Literature DB >> 35358229

Assessment of genetic variation in Apis mellifera jemenitica (Hymenoptera: Apidae) based on mitochondrial Cytochrome Oxidase Subunit II and III.

Yehya Alattal1, Ahmad Algamdi1.   

Abstract

Morphometric and genetic characterization of many Apis mellifera subspecies are well-documented. A. m. jemenetica occurs naturally in Africa and Asia. In this study, genetic variation of mitochondrial Cytochrome Oxidase II (COII) and III (COIII) were analysed in 133 specimens of the endemic honeybee colonies within Saudi Arabia. The COII gene sequence length was 684 bp comprising nine synonymous (1.3%) and two non-synonymous single nucleotide polymorphisms (SNPs) (0.87%). Five variants of COII were not previously documented, one variant (MT755968) showed an extra restriction site when subjected to type II restriction endonuclease from Arthrobacter protophormiae (Apol) or to Haemophilus influenzae Rf (Hinf1). Changes in COII sequence separated samples into three haplogroups. Whereas, COIII gene sequence length was 780 bp, including 18 synonymous and five non-synonymous SNPs. Furthermore, variation in COII sequence was more informative based on restriction profiles and on amino acid changes compared with COIII gene sequence. Variants of COIII showed identical restriction sites when subjected to type II restriction endonuclease from Deinococcus radiophilus (DraI), and revealed high similarity to African subspecies. Results of this study are very useful in understanding genetic diversity and characterization of A. mellifera subspecies.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35358229      PMCID: PMC8970473          DOI: 10.1371/journal.pone.0265454

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Apis mellifera jemenitica spreads naturally over large geographical areas in Asia and Africa [1]. It occurs naturally in the Arabian Peninsula, Sudan, Eretria, Chad, Niger, Kenya, Tanzania, Nigeria, Niger and Ethiopia with very diverse environmental extremes [2-4]. This may imply high morphometric and genetic variations among different population of A. m. jemenitica. The Asian and African populations, which are isolated by the Red Sea, are very obvious example for such variation [1,5]. Although the origin of A. mellifera is still under intensive debate by many scientists, more support was recently given to an Asian (West Asian) origin [6-11]. Phylogenetic analysis based on genomic protein-coding regions sets A. m. jemenitica and nearby subspecies at the most basal branch of evolution [6]. In the last two decades several articles discussed the characterization of the Asian A. m. jemenitica [12-20]. Based on morphometric traits, Alghamdi et al (2012) reported three distinctive sub-populations of A. m. jemenitica from Saudi Arabia, and found significant variation compared with the African A. m. jemenitica populations [12]. Morphometric variation would not be unexpected among other A. m. jemenitica populations within Africa as well [21]. Worldwide, Ilyasove et al [13] listed 33 A. mellifera subspecies being identified based on morphometry and were assigned to five different lineages (African (A); Western Europe (M); South-Eastern Europe (C) Middle East (O) and (Y) Ethiopia). Lately Mitochondrial DNA (mtDNA) markers are being regularly used to characterize and investigate evolutionary relationships within A. mellifera. mtDNA evolves faster and it contains regions with variable evolutionary rates that is useful in addressing question in many subspecies [14,15,22,23]. COI-COII intergenic fragment is the most widely used non-coding region revealing different sequence lengths (Presence/Absence of P and Q) and number of restriction sites when subjected to type II restriction endonuclease from Deinococcus radiophilus (DraI) [10,16-20]. Using COI-COII intergenic region, A. m. jemenitica colonies from Saudi Arabia were identified as members of the Z sub-lineage (Previously O lineage) similar to A. m. syriaca and A. m. lamarckii [24,25]. This intergenic region is highly variable and may overcome some endemic variation among populations. Ultimately investigating variation within protein coding mtDNA genes is highly supportive. In this study we analyse and discuss sequence variation in COII and COIII genes for 133 non-migratory A. m. jemenitica samples from Saudi Arabia.

