| Literature DB >> 35356768 |
Jingyi Cai1, Chaoyuan Li2, Shun Li3, Jianru Yi1, Jun Wang1, Ke Yao1, Xinyan Gan1, Yu Shen4, Pu Yang1, Dian Jing5,6, Zhihe Zhao1.
Abstract
Mechanical force, being so ubiquitous that it is often taken for granted and overlooked, is now gaining the spotlight for reams of evidence corroborating their crucial roles in the living body. The bone, particularly, experiences manifold extraneous force like strain and compression, as well as intrinsic cues like fluid shear stress and physical properties of the microenvironment. Though sparkled in diversified background, long noncoding RNAs (lncRNAs) concerning the mechanotransduction process that bone undergoes are not yet detailed in a systematic way. Our principal goal in this research is to highlight the potential lncRNA-focused mechanical signaling systems which may be adapted by bone-related cells for biophysical environment response. Based on credible lists of force-sensitive mRNAs and miRNAs, we constructed a force-responsive competing endogenous RNA network for lncRNA identification. To elucidate the underlying mechanism, we then illustrated the possible crosstalk between lncRNAs and mRNAs as well as transcriptional factors and mapped lncRNAs to known signaling pathways involved in bone remodeling and mechanotransduction. Last, we developed combinative analysis between predicted and established lncRNAs, constructing a pathway-lncRNA network which suggests interactive relationships and new roles of known factors such as H19. In conclusion, our work provided a systematic quartet network analysis, uncovered candidate force-related lncRNAs, and highlighted both the upstream and downstream processes that are possibly involved. A new mode of bioinformatic analysis integrating sequencing data, literature retrieval, and computational algorithm was also introduced. Hopefully, our work would provide a moment of clarity against the multiplicity and complexity of the lncRNA world confronting mechanical input.Entities:
Keywords: bone; competing endogenous RNA (ceRNA); force; long noncoding RNA (lncRNA); mechanotransduction; mesenchymal stem cells (MSCs); microRNA (miRNAs); transcription factor (TF)
Year: 2022 PMID: 35356768 PMCID: PMC8959777 DOI: 10.3389/fbioe.2022.780211
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Workflow of this research. Orange squares stand for the database and evidences on which our research is based. Light and dark blue colors represent the crucial factors and networks predicted though bioinformatic strategy, respectively. Circles are used to highlight the quartet network of lncRNAs.
Primer sequences of lncRNA validated by RT-qPCR.
| LncRNA | Primer sequences (from 5′- 3′) |
|---|---|
| Gapdh | F: CAG TGC CAG CCT CGT CTC AT |
| R: AGG GGC CAT CCA CAG TCT TC | |
| Kcnq1ot1 | F: AGTGAGCACGTTCTGTCTGG |
| R: ACAGGTAGGTGCCGTAGTCT | |
| Snhg16 | F: TGATGGCATTGCCTTTTGGC |
| R: GCCCACCATCTACCTATGCC | |
| Noard | F: GACCACAGCCTTTGTTAGGTG |
| R: CCACCCTACCAATCCGTTATGT | |
| Snhg12 | F: AATTCAGGTTTGCATAGTGGC |
| R: CATGACCAGTGTCTGTACTCA | |
| Tug1 | F: CTCTGGAGGTGGACGTTTTGT |
| R: GTGAGTCGTGTCTCTCTTTTCTC |
FIGURE 2Differentially expressed profiles and functional analysis of mRNAs in a force-related way. Heatmaps display the top 50 genes with the highest values of |log2foldChange (FC)| in the intermittent force group (A), static force group (B), and different force type group (C). Intersection of results gained from two force groups contributes to the list of force-sensitive mRNA (FS mRNA), which is visualized by the VENNY diagram (D). Top 10 GO annotations grouped by BP, CC, and MF of FS mRNAs (E) and FTS mRNAs (F). GO terms are ranked by the GeneRatio scores. The size and color of the dots represent the gene count and q-value score of the enrichment analysis, respectively.
