| Literature DB >> 35359600 |
Md Tofazzal Hossain1,2,3, Song Li4, Md Selim Reza1,2, Shengzhong Feng2, Xiaojing Zhang5, Zhe Jin5, Yanjie Wei2, Yin Peng5.
Abstract
Gastric cancer (GC) is one of the most common malignant tumors and ranks third in cancer mortality globally. Although, a lot of advancements have been made in diagnosis and treatment of gastric cancer, there is still lack of ideal biomarker for the diagnosis and treatment of gastric cancer. Due to the poor prognosis, the survival rate is not improved much. Circular RNAs (circRNAs) are single-stranded RNAs with a covalently closed loop structure that don't have the 5'-3' polarity and a 3' polyA tail. Because of their circular structure, circRNAs are more stable than linear RNAs. Previous studies have found that circRNAs are involved in several biological processes like cell cycle, proliferation, apoptosis, autophagy, migration and invasion in different cancers, and participate in some molecular mechanisms including sponging microRNAs (miRNAs), protein translation and binding to RNA-binding proteins. Several studies have reported that circRNAs play crucial role in the occurrence and development of different types of cancers. Although, some studies have reported several circRNAs in gastric cancer, more studies are needed in searching new biomarkers for gastric cancer diagnosis and treatment. Here, we investigated potential circRNA biomarkers for GC using next-generation sequencing (NGS) data collected from 5 paired GC samples. A total of 45,783 circRNAs were identified in all samples and among them 478 were differentially expressed (DE). The gene ontology (GO) analysis of the host genes of the DE circRNAs showed that some genes were enriched in several important biological processes, molecular functions and cellular components. The Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis revealed that some host genes were enriched in several GC related pathways. The circRNA-miRNA-gene interaction network analysis showed that two circRNAs circCEACAM5 and circCOL1A1 were interacted with gastric cancer related miRNAs, and their host genes were also the important therapeutic and prognostic biomarkers for GC. The experimental results also validated that these two circRNAs were DE in GC compared to adjacent normal tissues. Overall, our findings suggest that these two circRNAs circCEACAM5 and circCOL1A1 might be the potential biomarkers for the diagnosis and treatment of GC.Entities:
Keywords: circRNA biomarker; circRNA-miRNA-gene interaction; circular RNA; computational approach; gastric cancer
Year: 2022 PMID: 35359600 PMCID: PMC8960148 DOI: 10.3389/fmolb.2022.857320
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
FIGURE 1Expression profiles of circRNAs. (A) Venn-diagram of the identified circRNAs in normal and cancer samples, (B) Length distribution of circRNAs, (C) Classification of the identified circRNAs, (D) Distribution of the number of back spliced reads, and (E) Chromosome distribution of the identified circRNAs.
Summary Statistics of the circRNAs.
| Summary statistics | |
|---|---|
| Min | 48 |
| 1st Quartile | 359 |
| Median | 563 |
| Average | 3,042 |
| 3rd Quartile | 1,037 |
| Max | 199,579 |
FIGURE 2Distribution of circRNAs. (A) Expression (FPKM) of circRNAs for different samples, (B) Biplot of PCA loadings for different samples, (C) Distribution of circRNAs derived from different number of exons, and (D) Distribution of the number of circRNAs per gene.
FIGURE 3Volcano plot of the circRNAs. Red colors indicate upregulated circRNAs while blue colors indicate downregulated circRNAs and black colors indicate not significant. Results of DE analysis of (A) Sample_1N vs Sample_1T, (B) Sample_2N vs Sample_2T, (C) Sample_3N vs Sample_3T, (D) Sample_4N vs Sample_4T, (E) Sample_5N vs Sample_5T, and (F) Sample_N vs Sample_T.
Number of DE circRNAs in different samples.
| Control | Case | Upregulated | Downregulated | Total |
|---|---|---|---|---|
| Sample_1N | Sample_1T | 91 | 90 | 181 |
| Sample_2N | Sample_2T | 90 | 114 | 204 |
| Sample_3N | Sample_3T | 126 | 100 | 226 |
| Sample_4N | Sample_4T | 94 | 89 | 183 |
| Sample_5N | Sample_5T | 136 | 139 | 275 |
| Sample_N | Sample_T | 242 | 236 | 478 |
FIGURE 4Heatmap of the DE circRNAs. The heatmap represents the expression profile of the DE circRNAs in GC compared to the adjacent normal tissues. The color scale indicates the Log2FoldChange of the expression value for each circRNA in cancers vs normal tissues. Red and green colors indicate down-regulation and up-regulation of the circRNAs respectively.
