Literature DB >> 35345355

Epithelial-Mesenchymal Transition Markers in HCVAssociated Hepatocellular Carcinoma: A Multivariate Follow Up Study.

Thanaa Elsayed Helal1, Ahmed Aref2, Asmaa Ibrahim Gomaa3, Ola Nada1, Mohamed Abd-Elghaffar4, Khaled Farouk5, Nermine Ahmed Ehsan3.   

Abstract

OBJECTIVE: Validated markers to predict recurrence after surgical resection of hepatocellular carcinoma (HCC) are needed. Little data is available regarding epithelial-mesenchymal transition (EMT) markers in HCC. The objective of this study was to investigate the expression of EMT markers and their correlation with clinicopathological variables and survival in hepatitis C virus (HCV)-associated HCC.
METHODS: This longitudinal study included 109 cases of HCV-associated HCC treated with surgical resection. Nine different EMT markers (vimentin, E-cadherin, N-cadherin, Stat3, Snail1, Slug, Twist1, Zeb1 and integrin α5) were evaluated on liver tissue from HCC cases. Twenty fresh HCC samples from the studied cases were used for gene expression of EMT markers by quantitative real time polymerase chain reaction (PCR).
RESULTS: EMT markers expression was 71%, 25%, 26%, 27%, 9%, 4%, 72%, 47%, 87% for vimentin, E-cadherin, N-cadherin, Stat3 snail1, slug, twist1, Zeb1 and integrin α5 respectively.  EMT mRNA in HCC tissues correlated with protein expression by 50-70%.  Vimentin was independent predictor of large tumor size (P=0.001), high risk of recurrence (HRR) (P=0.006) and shorter disease free survival (P=0.03) in multivariate analysis.  Reduced E-cadherin was a predictor of HRR (P=0.002).
CONCLUSION: Vimentin and E-cadherin were the most powerful prognostic EMT markers in HCV-associated HCC in prediction of recurrence.

Entities:  

Keywords:  Epithelial-mesenchymal transition markers; HCV; Hepatocellular carcinoma; Prognosis

Mesh:

Year:  2022        PMID: 35345355      PMCID: PMC9360938          DOI: 10.31557/APJCP.2022.23.3.839

Source DB:  PubMed          Journal:  Asian Pac J Cancer Prev        ISSN: 1513-7368


Introduction

In spite of the rapidly developing era of direct acting antiviral regimens (DAA) in the treatment of hepatitis C virus (HCV), the incidence of hepatocellular carcinoma (HCC) is still rising (Ferlay et al., 2015; Pascut et al., 2020). Following successful virus clearance, patients continue to suffer from the sequelae of chronic HCV such as liver cirrhosis and HCC. Moreover, it has been reported recently that DAA may be claimed for the increase incidence of HCC (Musa et al., 2020). The treatment of HCC is dependent on the tumor stage at time of diagnosis. Partial or total hepatectomy with liver transplantation are the best available treatment option for patients at early stages of the disease (El-Zayadi et al., 2005). Nevertheless, HCC is associated with a high risk of postoperative recurrence and metastasis (Adam et al., 2012). The conventional clinicopathologic features of the tumor as tumor size, vascular invasion and tumor/nodal/metastases (TNM) stage are currently used for prediction of HCC prognosis (Bruix et al., 2014). Unfortunately, HCC is a heterogeneous disease and even in patients with the same clinical and pathological characteristics, the prognosis varies (Tandon and Gracia-Tsao, 2009). Therefore, it is of great importance to find other potential molecular markers that can help in predicting HCC recurrence and metastasis (Kim et al., 2010; Pinero et al., 2020 ). Epithelial – mesenchymal transition (EMT) was first identified as an essential process in cancer in 1989 (Wan et al., 2017). Later on, EMT has been found to play an important role in tumor cell invasion and metastatic potential of various cancers (Boyer et al., 1989; Soltermann et al., 2008; Saski et al., 2009; Iwatsuki et al., 2010; Joger et al., 2010). In case of HCC, numerous studies investigated EMT markers and their relation to the clinicopathologic features and metastasis. However most of these articles did not include survival data (Lee et al., 2006; Zhao et al., 2011; Zhang et al., 2012; Li et al., 2013; Yuan et al., 2020; Song, 2020). On the other hand, studies including survival data were analyzing one or two EMT markers (Yang et al., 2007; Sun et al., 2010; Cai et al., 2012; Hashiguchi et al.,2013; Yao et al., 2013; Meng et al.,2015). Investigation of multiple EMT markers with follow up data in HCC has been reported in very few studies (Yang et al., 2009; Kim et al., 2010; Nagai et al.,2016). In all these studies HCV-related HCC represented only a small fraction of the analyzed HCC cases. In the current study, we intended to explore the value of multiple EMT markers in a cohort of 109 HCV-associated HCC patients with full follow up data. We were attempting to find out EMT marker (s) that can be used complementary to the routine prognostic factors to select cases with aggressive behavior who may need postoperative adjuvant therapy.