Materials and methods

Samples of non-migratory A. m. jemenitica colonies (Number of samples = 133) of Saudi Arabia were collected (Makkah (n = 20); Madinah (n = 17); Taif (n = 14); Jazan (n = 16); Najran (n = 14); Tabuk (n = 18); Albaha (n = 15); Asir (n = 19)) and were then preserved in 96% Ethanol. Each sample consisted of 15 workers. All colonies were morphometrically confirmed as A. m. jemenitica according to standard methods [18]. For mtDNA analyses, DNA was extracted from one worker/colony using Qiagen extraction Kit (Cat No./ID: 69506). Extracted DNA was then sequenced by BGI (Hong Kong, China). Raw data cleaning was performed using SOAPnuke v1.5.6 (parameters -n 0.05 -l 20 -q 0.2 –G–Q 2) [26]. Filtration started with adaptor trimming (sequences with adapter mapping %>50 was removed). Next, low quality reads (Q20<50%) were removed. Finally, contiguous reads with more than 2% N bases were removed. Clean mtDNA reads were mapped and annotated against a reference mitogenome of A. m. jemenitica for a sample collected from Yemen in 1980s (GeneBank: MN714161). Mapping was performed in Geneious Prime 2020.1.2 (Biomatters Ltd., Auckland, New Zealand). Sequences of COII and COIII for each sample were then extracted in fasta format and imported to BioEdit v7.2.5 [27] for alignment with COII and COIII mtDNA sequences of other A. mellifera subspecies. COII and COIII sequences were also subjected to two restriction enzymes each; Apol and HinfI (for COII) and DraI (for COIII). Phylogenetic tree was constructed using Maximum Composite Likelihood method and tested over1000 bootstrap replicates [28], evolutionary distances were calculated in MEGA7 [29]. Nonsynonymous SNPs and changes on amino acid composition were also explored. Sequences were additionally analysed with Basic Local Alignment Search Tool (BLAST), then previously undocumented variants were uploaded into the Genbank.

Results

The COII gene sequence length was 684bp, composed of 80.6% AT and 16.4% GC. Nine loci were polymorphic (1.3%) (Table 1) and revealed changes of two amino acids (0.87%) (Table 2). Five variants of COII gene sequences among A. m. jemenitica within Saudi Arabia were previously un-documented (Table 1). Variant-6 (MT755968: n = 4 (~3%)) revealed the highest number of nucleotide variation (Seven Nucleotides) (Table 1) and revealed ten restriction sites with Apol and four sited for Hinf1 compared with nine and three sites respectively for all other samples (Table 3). Most COII sequence variants (95.5%) are similar to reference sequences affiliated with the African lineage A (Table 3). However two variants (MT755968: n = 4 (~3%) and MT755970) showed an extra digestion sites for each restriction enzyme and clustered with another subspecies lineage. Table three shows variation in amino acid composition among different variants. Variant number three (MT755972) had amino acid changes on codon 93 (Valine to Isoleucine), >90% of the colonies of this variant belongs to Tabuk and Almadinah regions in the northern part of Saudi Arabia. While all colonies of variant number six had the same amino acid changes on codon 69. Interestingly Changes in amino acid compositions separated our samples into three haplogroups, Haplogroup one resembling 105 samples demonstrated identical amino acid sequence with other subspecies of the African lineage, Haplogroup two and three share similarity with subspecies from the lineage M and C respectively concerning this region. Phylogenetic tree including all COII-variants based on 133 samples and six other reference haplotypes using Maximum Likelihood method demonstrated that most samples clustered with A. m. jemenitica, A. m. lamarckii and A. m. syriaca, some samples (Variant six) clustered very close to A. m. mellifera (Fig 1). The COIII gene sequence length was 780bp, composed of 82.4% AT and 17.6% GC. Polymorphic loci were 18 (2.6%) (Table 4) resulted in five amino acids variants (1.92%) (Table 5). Nine variants were previously undocumented and were uploaded in the Genbank (Table 6). Variant number nine (MT769261: n = 4 (~3%)) revealed the highest nucleotide variation (11 nucleotides) (Table 4). DraI restriction profile was similar for all COIII Variants and were most similar to African subspecies with two restriction sites (Table 6). COIII–Variant number nine (MT769261) and Variant number six (MT769259) had two amino acid changes which were similar in A. m. mellifera (KY926884). Phylogenetic tree using ML methods showed that most samples clustered with A. m. jemenitica, A. m. lamarckii and A. m. syriaca, however (Variant nine) clustered with A. m. mellifera (Fig 2).
Table 1

Sequence variations in COII gene among A. m. jemenitica samples from Saudi Arabia.