Creditable force-sensitive miRNAs and related pathways.
| Evidence | Samples | Force | miRNA | Osteo | Target and pathways | |
|
| function | prOB | CTS: 3% strain, 0.5 Hz, 4 h | miR-214 | N | Pten, |
| qPCR | miR-30d-5p, miR-199a-3p | N | ||||
| qPCR | miR-31-5p | P | ||||
|
| function | hPDLSCs | CTS: 10% strain 1.0 Hz, 6, 12, 24, or 48 h | miR-21 | P | ACVR2B (TGF- |
|
| function | FOB 1.19 | CTS: 8% strain, 0.5 Hz, 72 h; MG: | miR-103a | N | Runx2 |
|
| qPCR | MC3T3-E1 | CTS: 2,500 µε, 0.5 Hz, 8 h | miR-191*, miR-3070a | P | |
| qPCR | miR-218, miR-33 | N | ||||
|
| function | MLO-Y4 | CTS: 2,500 με, 0.5 Hz, 8 h | miR-29b | N | Inhibited IGF-1 secretion |
| qPCR | miR-713, miR-706, miR-703, miR-574-3p, miR-467b-3p, miR-466i/f-5p, miR-208a-3p | P | ||||
| qPCR | miR-361-3p | N | ||||
|
| function | rBMSCs | CTS: 10% strain, 1 Hz, 12 h | miR-503-5p | N | |
| qPCR | miR-34c-3p, miR-326-5p | P | ||||
| qPCR | miR-324-5p, miR-188-5p, miR-345-3p, miR-30a-5p, miR-29b-3p, miR-351-3p | N | ||||
|
| qPCR | hPDLC | CTS: 10% strain, 0.1 Hz, 24 h | miR-138-5p, miR-221-3p, miR-132-3p | P | |
| qPCR | miR-133a-3p, miR-133a-5p, miR-210-3p | N | ||||
|
| function | hPDLC | CTS: 15% strain, 0.5 Hz, 24 h | miR-3198 | N | Regulates OPG but not RANKL |
| CF: 2.0 g/cm, 24 h | ||||||
|
| function | hPDLCs | CTS: 2% stretch, 0.1 Hz, 24 h | miR-29 family (a,b,c) | P | targeting at ECM genes: Col1a1 Col3a1 Col5a1 |
| CF: 2.0 g/cm, 24 h | ||||||
|
| function | MC3T3-E1 | CF: 2.0–4.0 g/cm2, 24 h | miR-494-3p | N | Fgfr2, Rock1 |
| qPCR | miR-146a-5p, miR-210-3p, miR-1247-3p | N | ||||
|
| function | hPDLC | CTS: 12% strain, 0.1 Hz, 24, 48, or 72 h | miR-195-5p | N | WNT3A, FGF2, and BMPR1A |
|
| qPCR | hPDLC | CTS: 12% strain, 0.1 Hz, 72 h | miR-195-5p, miR-424-5p, miR-1,297, miR-3607-5p, miR-145-5p, miR-4,328, miR-224-5p | N | |
|
| function | hADSCs | CTS: 5% strain, 0.5 Hz, 2 h/day, 6 days | let-7i-3p | N | LEF1 (Wnt/β-catenin) |
|
| function | hBMSCs | CTS: 10% strain, 0.5 Hz, 6 h/day, 7 days | miR-138 | N | miR-138/PTK2(FAK-ERK1/2-Runx2) |
|
| function | mADSCs | CTS: 2000 με, 0.5 Hz, 2 h/day, 7 days | miR-154-5p | N | Wnt/PCP (RhoA/ROCK) |
|
| function | mOB | CTS: 2 Hz, 36 cycles/day, 2 weeks | miR-20a | P | IGF-I |
|
| function | hBMSCs, hTDSCs, hADSCs | ESW: 0.16 mJ/mm2, 500 impulses | miR-138 | N | miR-138-FAK-ERK1/2-RUNX2 |
|
| function | MC3T3-E1 | MG: 24, 48, 72 h | miR-30b/c/d/e | N | Runx2 |
|
| function | C2C12 | MG: 12 h | miR-494 | N | MYOD; BMPR-SMAD-RUNX2 |
| qPCR | miR-122a, miR-340 | P | ||||
|
| function | MC3T3-E1 | MG: 48 h; FSS: 10 dyn/cm2, 1 h | miR-33-5p | P | Hmga2 |
|
| function | MC3T3-E1 | MG: 48 h | miR-103 | N | Cav1.2: calcium voltage-gated channel |
|
| function | prOB | MG: 48 h | miR-132-3p | N | Ep300-Runx2 |