Materials and Methods

Specimen and data collection One hundred and nine patients who underwent curative partial –hepatectomy or total hepatectomy with liver transplantation were enrolled in this study. The patients were selected according to HCV positivity, absence of preoperative therapy for HCC and availability of follow up data. They were obtained during the period 2012 – 2015 from National Liver Institute, Menoufia University, Ain- Shams University hospitals and Dar Al Fouad hospital. The clinical, follow up and pathologic data were retrieved from the medical and pathology records. TNM staging was done according to the American Joint Committee on Cancer (Amin et al., 2017). Hematoxylin and eosin–stained sections from the tumor tissue were re-examined to confirm the diagnosis and assess the histologic grade based on Edmondson and Steiner criteria (Edmondson and Steiner, 1954). This work was approved by the Research Ethical Committee (IRB) of the Faculty of Medicine, Ain–Shams University (FWA00006444) according to the declaration of Helsinki for medical research involving human subjects. Patients that had samples from fresh frozen liver tissue had informed consent. All data and specimens were anonymized. Immunohistochemistry Formalin–fixed, paraffin embedded tissue sections were obtained from all 109 resected HCC specimens. Ten normal liver tissue samples were taken from healthy donors (after informed consent) to be used as control. All tissue sections were dewaxed and hydrated. After antigen retrieval in citrate buffer and blocking the endogenous peroxidase activity, the tissue sections were incubated with the primary antibodies. The following antibodies with their catalog number were: Vimentin, MS–129–R7, E-cadherin, MS–9470–R7, N-cadherin, 030076, Stat 3, S 7971 – 20C, Snai1, 031251, Slug, 213491, Twist1, 214438, Zeb1, 214442 and Integrin 5, C 2405 - 02S. Vimentin and E-Cadherin antibodies were purchased from Thermo Fisher Scientific (UK) and were ready to use. The remaining antibodies were purchased from US Biological (MA, USA) and used at a concentration of 1:100. The incubation period for vimentin and E-Cadherin was one hour at room temperature. Incubation with the rest of antibodies was overnight at 4ºC. As a negative control, the primary antibody was replaced by nonimmunized mouse serum. Appropriate positive control tissue sections were used as recommended by the manufacturer. The staining system was the mouse/ rabbit specific HRP-DAB detection kit (catalog no. TP-060-HL, Thermo Fisher Scientific, UK). This system was applied according to the manufacturer’s instructions. Interpretation of immunostaining For vimentin, the cases were classified as negative or positive (>5% of tumor cells showed cytoplasm staining). For E-cadherin and N-cadherin, the results were categorized as either reduced expression or preserved expression (>90% of tumor cells showed membranous staining) (Hashiguchi et al., 2013). Stat3 expression was evaluated according to Xiang et al.; 2002 as negative (0-15% of tumor cells showed nuclear staining) or positive (> 15% positive tumor cells). For Snai1, Slug and Twist1, positivity was considered when ≥ 50% of the tumor cells revealed nuclear staining (Losic et al., 2020). Zebl expression was regarded as positive if at least 1% of the tumor cells has positively stained nuclei (Sun et al., 2010). Integrin-5 immunostaining was categorized according to Yao et al.; 1997 as follows: 1 (no staining), 2 (fewer than 15% positive membranous staining of the tumor cells), 3 (15% - 50% positive cells), 4 (more than 50% positive cells). For statistical analysis, 1 and 2 were grouped as negative and 3 and 4 as positive. Real time PCR analysis Twenty frozen tissue specimens from the 109 HCC patients and ten normal liver tissues were used to analyze the expression of vimentin, E-cadherin, Snai1, Twist1 and Zeb1 mRNA as selected EMT markers. β-Actin as house keeping gene was used as a reference gene. Total RNA was isolated from frozen tissue using an RNeasy Plus Minikit (Qiagen, Valencia, CA, USA). RNA quality was assessed by using NanoDrop2000 (Thermo Fisher Scientific, UK ). The ratio of absorbance at 260 and 280 nm was used to assess the purity of RNA, a ratio of 1.8- 2.1 is an indicator of purified RNA. For cDNA synthesis, we used one microgram from total RNA and random primers were used using the RevertAid H Minus Reverse Transcriptase provided by (ThermoFisher Scientific Inc., Canada). In a total volume of 20 µl real time PCR reactions were performed using SYBR Green (Life Technologies, CA) and was conducted on the Applied Biosystems Step One™. PCR reactions were as following 15 minutes incubation at 95°C followed by 40 cycles for 15 seconds at 94°C, and annealing temperature of 55 °C for 30 seconds and 70°C for extension for another 30 seconds . After PCR amplification, the ΔCt is calculated by subtraction of the Β-Actin Ct from each sample Ct. The following equation 2−ΔΔCt was used for data analysis. The primer sets used were as the following. Vimentin F: 5’-GTTGACAATGCGTCTCTGGC-3’ R: 5’-CGATTAGGACAGCTGTTCCT-3’ E- cadherin F: 5’-GGAACCTCTGTGATGGAGGTCA-3’ R: 5’-AAGCGATGGCGGCATTGTA-3’ Snai1 F: 5’-GTTTACCTTCCAGCAGCCCTA -3’ R: 5’- CAGGACAGAGTCCCAGATGAG-3’ Twist1 F: 5’-ACGAGCTGGACTCCAAGATG-3 R: 5’- CACGCCCTGTTTCTTTGAAT -3’ Zeb1 F: 5’-TGCAGAAAATGAGCAAAACCAT-3’ R: 5’-GTGAAAATGCACTGGTGTTCCA-3’ Statistical analysis The relationships between EMT markers and clinicoopathologic factors were investigated by Chi square test. Overall survival (OS) and disease free survival (DFS) were analyzed by Kaplan-Meir survival curve and their relationships to the expression of EMT markers were assessed using long-rank test. The correlations between the levels of expression of various EMT markers were evaluated by Spearman’s rank correlation test. Finally, multivariate analysis was performed by applying Cox proportional hazard model to identify the EMT markers with independent prognostic value. A P value less than 0.05 was considered statistically significant.