*The number of the nucleotide at the sequence resembles the position where variation took place.

VariantAccession No.Position of Variation
217896150163169205277366393444525
IMT755967TTCTCTGGTCCT
IIMT755968 C T T C T C A G A CCT
IIIMT755969T C CTCTGGTCCT
IVMT755970TTCTCT A GACCT
V(KY926882)TTCTCTGGACCT
VIMT755972TTCTCTG A ACCT
A m jemenitica (Mn714161) TTCTCTGGTCCT
Am lamarckii (KY464958) TTCTCTGGATCT
A m syriaca (KP163643) TTCTCTGGATCT
A m intermissa (KM458618) C TCTTTGGATTC
A m simensis (MN585108) TTCTTTGGATTC
A m mellifera (KY926882) C TCTTTGAACTT
Table 2

Amino acid variations in COII gene among different haplotypes and six other reference subspecies resembling two lineages.

*The number of the codon resembles the position of variation.

HaplogroupHaplotype (distribution percent in the cluster)No. of coloniesCodon No.
6993211
Amino acid symbol*
IHaplotype-1 (5.2) (MT755967); Haplotype-1 (72.5) KY926882); Haplotype-4 (1.5) MT755969)105VVV
IIHaplotype-3 (17.3) MT755972)24 >90% Madinah +TabukVIV
IIIHaplotype-5 (0.7) MT755970); Haplotype-6 (3) MT755968)4 Special variantI V V
A m jemenitica (MN714161); A. m lamarckii (KY464958); A m intermissa (KM458618);A m simensis (MN585108); A m syriaca (KP163643); A m capensis (KX870183)VVV
A m meda (KY464957), A m caucasica (MN714160.1) A m carnica (MN250878.1);IVV
A m ligustica (AP018435.1)IVI
A m mellifera (KY926884)VIV

*V = Valine; I = Isoleucine.

Table 3

Haplotypes’ accession numbers based on COII gene Sequences, frequency within whole population and number of colonies in each region besides restriction map of haplotype sequences using restriction endonuclease from Arthrobacter protophormiae (Apol) or to Haemophilus influenzae Rf (Hinf1).

Subspecies / Haplotype Accession No.Freq. (%)Distribution of colonies in sampling areasRestriction map
MakkahMadinahTaifJazanNajranTabukAlbahaAsir
ApolHinf1
A. m. jemeniticaB. (Saudi Arabia)(KY926882)72.51641212121015156, 43, 152, 252, 341, 356, 547, 570,594 (9 positions)38, 362, 635 (3 positions)
MT75597217.3112-28--
MT7559675.2 2 1 - - - - - 4
MT7559691.5--2----
MT7559700.71------
MT7559683.0----22---6, 43, 152, 160, 252, 341, 356, 547, 570, 594 (10 positions)18, 38, 362, 635 (4 positions)
A. m jemenitica (Yemen) (MN714161); A. m syriaca (Syria) (KP163643); A. m lamarckii (Egypt) (KY464958)6, 43, 152, 252, 341, 356, 547, 570,594 (9 positions)38, 362, 635 (3 positions)
A m meda (KY464957), A m caucasica (MN714160.1, A. m mellifera (Germany) KY9268846, 43, 152, 160, 252, 341, 356, 547, 570, 594 (10 positions)18, 38, 362, 635 (4 positions)
A. m simensis (Ethiopia) MN5851086, 43, 152, 160, 252, 341, 356 441, 547, 570, 594 (11 positions)38, 362, 635 (3 positions)
A. m intermissa (Algeria) KM458618 A. m capensis (South Africa) KX8701836, 43, 152, 160, 252, 341, 356, 441, 547, 570,594 (11 positions)18, 38, 362, 635 (4 positions)
Fig 1

Phylogenetic analysis for COII sequence variation in the study samples and seven other sequences for seven reference honeybee subspecies, using Maximum Likelihood method.

