Yu Bai1, Emmanuel Caussinus1, Stefano Leo1, Fritz Bosshardt1, Faina Myachina1, Gregor Rot1,2, Mark D Robinson1,2, Christian F Lehner3. 1. Department of Molecular Life Sciences, University of Zurich, Winterthurerstrasse 190, 8057, Zurich, Switzerland. 2. SIB Swiss Institute of Bioinformatics, University of Zurich, Winterthurerstrasse 190, 8057, Zurich, Switzerland. 3. Department of Molecular Life Sciences, University of Zurich, Winterthurerstrasse 190, 8057, Zurich, Switzerland. christian.lehner@imls.uzh.ch.
Correction to: BMC Genomics 22, 771 (2021)https://doi.org/10.1186/s12864-021-08057-4Following the publication of the original article [1], the corresponding author was informed of two mistakes present in the originally published Additional file 23 Table S10. The sequences of the oligonucleotides YB320 and YB362, which were used as forward primers for amplification of the candidate CREs Hsp23_E2 and Prx2540-1_E, were not entered correctly into this table.The correct sequence of YB320 is 5’-TAGTTGGGGATGTCTTCGAATGTACATATGTTCCAAATCG -3’ and of YB362 is 5’- TAGTTGGGGATGTCTTCCATTTAGCTCATCTCCACGCTAG -3’.The correct Additional file 23 Table S10 is included in this Correction article and the original article [1] has been updated.Additional file 23: Table S10. Excel file with description of synthetic DNA fragments (oligos and gene blocks).
Authors: Yu Bai; Emmanuel Caussinus; Stefano Leo; Fritz Bosshardt; Faina Myachina; Gregor Rot; Mark D Robinson; Christian F Lehner Journal: BMC Genomics Date: 2021-10-28 Impact factor: 4.547