Results

Clinicopathologic features The ages of the 109 patients included in the study ranged from 44 to 75 years with mean age 57.7 ±9.1. They were 90 males (82.6%) and 19 females (17.4%). The clinicopathologic data are given in Table 1. The overall survival (OS) ranged from 12 to 26 months (median 24 months). The disease free survival ranged from 6 to 24 months (median 12 months).
Table 1

Clinicopathologic Data of 109 Hepatocellular Carcinoma Cases Included in the Study

FeatureNumber (%)
Age
≤ 50 years18 (16.5)
> 50 years91 (83.5)
Alpha fetoprotein (ng/ML)
≤ 40060 (82.2)
> 40013 (17.8)
Tumor size (cm)
≤ 573 (67.0)
> 536 (33.0)
Histologic grade
I41 (37.6)
II53 (48.6)
III & IV15 (13.8)
Vascular invasion
Absent75 (68.8)
Present34 (31.2)
TNM stage
I39 (35.8)
II51 (46.8)
III19 (17.4)
Recurrence
Absent39 (35.8)
present70 (64.2)
Immunoexpression of EMT markers Normal liver tissue samples showed positive immunostaining for E-cadherin, N-cadherin and integrin α5. Whereas, none of the remaining studied EMT markers revealed immunoexpression in normal liver tissues. The immunohistochemical results of EMT markers in liver tissue from HCC cases are shown in Table 2 and Figure 1.
Table 2