Pairwise distances were estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. There were a total of 687 positions in the final dataset. Evolutionary analyses were conducted in MEGA7.

Table 4

Sequence variations in COIII gene among A. m. jemenitica samples from Saudi Arabia.

*The number of the nucleotide at the sequence resembles the position where variation took place.

VariantAccession No.Position of Variation
15637091132141198228255303306336366370391399449453455499505540558561595622636639651652671675726735768
IMT769253CTAGTTTTCTTTTACGTTTCGCTTGTCTTTTCTTC
IIMT769254...............A...........C.......
IIIMT769255...............A...........C..C....
IVMT769262...............A...................
VMT769257...............A....A......C.......
VIMT769258T..............A.........C.C.......
VIIMT769259...............A.........C.C.......
VIIIMT769260........T......A..C........C.......
IXMT769261.C.A..C.T.C.CG.A.C....C.....C..T...
A m jemenitica (Mn714161) ........T......A...........C.......
Am lamarckii (KY464958) ........T......A...........C.......
A m syriaca (KP163643) ........T......A...........CC......
A m intermissa (KM458618) ....A........G.A...T.T.....TCC.T.C.
A m simensis (MN585108) ..T.A..CTC.C.G.A.......C..T...T.CT
A m mellifera (KY926882) T..A.A..T...CGTAC.......A.A.C..TC.T
Table 5

Amino acid variations in COIII gene among different haplotypes and six other reference subspecies resembling two lineages.

*The number of the codon resembles the position of variation.

Amino acid variantHaplotype (distribution percent in the cluster)No. of coloniesCodon No.
24314471119124150152163169199224
Amino acid symbol*
IMT769254; MT769258; MT769253; MT769262125IVFTDNLISGAI
IIMT7692592IVFTDNL T SGAI
IIIMT7692551IVFTDNLISGA T
IVMT7692571IVFTDNLIS R AI
VMT769261, MT7692594I I FTD D LISGAI
A m jemenitica (MN714161); A. m lamarckii (KY464958); A m syriaca (KP163643);IVFTDNLISNAI
A m simensis (MN585108); A m capensis (KX870183)LVLTDDLISGAI
A m intermissa (KM458618); IVLTDDLISGAI
A m meda (KY464957), A m caucasica (MN714160.1)IVLTNNLILGAI
A m ligustica (AP018435.1;) A m carnica (MN250878.1);IVLSNNLILGAI
A m mellifera (KY926884) IIFTDDSISGTI

*I = Isoleucine; V = Valine; F = Pheneyalanine; N = Asparagine; G = Glycine; T = Threonine; D = Aspartate.

Table 6

Haplotypes’ accession numbers based on COIII gene sequences, frequency within whole population and number of colonies in each region besides restriction map of haplotype sequences using DraI.

Accession No.Freq. (%)Distribution of COIII VariantsDigestion fragment size
DraI
MakkahMadinahTaifJazanNajranTabukAlbahaAsir234, 465
Variant No. (%)
IMT7692530.8 - 1 (100) - - - - - -
IIMT7692621.5--2 (100)------
IIIMT76925482.720 (18)14 (12.7)12 (10.9)12 (10.9)12 (10.9)13 (12)11 (10)16 (14.6)
IVMT7692550.81(100)
VMT7692570.8-1 (100)------
VIMT7692580.8-1(100)
VIIMT7692598.3---2 (18.2)-4 (36.4)3 (27.3)2 (18.2)
VIIIMT7692601.5-----1(0.5)1(0.5)-
IXMT7692613.0---2 (0.5)2(0.5)---
A. m jemenitica (MN714161); A. m syriaca (KP163643); A. m lamarckii (KY464958); A. m intermissa KM458618; A. m capensis (KX870183)234, 465
A. m simensis (MN585108)72, 132, 234, 465
A. m mellifera (KY926882)132, 234, 465
A m meda (KY464957), A m caucasica (MN714160.1) A m carnica (MN250878.1); A m ligustica (AP018435.1)132, 234, 465
Fig 2

Phylogenetic tree for COIII sequence variation in the study samples and seven other sequences for seven reference honeybee subspecies, using the Maximum Likelihood method.

