi |
|
| 20201123 | Anhui, China | Dried root bark |
| Sheng Di Huang |
|
| 20201104 | Henan, China | Dried root tuber |
| Mai Ya |
|
| 20201030 | Hebei, China | Dried ripe fruit |
| Mu Li |
|
| 20200917 | Guangdong, China | Shell |
| Kun Bu |
|
| 20200922 | Fujian, China | Dried lobes |
FIGURE 1Effects of luteolin, apigenin, quercetin, and the Fy formula, at different concentrations, on GT1-7 cells. The CCK-8 assay was conducted to determine cell proliferation in the GT1-7 cells after treatment with luteolin, apigenin, quercetin, and the Fy formula at different concentrations.
FIGURE 2Effects of luteolin, apigenin, quercetin, and the Fy formula on GnRH secretion. Cells pretreated with E2 stimulate the secretion of GnRH, and the level of GnRH secretion decreases when coincubated with luteolin, apigenin, quercetin, and the Fy formula. ***p < 0.0001 compared to the model group.
FIGURE 3Effects of luteolin, apigenin, quercetin, and the Fy formula on the expression of GnRH, GnRHRc, Kiss1, GPR54, ERα IGF-1, and IGF-1R, which are involved in GnRH secretion. *p < 0.05, **p < 0.001, and ***p < 0.0001 compared to the model group.