Immunohistochemistry of EMT Markers in 109 Hepatocellular Carcinoma Cases

MarkerNegative (%)Positive (%)
Vimentin32 (29.4)77 (70.6)
E-cadherin82 (75.2)27 (24.8)
N-cadherin81 (47.3)28 (25.7)
Stat 380 (73.4)29 (26.6)
Snai199 (90.8)10 (9.2)
Slug105 (96.3)4 (3.7)
Twist131 (28.4)78 (71.6)
Zeb158 (53.2)51 (46.8)
Integrina514 (12.8)95 (87.2)
Figure 1

Cases of Hepatocellular Carcinoma Showing. (a), cytoplasmic staining of vimentin; (b), preserved membranous expression of E-cadherin; (c), preserved membranous expression of N-cadherin; (d), nuclear staining for Stat3; (e), nuclear staining of Snai1; (f), nuclear staining of slug; (g), nuclear staining of Twist1; (h), nuclear staining of Zeb1; (i), cytoplasmic staining for integrinα5. Original mag. X200

PCR data The results showed that HCC cases had higher expression regarding vimentin, E-cadherin, Snai1, Twist1 and Zeb1 when compared with normal liver tissues. Relationship between EMT markers and clinicopathologic factors Table 3, shows the relationships between the 9 investigated EMT markers and the clinicopathologic variables in the HCC cases as estimated by Chi square test.
Table 3

Relationship between Immunohistochemical Expression of EMT Markers and Clinicopathologic Variables

Variables VimentinReducedEcadherinReducedNcadherinStat 3Snai1SlugTwist1Zeb1Integrinα5
variableNNPNPNPNPNPNPNPNPNP
Age (years)
≤ 501816NS13NS11NS4NS0NS0NS15NS9NS14NS
> 509161697025104634281
Gender
Male8765NS70NS66NS24NS9NS3NS67NS44NS78NS
Female1912121551111717
Grade
I41282530811251435
II5337NS430.0243NS17NS50.023NS40NS29NS48NS
III & IV151214844013812
AFP (ng/ML)
≤ 4006047NS43NS43NS11NS00.0022NS380.00924NS50NS
> 400131110832113313
Tumor size
≤ 5cm73580.00457NS51NS18NS30.0092NS51NS33NS600.03
> 5cm361925301172271835
Stage
I392329NS31NS12NS4NS1NS29NS240.0133NS
II5141NS3934922361644
III19131416841131118
V-invasion
Absent75460.002510.00957NS22NS5NS2NS51NS37NS65NS
Present34313124752271430
Recurrence
Absent39190230.00332NS10NS5NS1NS27NS250.00735NS
Present705859491953512660
Survival analysis Long rank test revealed that the rate of 2-year overall survival (OS) was significantly less for patients whose tumors showed vimentin positivity (X2 = 7.3, P = 0.007, Figure 2A), reduced E-cadherin expression (X2 = 5.0, P = 0.03, Figure 2B) and integrin positivity (X2 = 9.1, P = 0.003, Figure 2C). The rest of the EMT markers had no value in predicating the OS. Regarding the rate of the 2-year disease free survival (DFS), it was less for patients with vimentin positivity (X2 = 13.7, P = 0.000, Figure 3A), reduced E-cadherin (X2 = 7.7, P = 0.006, Figure 3B) and Zebl negativity (X2 = 7.0, P = 0.008, Figure 3C).
Figure 2

Kaplan-Meir Survival Curve Showing the Relationship between Overall Survival and the expression of (a) Vimentin (P=0.007), (b) E-cadherin (P=0.03), and (c) integrinα5 (P=0.003)