| qPCR | miR-139-3p, miR-339-3p | N | ||||
| qPCR | miR-487b, miR-2,985, miR-34b | P | ||||
|
| function | hPDLC | FSS3, 6, 9, 12, 15 dyn/cm2, 6 h | miR-132 | P | mTOR |
|
| function | h/mPDLCs | OTM | miR-21 | P | Pdcd4 (C-fos) |
Osteogenesis: N, negative; P, positive; CTS, cyclic tensile strain; CF, compressive force; MG, microgravity; OTM, orthodontic tooth movement; FSS, fluid shear strain; ESW, extracorporeal shockwave; rBMSCs/hBMSCs, rat/human bone marrow-derived stem cells; hADSCs, human adipose tissue-derived stem cells; h/mPDLSCs, human/mouse periodontal ligament stem cells; hPDLC, human periodontal ligament cells; m/prOB, mouse/primary rat osteoblast.
FIGURE 3KEGG enrichment of CFS miRNAs corroborating the reliability of bioinformatics. Pathways are ranked according to p-value, and the top 22 are displayed after filtering those relating to cancer and chemical synthesis. KEGG terms included are highly consistent with verified FR pathways at present. Pathways excluded are proteoglycans in cancer, pathways in cancer, fatty acid biosynthesis, mucin-type O-glycan biosynthesis, morphine addiction, and melanoma (nos. 5, 6, 8, 11, 18, and 21, respectively).
FIGURE 4Identification of FR lncRNA through the ceRNA network and RT-qPCR validation. In the ceRNA network, rhombuses, squares, and circles stand for lncRNAs, miRNAs, and mRNAs, respectively. Upregulated RNAs are shown in pink, while downregulated ones are shown in blue. Gray lines represent regulatory relationships (A). The validation of lncRNA expression changes via RT-qPCR under mechanical stretch was normalized to Gapdh (n = 3) (B).
FIGURE 5FS mRNA and FR lncRNA interaction. The direct interaction relationships were visualized (A) and the Ce-loop RNA network was also extracted (B). Rhombuses, squares, and circles stand for lncRNAs, miRNAs, and mRNAs, respectively. Upregulated RNAs are shown in pink, while downregulated ones are shown in blue. Gray lines represent regulatory relationships.
FIGURE 6The co-expression network among FS mRNA and FR lncRNA. Rhombuses and squares stand for lncRNAs and mRNAs, respectively. Upregulated RNAs are shown in pink, while downregulated ones are shown in blue. Red and blue lines represent positive and negative correlations, respectively. The widths of lines are mapped to correlation scores.
FIGURE 7The FR TF–lncRNA regulatory network. The TF–FR lncRNA network is visualized with lncRNAs forming the middle circle while TFs with degree < 10 standing on the left and those with degree ≥ 10 on the right. Node colors are mapped to degree scores. (A) The feedback loops based on the triplet of TF (FS mRNA)–CFS miRNA–FR lncRNA (B) as well as the triplet of TF (FTS mRNA)–CFS miRNA–FR lncRNA (C) are displayed.