Top 8 (4 upregulated and 4 downregulated) circRNAs.
| circRNA name | circRNA ID | Base mean | Log2 FC |
| FDR | Host gene |
|---|---|---|---|---|---|---|
| circCEACAM5 | NC_000,019.10:41,720,921|41,727,352 | 163.53 | 3.05 | 3.9 × 10−03 | 1.0 × 10−01 | CEACAM5 |
| circMISP | NC_000,019.10:756,889|760,039 | 2093.45 | 2.42 | 3.4 × 10−03 | 9.0 × 10−02 | MISP |
| circCOL1A1 | NC_000,017.11:50,194,129|50,194,828 | 540.5 | 2.66 | 2.4 × 10−10 | 1.7 × 10–06 | COL1A1 |
| circCOL3A1 | NC_000,002.12:188,999,860|189,004,054 | 2,678.48 | 1.92 | 8.7 × 10−07 | 4.3 × 10−04 | COL3A1 |
| circLIPF | NC_000,010.11:88,667,286|88,675,657 | 1766.22 | -4.50 | 8.8 × 10−03 | 1.0 × 10−01 | LIPF |
| circPGC | NC_000,006.12:41,741,795|41,742,489 | 2,300.96 | -3.48 | 3.7 × 10−03 | 1.0 × 10−01 | PGC |
| circPGC_1 | NC_000,006.12:41,742,289|41,743,389 | 18,599.68 | -3.58 | 1.3 × 10−03 | 5.6 × 10−02 | PGC |
| circPGC_2 | NC_000,006.12:41,740,207|41,740,610 | 401.54 | -3.67 | 4.3 × 10−06 | 1.3 × 10−04 | PGC |
FIGURE 5CircRNA-miRNA-gene interaction network. Ellipse shape indicates circRNA, diamond shape indicates miRNA while triangle indicates gene. Blue triangle indicates genes related to GC and black triangle indicates other genes.
The five hub circRNAs, their interacted gastric cancer related miRNAs and the host genes of the circRNAs.
| Name | circRNA ID | Host gene | Interacted miRNAs |
|---|---|---|---|
| CircMISP | NC_000,019.10:756,9889|760,9039 | MISP | hsa-miR-508-5p, 873-5p, 125a-5p, 1236-3p, 138-5p, 148b-3p, 148a-3p, 151a-5p, 152-5p, 193a-5p, 193a-3p, 199a-5p, 204-5p, 24-3p, 28-5p, 296-5p, 29a-3p, 302b-3p, 326, 331-3p, 338-3p, 346, 375, 423-5p, 486-5p, 491-5p |
| CircCOL3A1 | NC_000,002.12:188,999,860|189,004,054 | COL3A1 | hsa-miR-634, 584-3p, 645, 99b-5p, 145-5p, 152-5p, 15b-5p, 16-5p, 198, 195-5p, 29a-3p, 424-5p, 490-3p, 501-5p, 508-5p |
| CircLIPF | NC_000,010.11:88,667,286|88,675,657 | LIPF | hsa-miR-509-3p, 634, 645, 103a-3p, 107, 145-5p, 148a-3p, 17-5p, 199a-3p, 216a-3p, 28-5p, 27a-3p, 320a, 338-3p |
| CircCEACAM5 | NC_000,019.10:41,720,921|41,727,352 | CEACAM5 | hsa-miR-634, 944, 1207-5p, 143-3p, 146b-5p, 203a-3p, 216a-3p, 361-5p, 429 |
| CircCOL1A1 | NC_000,017.11:50,194,129|50,194,828 | COL1A1 | hsa-miR-634, 129-5p, 145-5p, 21-3p, 29a-3p, 501-5p |
FIGURE 6Expression analysis of the targeted miRNAs of the circRNAs circCEACAM5 and circCOL1A1. (A) Clustered heatmap represents the expression profile of the DE miRNAs in GC compared to normal tissues. The color scale indicates the Log2FoldChange of the expression value for each miRNA in cancers vs normal tissues. Red color implies down-regulation while green color indicates up-regulation. (B) Volcano plot of the DE miRNAs in GC relative to normal tissues. Red, blue and black dots indicate up-regulation, down-regulation and not significant respectively. (C) Identification of the potential target miRNAs of the circRNAs circCEACAM5 and circCOL1A1. Expression levels of (D) hsa-miR-429, (E) hsa-miR-21-3p and (F) hsa-miR-145-5p in GC compared to normal tissues.
FIGURE 7Validation of the expression of 6 host genes of the top up and down regulated circRNAs in GC. The expression of (A) CEACAM5, (B) MISP, (C) COL1A1 and (D) COL3A1 was upregulated, and the expression of (E) LIPF and (F) PGC was downregulated in gastric tumor compared to normal samples from the TCGA data. The cutoffs |Log2FoldChange|>1 and p-value<0.05 were considered as statistically significant.
FIGURE 8ROC analysis of the candidate circRNAs. The AUC values of the ROC curves of (A) circCEACAM5 and (B) circCOL1A1 represented the accuracy of these circRNAs in distinguishing GC and normal patients.