Figure 3

Kaplan-Meir Survival Curve Showing the Relationship between Disease Free Survival and the Expression of (a) Vimentin (P=0.000), (b) E-cadherin (P=0.006), and (c) Zeb1 (P=0.008)

Independent prognostic EMT markers Multivariate Cox regression analysis (Table 4) showed that vimentin was an independent predictor of larger tumor size (P=0.001), vascular invasion (P=0.004), increased risk of recurrence (P=0.006) and shorter DFS (P=0.03). Reduced E-cadherin expression was an independent predictor of poor tumor histologic grade (P=0.002) and high risk of recurrence (P=0.002). Snail expression predicts larger tumor size (P= 0.02) as well as poor histologic grade (P=0.01). Zebl predicts earlier TNM stage (P=0.02) and integrinα5 expression independently predicts shorter OS (P=0.02).
Table 4

Multivariate Analysis of Prognostic Value of EMT Markers According to Real Time PCR Results

MarkerTumor sizeHistologic gradeVascular invasionTNMstageRecurrenceOverallSurvival Disease free Survival
Vimentin______
Odds ratio0.158.73.993.712.1
95% CI0.05 - 0.461.99-37.931.48 - 10.800.83 - 16.671.06-4.17
P0.0010.0040.006NS0.03
E cadherin______
Odds ratio0.210.240.160.390.74
95% CI0.08 - 0.560.05 – 1.140.05 – 0.530.09 – 1.760.36 – 1.51
P0.002NS0.002NSNS
Snai1_______________
Odds ratio5.633.72
95% CI1.36 – 23.301.32 – 10.47
P0.020.01
Zebl____________
Odds ratio2.391.040.67
95% CI1.19 – 4.820.41 – 2.660.41 – 1.10
P0.02NSNS
Integrinα5_______________
Odds ratio7.580.35
95% CI0.95 – 60.470.15 – 0.81
PNS0.02
Correlation between EMT markers Figure 4, showed the correlation between the expression levels of the EMT markers. This figure demonstrated that most of the EMT markers are correlated with each other. The main correlations can be categorized into two groups. First, significant positive correlation between each two of the following: vimentin expression, E-cadherin reduced expression, Twist expression and Zebl expression. The only exception was the relationship between Zebl expression and either vimentin expression or reduced E-cadherin expression which was an inverse correlation. The second group included Stat3, Twist1 and Zebl which showed positive correlation between the expression levels of any two markers.
Figure 4

Spearman Rank Correlation between: (a) Vimentin and E-cadherin (r=-0.764, P=0.000), (b) Vimentin and Zeb1(r=-0.220, P=0.028), (c) Vimentin and Twist1 (r=0.215, P=0.03), (d) E-cadherin and Zeb1 (r=0.216, P=0.03), (e) E-cadherin and Twist1 (r=-0.386, P=0.000), (f) Stat3 and Twist1(r=0.327, P=0.001), (g) Stat3 and Zeb1 (r=0.290, P=0.003) and Zeb1 and Twist1 (r=0.203,P=0.04)

Cases of Hepatocellular Carcinoma Showing. (a), cytoplasmic staining of vimentin; (b), preserved membranous expression of E-cadherin; (c), preserved membranous expression of N-cadherin; (d), nuclear staining for Stat3; (e), nuclear staining of Snai1; (f), nuclear staining of slug; (g), nuclear staining of Twist1; (h), nuclear staining of Zeb1; (i), cytoplasmic staining for integrinα5. Original mag. X200 Kaplan-Meir Survival Curve Showing the Relationship between Overall Survival and the expression of (a) Vimentin (P=0.007), (b) E-cadherin (P=0.03), and (c) integrinα5 (P=0.003) Clinicopathologic Data of 109 Hepatocellular Carcinoma Cases Included in the Study Immunohistochemistry of EMT Markers in 109 Hepatocellular Carcinoma Cases Relationship between Immunohistochemical Expression of EMT Markers and Clinicopathologic Variables Multivariate Analysis of Prognostic Value of EMT Markers According to Real Time PCR Results Kaplan-Meir Survival Curve Showing the Relationship between Disease Free Survival and the Expression of (a) Vimentin (P=0.000), (b) E-cadherin (P=0.006), and (c) Zeb1 (P=0.008) Spearman Rank Correlation between: (a) Vimentin and E-cadherin (r=-0.764, P=0.000), (b) Vimentin and Zeb1(r=-0.220, P=0.028), (c) Vimentin and Twist1 (r=0.215, P=0.03), (d) E-cadherin and Zeb1 (r=0.216, P=0.03), (e) E-cadherin and Twist1 (r=-0.386, P=0.000), (f) Stat3 and Twist1(r=0.327, P=0.001), (g) Stat3 and Zeb1 (r=0.290, P=0.003) and Zeb1 and Twist1 (r=0.203,P=0.04)