Pathway mapping of force-related lncRNAs.
| LncRNA | Clarified information | ||
| Background | Reported target and function | Pathway | |
| NEAT1 | HBMSC ( | Promoting osteogenic differentiation via miR-29b-3p/BMP1 axis | BMP |
| cancer cell lines ( | Mediate the mechanomemory to substrate stiffness via H3K27me3 activity | EZH2 | |
| H19 | HBMSC ( | Promoting osteogenesis under tension via sponging miR-138 to release PTK2 | FAK-ERK1/2-Runx2 |
| UMR-106 ( | Positively related to osteogenesis under mechanical unloading | ERK-MAPK | |
| UMR-106 ( | Positively related to osteogenesis under mechanical unloading | Wnt/ | |
| MC3T3-E1 ( | Promoting matrix mineralization via miR-185-5p/IGF1 | IGF1 | |
| HBMSCs ( | Promoting osteogenic differentiation | SATB2 | |
| REMSCs ( | Promoting osteogenic differentiation | Wnt/ | |
| HBMSC ( | Elevates cell proliferation and differentiation of BMSCs | ||
| KCNQ1OT1 | HBMSCs ( | Promoting osteoblast generation | Cbfa1/Runx2 |
| HBMSCs ( | Promoting osteogenic differentiation | BMP2 | |
| MTSPCs ( | Promoting osteogenic differentiation | RUNX2/PPARγ | |
| Hc-a cells ( | A potential biomarker of delayed fracture healing of patients promoting cellular proliferation and inhibiting apoptosis | Wnt/ | |
| TUG1 | MTSPCs ( | Promoting osteogenic differentiation via promoting the ubiquitination of bFGF | bFGF |
| HPDLSCs ( | Promoting osteogenic differentiation | ||
| HPDLSCs ( | Promoting osteogenic differentiation | Smad | |
| Osteoblast ( | Promoting osteoblast proliferation and differentiation | Wnt/ | |
| Valve interstitial cells ( | Promoting osteogenic differentiation | Runx2 | |
| SNHG1 | HBMSCs ( | Attenuating the osteogenesis | Wnt/ |
| MBMSCs ( | Inhibiting osteogenic differentiation | p38 MAPK | |
| Prostate cancer ( | Binding to EZH2 and exerting proto-oncogene effect | Wnt/ | |
| Osteosarcoma cells ( | A negative regulator via miR-101-3p/ROCK1 pathway | ROCK1 | |
| MALAT1 | RBMSCs ( | Inhibiting osteogenic differentiation | MAPK |
| Esophageal cancer ( | Direct binding to enhance YAP activity | YAP/TAZ | |
| Acute pancreatitis ( | Forming a loop as MALAT1/miR-194/YAP1 | YAP/TAZ | |
| Non-small-cell lung cancer ( | Forming a loop as MALAT1/miR-1914-3p/YAP | YAP/TAZ | |
| Valve interstitial cells ( | Promoting osteogenic differentiation | Smad | |
| Osteosarcoma ( | Facilitating the metastasis | RhoA/ROCK | |
| NORAD | Lung/breast cancer ( | Transcriptionally repressed by the YAP/TAZ-TEAD complex | YAP/TAZ |
| Hepatocellular carcinoma ( | Regulating epithelial-to-mesenchymal transition-like phenotype | TGF- | |
| Promoting cancerous progression | |||
| Breast cancer ( | Promoting cancerous progression | TGF-β | |
| OIP5-AS1 | Valve interstitial cells ( | Promoting osteogenic differentiation via miR-137/TWIST11 | TWIST11 |
| SNHG16 | Colorectal cancer ( | Regulated by Wnt activity | Wnt/ |
| Cervical cancer ( | Function via the SNHG16/miR-128 axis | Wnt/ | |
| LINC-00662 | Hepatocellular carcinoma ( | Facilitating WNT3A secretion | Wnt/ |
| MCM3AP-AS1 | Chondrocytes ( | Increasing apoptotic rate of chondrocytes via miR-142-3p/HMGB1 | |
Creditable force-sensitive lncRNAs and related pathways.