Top 30 GO terms for the top 50 hub genes from the PPI networks of the host genes of the DE circRNAs.
| GO term | GO name | No. of genes |
|
|---|---|---|---|
|
| |||
| GO:0,098,609 | cell-cell adhesion | 9 | 8.95E-07 |
| GO:0,030,198 | extracellular matrix organization | 7 | 1.91E-05 |
| GO:0,006,281 | DNA repair | 7 | 5.29E-05 |
| GO:0,007,067 | mitotic nuclear division | 7 | 7.13E-05 |
| GO:0,030,199 | collagen fibril organization | 4 | 1.86E-04 |
| GO:0,009,615 | response to virus | 5 | 2.72E-04 |
| GO:0,051,301 | cell division | 7 | 4.61E-04 |
| GO:0,030,574 | collagen catabolic process | 4 | 8.08E-04 |
| GO:0,007,051 | spindle organization | 3 | 9.36E-04 |
| GO:0,006,260 | DNA replication | 5 | 9.91E-04 |
|
| |||
| GO:0,005,524 | ATP binding | 18 | 4.83E-07 |
| GO:0,098,641 | cadherin binding involved in cell-cell adhesion | 9 | 1.69E-06 |
| GO:0,005,515 | protein binding | 41 | 1.57E-05 |
| GO:0,048,407 | platelet-derived growth factor binding | 3 | 4.46E-04 |
| GO:0,005,201 | extracellular matrix structural constituent | 4 | 9.66E-04 |
| GO:0,003,677 | DNA binding | 13 | 0.002467 |
| GO:0,008,017 | microtubule binding | 5 | 0.003076 |
| GO:0,031,490 | chromatin DNA binding | 3 | 0.012302 |
| GO:0,003,725 | double-stranded RNA binding | 3 | 0.013545 |
| GO:0,003,777 | microtubule motor activity | 3 | 0.022588 |
|
| |||
| GO:0,005,654 | nucleoplasm | 28 | 1.30E-10 |
| GO:0,030,496 | midbody | 8 | 5.07E-08 |
| GO:0,031,012 | extracellular matrix | 10 | 8.10E-08 |
| GO:0,005,913 | cell-cell adherens junction | 9 | 2.14E-06 |
| GO:0,005,829 | cytosol | 23 | 1.49E-05 |
| GO:0,005,634 | nucleus | 30 | 1.71E-05 |
| GO:0,072,686 | mitotic spindle | 4 | 1.81E-04 |
| GO:0,005,876 | spindle microtubule | 4 | 2.24E-04 |
| GO:0,005,737 | cytoplasm | 26 | 7.87E-04 |
| GO:0,005,604 | basement membrane | 4 | 0.001251 |
Significant pathways for the top 50 hub genes from the PPI network of the host genes of the DE circRNAs.
| Pathway ID | Pathway description | No. of genes |
|
|---|---|---|---|
| hsa04512 | ECM-receptor interaction | 14 | 0.0000 |
| hsa05146 | Amoebiasis | 10 | 0.0017 |
| hsa04510 | Focal adhesion | 12 | 0.0031 |
| hsa04151 | PI3K-Akt signaling pathway | 14 | 0.0062 |
| hsa04974 | Protein digestion and absorption | 8 | 0.0091 |
| hsa05145 | Toxoplasmosis | 8 | 0.0166 |
| hsa04110 | Cell cycle | 8 | 0.0228 |
| hsa05162 | Measles | 8 | 0.0273 |
| hsa05160 | Hepatitis C | 8 | 0.0273 |
| hsa00010 | Glycolysis/Gluconeogenesis | 6 | 0.0429 |
| hsa01230 | Biosynthesis of amino acids | 6 | 0.0489 |
FIGURE 9The relative expression level of top 5 up and downregulated circRNAs. The expression of (A) circCEACAM5, (B) circMISP, (C) circCOL1A1, (D) circLIPF and (E) circPGC in 10 paired gastric cancer (GC) specimens and the corresponding paired normal adjacent tissues (NT) was determined using real-time quantitative RT-PCR with divergent primers.
| circCEACAM5 | F | CTCAGCTGGGGCCACTG |
| R | GTGTCCGGCCCATCAGTC | |
|
| F | GGCAGTTACTCGGTGTCTGA |
| R | GGTATCTGGTCACGCGGTC | |
|
| F | CTGGCAGCCCTGGTCCTGAT |
| R | ATCTGCGCCAGGGAAACCAC | |
|
| F | AACACGAGTCGCTTGGATGT |
| R | TGCCATTGTTAAAAGCAGCCA | |
|
| F | GATGAGGCCACCACAGCTA |
| R | TGGATGCTCTGGACCTGCT |