Distances were estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. There were a total of 781 positions in the final dataset. Evolutionary analyses were conducted in MEGA7.

Phylogenetic analysis for COII sequence variation in the study samples and seven other sequences for seven reference honeybee subspecies, using Maximum Likelihood method.

Pairwise distances were estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. There were a total of 687 positions in the final dataset. Evolutionary analyses were conducted in MEGA7.

Phylogenetic tree for COIII sequence variation in the study samples and seven other sequences for seven reference honeybee subspecies, using the Maximum Likelihood method.

Distances were estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. There were a total of 781 positions in the final dataset. Evolutionary analyses were conducted in MEGA7.

Sequence variations in COII gene among A. m. jemenitica samples from Saudi Arabia.

*The number of the nucleotide at the sequence resembles the position where variation took place.

Amino acid variations in COII gene among different haplotypes and six other reference subspecies resembling two lineages.

*The number of the codon resembles the position of variation. *V = Valine; I = Isoleucine.

Sequence variations in COIII gene among A. m. jemenitica samples from Saudi Arabia.

*The number of the nucleotide at the sequence resembles the position where variation took place.

Amino acid variations in COIII gene among different haplotypes and six other reference subspecies resembling two lineages.

*The number of the codon resembles the position of variation. *I = Isoleucine; V = Valine; F = Pheneyalanine; N = Asparagine; G = Glycine; T = Threonine; D = Aspartate.

Discussion

A. m. jemenitica shows high morphometric and genetic diversity and is well adapted within its distribution range [1,2,12,14,15,30]. Most publication concerned with genetic variation and phylogenetic relationship among and within A. mellifera subspecies used mtDNA sequences [10,14-20,31]. In this study, analyses based on COII and COIII gene sequences confirmed previous results using other mtDNA genes, asserting that most of the Saudi samples cluster with the A. m. lamarckii, A. m. jemenitica and A. m. syriaca reference samples, which resemble the African Sub lineage Z [12,14,15]. However few samples cluster with other lineages (C or O for example) or with another African sub-lineage demonstrating significant divergence from the common group. COIII sequences exhibited twice the variability that occurs within COII, furthermore variation in COII sequence was more informative based on restriction profile and amino acid changes compared with COIII. Variation in COII can be diagnostic for most of Almadinah and Tabuk samples (Variants MT755972) which spreads at the border line of the natural distribution range of the Syrian Honeybee A. m. syriaca ([1].). Apparently, ~60% of the samples from the north are restricted to the COII-variant six (COII-MT755972: 17.3%), which could be unique in their localities. Restriction profiles of COII sequences using Apo1 and/or Hinf1 demonstrated consistency with subspecies lineage grouping based on sequence variation and phylogenetic trees (Table 3), and could be used in the future in such analyses. Variation in COIII sequences is also unique for the variant (MT755968), which is uncommon variant found near the border of Yemen in the south, the samples resembling this variant was collected from two apiaries located about 2000m above sea level, and two other Apiaries from Najran, these four samples may be very similar to A. m. jemenitica. Yet, neither the presence of heterogenous groups, nor the impact of an exotic subspecies can be excluded. Although most variation in COII and COIII sequences were inconsequential and has no impact on protein structure and function, some variants had nonsynonymous SNPs and their impact on protein function should be discussed. Although reference sequences for mitochondrial genes including COII and COIII genes from the Genbank are not abundant and are available for few subspecies only, which may hinder real variability comparison in those populations and comprehensive evolutionary analysis, A. m. lamarckii and A. m. syriaca are apparently the closest to A. m. jemenitica, and essentially resembling the same lineage. However, based on morphometric reference data (14), it is clear that African and Asian population of A. m. jemenitca are closer to each other’s than to A. m. lamarckii and A. m. syriaca, which may indicate and adaptive evolution in either population. The results of this study are very useful in characterization of Saudi Arabia Honeybee, A. m. jemenitica.
  17 in total