| Evidence | Samples | Force | lncRNA | Exp | Pathway | |
|
| HiSeq 2000 (Illumina) | OCCM-30 | CF | 70 lncRNAs: 57 upregulated, 13 downregulated | KEGG pathway analyses of DEGs: HIF-1, FoxO, mTOR, Notch, and Rap1 signaling pathways | |
| qPCR | Prkcz2, Hklos, Trp53cor1, Gdap10, Ak312-ps | Up | ||||
|
| Affymetrix GeneChip | MC3T3-E1 | RWVB | 857 lncRNAs: 168 upregulated, 689 downregulated | ||
| Bioinformatics qPCR | NONMMUT044983 | down | Ptbp2: CaV1.2 calcium channel transcript | |||
| NONMMUT018832 | Tnpo1: nuclear translocation of oxytocin receptors | |||||
| NONMMUT023474 | Ext1: BMP signaling | |||||
|
| HiSeq 2000 system (Illumina) | hPDLSCs | CF | 90 lncRNAs: 72 upregulated, 18 downregulated | KEGG of DEGs: ECM–receptor interaction, focal adhesion, HIF-1, PI3K/Akt, protein digestion and absorption, and glycolysis/gluconeogenesis | |
| qPCR | ||||||
| FER1L4, HIF1A-AS2, MIAT, NEAT1, ADAMTS9-AS2, LUCAT1 | up | |||||
| MIR31HG, DHFRP1 | down | |||||
|
| functional | PDLSCs; Mice | CF OTM | Fer1l4 | up | AKT/FOXO3 |
|
| functional | HPDLCs; Rats | CF OTM | DANCR | up | miR-34a-5p/DANCR/Jagged1 (Notch signaling pathway) |
|
| Illumina HiSeq 2500 | Rats | HLU | 464 lncRNA: 83 upregulated, 381 downregulated | ||
| bioinformatics | H19 | down | Dkk4/Wnt/β-catenin signaling; TGF-beta, and tight junction pathways | |||
| functional | ||||||
|
| functional | hBMSCs | CTS | H19 | up | H19–miR-138–PTK2(FAK) |
|
| functional | U-MSCs to chondrocyte; rats | RCCS | H19 | up | RCCS significantly promoted exosome production and exosomal lncRNA H19 at 36 rpm/min within 196 h |
|
| functional | UMR-106; rats | HLU | H19 | down | DNMT1–hypermethylation of H19 promoter–ERK signaling; TGF-β, WNT, and JAK-STAT pathways |
|
| Affymetrix GeneChip | C2C12; Mice | HLU | lncMUMA | down | miR-762/MyoD |
| RPM | ||||||
|
| Microarray functional | hBMSCs | Topography | lncRNA PWRN1-209 | up | integrin-FAK-ALP signaling |
|
| functional | MC3T3-E1; Mice | HLU | ODSM | up | partially dependent on miR-139-3p/ELK1 |
|
| Microarray (Arraystar) | human chondrocytes | CTS | 107 lncRNAs: 51 upregulated, 56 downregulated | ||
| functional | lncRNA-MSR | up | miRNA-152/TMSB4 | |||
| microarray | lncRNA-CIR | up | vimentin | |||
|
| bioinformatics | hASCs | Topography | MEG3 | up | controlled by miR-125b |
| qPCR | ||||||
| qPCR | H19 | up | BMP signaling | |||
|
| functional | MC3T3-E1 | Clinostat | OGRU | down | miR-320-3p/Hoxa10 axis-Runx2 |
| Mice | ||||||
CF, compressive force; RWVB, rotating wall vessel bioreactor; OTM, orthodontic tooth movement; HLU, hind limb unloading; CTS, cyclic tensile strain; RCCS, rotary cell culture system; RPM, random positioning machine; hPDLSCs, human/mouse periodontal ligament stem cells; hPDLC, human periodontal ligament cells; hBMSC, human bone marrow-derived stem cells; hADSCs, human adipose tissue-derived stem cells hADSCs, human adipose tissue-derived stem cells.
FIGURE 8Intricate pathway network provoked by mechanical input is modulated by lncRNAs. Blue ellipses and green squares stand for FR lncRNAs and verified pathways, respectively.
FIGURE 9ceRNA network and downstream pathways revealed H19 as a key FS lncRNA confronting the mechanical input. Orange squares and dark yellow ellipses in the left semicircle stands for FS mRNA and CFS miRNA related to H19, respectively. White ellipses in the right semicircle represent the verified pathway H19 involved in FS condition and osteogenic processes.