Discussion

Hepatocellular carcinoma (HCC) is an aggressive disease with high rate of recurrence and metastasis (Forner et al.;2012). The value of the traditional clinicopathologic parameters in predicting the patient outcome after curative surgery is limited (Bruix et al., 2014). This indicates the need for other potential markers that can be of prognostic value in HCC (Kim et al., 2010). Several molecular techniques have proposed a gene signature for predicting prognosis of HCC patients (Kim et al.,2010; Nagai et al., 2016; Villanueva et al., 2007; Wang et al., 2007). Nevertheless, these methods cannot be applied for routine practice due to their tedious technology (Dupuy and Simon, 2007). Immunohistochemistry is now considered a reliable and simple method which is available in routine pathology laboratories (Chen, 2000). The process of epithelial–mesenchymal transition (EMT) has been reported to be a key factor in cancer development and progression including metastasis and recurrence (Ye and Weinberg, 2015; Smith and Bhowmick, 2016). Numerous studies investigated the prognostic value of EMT in HCC. However, most of these studies, if not all, are from East Asia, mainly China (Iwatsuki et al., 2010; Nagai et al., 2016). Up to our knowledge, no reports are available from the Middle East especially Egypt, where HCC is a very common malignancy (Pascut et al., 2020). In this study we assessed the value of nine EMT markers in a cohort of 109 HCC patients by correlating them to the conventional clinicopathologic factors as well as recurrence, overall survival (OS) and disease free survival (DFS). It was astonishing to find that the level of reduced E-cadherin expression (75%) and the positive expression of vimentin (71%), Twist1 (72%) and Zebl (47%) were much higher than that reported in many immunohistochemical studies (Bruix et al., 2014; Zhang et al., 2012; Yao et al., 2013; Yang et al., 2007; Sun et al., 2010). This difference may be due to variation in methodology, types and dilution of antibodies or interpretation of results. Alternatively, we speculate that the higher level of EMT markers in our patients as compared to other studies is due to the fact that all cases included in the present work were HCV-associated in contrast to those studies where HCV infection was not present or limited to few or some of the investigated HCC cases (Yang et al., 2009; Sun et al., 2010; Zhao et al., 2011; Zhang et al., 2012; Yao et al., 2013; Hashiguchi et al.,2013; He et al.,2014; Luo et al., 2016; Yuan et al., 2020). The role of HCV in inducing the process of EMT was pointed out by several studies (Battaglia et al., 2009; Bose et al., 2012; Akkari et al., 2012; Iqbal et al., 2014; Kwon et al., 2015). Battaglia et al., (2009) found that in HCC, the expression of HCV-derived core protein switched the cellular response to transforming growth factor ß from inhibition of growth to induction of EMT. A more recent study reported that HCV – infected hepatocytes secrete osteopontin which binds with cell surface receptors and triggers signaling cascade that promotes EMT (Iqbal et al., 2014). Last but not least, Kwon et al., (2015) highlighted that HCV induces signaling molecules that trigger EMT generation. Multivariate analysis demonstrated that the most important one among all EMT markers included in the current study was vimentin which proved to be an independent indicator of the tumor size (P = 0.001), vascular invasion (P = 0.004) and more importantly recurrence (P = 0.006) and DFS (0.03). This agrees with previous reports (Satelli et al., 2011; Li et al., 2013; Mima et al., 2013). The prognostic value of vimentin in HCC can be explained by various mechanisms. First, vimentin as an EMT marker promotes tumor angiogenesis and thus stimulates invasion and metastasis (Zhang et al., 2013). Second, EMT markers including vimentin are suggested to have an anti-apoptotic action which leads to tumor growth (Shang et al., 2013; Sui et al., 2014). Third, vimentin may induce cancer stem cell generation in cancer patients and accordingly enhance tumor growth