1.  Putative origin and function of the intergenic region between COI and COII of Apis mellifera L. mitochondrial DNA.

Authors:  J M Cornuet; L Garnery; M Solignac
Journal:  Genetics       Date:  1991-06       Impact factor: 4.562

2.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

3.  Thrice out of Africa: ancient and recent expansions of the honey bee, Apis mellifera.

Authors:  Charles W Whitfield; Susanta K Behura; Stewart H Berlocher; Andrew G Clark; J Spencer Johnston; Walter S Sheppard; Deborah R Smith; Andrew V Suarez; Daniel Weaver; Neil D Tsutsui
Journal:  Science       Date:  2006-10-27       Impact factor: 47.728

4.  SOAPnuke: a MapReduce acceleration-supported software for integrated quality control and preprocessing of high-throughput sequencing data.

Authors:  Yuxin Chen; Yongsheng Chen; Chunmei Shi; Zhibo Huang; Yong Zhang; Shengkang Li; Yan Li; Jia Ye; Chang Yu; Zhuo Li; Xiuqing Zhang; Jian Wang; Huanming Yang; Lin Fang; Qiang Chen
Journal:  Gigascience       Date:  2018-01-01       Impact factor: 6.524

5.  Intraspecific phylogenetic analysis of Siberian woolly mammoths using complete mitochondrial genomes.

Authors:  M Thomas P Gilbert; Daniela I Drautz; Arthur M Lesk; Simon Y W Ho; Ji Qi; Aakrosh Ratan; Chih-Hao Hsu; Andrei Sher; Love Dalén; Anders Götherström; Lynn P Tomsho; Snjezana Rendulic; Michael Packard; Paula F Campos; Tatyana V Kuznetsova; Fyodor Shidlovskiy; Alexei Tikhonov; Eske Willerslev; Paola Iacumin; Bernard Buigues; Per G P Ericson; Mietje Germonpré; Pavel Kosintsev; Vladimir Nikolaev; Malgosia Nowak-Kemp; James R Knight; Gerard P Irzyk; Clotilde S Perbost; Karin M Fredrikson; Timothy T Harkins; Sharon Sheridan; Webb Miller; Stephan C Schuster
Journal:  Proc Natl Acad Sci U S A       Date:  2008-06-09       Impact factor: 11.205

6.  A fifth major genetic group among honeybees revealed in Syria.

Authors:  Mohamed Alburaki; Bénédicte Bertrand; Hélène Legout; Sibyle Moulin; Ali Alburaki; Walter Steven Sheppard; Lionel Garnery
Journal:  BMC Genet       Date:  2013-12-06       Impact factor: 2.797

7.  The complete mitochondrial genome and phylogenetic analysis of the Arabian Honeybee Apis mellifera jemenitica (Insecta: Hymenoptera: Apidae) from Saudi Arabia.

Authors:  Ahmad Alghamdi; Yehya Alattal
Journal:  Mitochondrial DNA B Resour       Date:  2020-11-03       Impact factor: 0.658

8.  Tunicate mitogenomics and phylogenetics: peculiarities of the Herdmania momus mitochondrial genome and support for the new chordate phylogeny.

Authors:  Tiratha Raj Singh; Georgia Tsagkogeorga; Frédéric Delsuc; Samuel Blanquart; Noa Shenkar; Yossi Loya; Emmanuel Jp Douzery; Dorothée Huchon
Journal:  BMC Genomics       Date:  2009-11-17       Impact factor: 3.969

View more
  1 in total

1.  Retraction: Assessment of genetic variation in Apis mellifera jemenitica (Hymenoptera: Apidae) based on mitochondrial Cytochrome Oxidase Subunit II and III.

Authors: 
Journal:  PLoS One       Date:  2022-09-14       Impact factor: 3.752

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.