and recurrence (Li and Zhou, 2017). The next important EMT marker in our study was E-cadherin which was found to be an independent predictor of histologic grade (P = 0.002) and recurrence (P = 0.002). This result was previously reported by others (Sun et al., 2010; Zhang et al., 2012; Cai et al., 2012; Hashiguchi et al., 2013; Liu et al., 2017). The important role of vimentin and E-cadherin was further supported by the significant positive correlation between the levels of vimentin expression and E-cadherin reduced expression. In fact, these findings were expected. Vimentin and E-cadherin are the main pillars in the process of EMT, since EMT is manifested by changing the epithelial morphology of the cells through losing the epithelial markers mainly E-cadherin and acquiring the spindle cell morphology via expression of the mesenchymal markers as vimentin (Cai et al., 2012; Zheng and Kang, 2014). Other EMT markers that showed independent prognostic value included Snail, Zeb1 and integrinα5. The rest of markers included in our study (N-cadherin, Stat3, Slug and Twist1) had no independent prognostic value. These data agree with some studies (Yang et al., 2009; Kim et al., 2010; Sun et al., 2010; Nagai et al., 2016; Song et al.,2020). Other studies found that some of these EMT markers, especially N-cadherin and Twist1 had prognostic value in HCC. Yet, most of these studies did not apply multivariate analysis to assess the independent prognostic value of these markers (Iwatsuki et al., 2010; Zhao et al.,2012; Li et al., 2013; Yao et al., 2013; Hashiguchi et al., 2013, Liu et al., 2017). One of the important points investigated in our study was the relationship between the various EMT markers. Vimentin, E- cadherin, Twist1 and zeb1 were significantly correlated with each other. On the other hand, Stat3, Twist1 and Zeb1 were also significantly correlated with each other. These results suggest that EMT markers act interdependently. In other words, there is a cross-talk or signal axis relating these markers to each other to act cooperatively rather than individually to promote EMT in HCC. The relationship between various EMT markers in HCC patients was the subject of controversy. Li et al.;2013 reported that the level of E-cadherin did not correlate with snail, slug or Zeb1. Yang et al., (2009) found that E-cadherin correlated with Snail and Twist, but not with Slug. Other studies demonstrated that E-cadherin correlates negatively with Twist, while Zhang et al.,( 2012)could not achieve such a correlation. The most important limitations in this study were the relative small number of cases and short follow up period. Conversely, it has several points of strength. First, up to our knowledge, this is the initial study from the Middle East investigating EMT in HCC. Second, we analyzed a relatively good number of EMT markers with follow up data and multivariate analysis. Last, but not least, All HCC cases included in this work were HCV–associated which allowed us to disclose the effect of HCV on EMT expression in HCC. However, this needs further investigations with HCV–negative control cases. In conclusion, our results demonstrated that: 1) The level of EMT markers in Egyptian HCC patients is higher than that reported in the literature. Although HCV infection seems to be repressible of this high EMT level, further studies are recommended to confirm this speculation. 2) EMT markers play an impotent role in HCC prognosis and they act cooperatively as shown by the significant correlation between most of them. 3) More importantly, vimentin and E-cadherin proved to be strong independent predictors of patient prognosis, especially recurrence. These two markers are available in any routine pathology laboratory with easy and simple immunohistochemical technique. Therefore, we recommend these two markers in HCC patients with curative resection for prediction of the potential risk of recurrence.

Author Contribution Statement

Helal, T: PI of STDF grant, study concept and design, writing the manuscript. Aref, A: performed the gene expression analysis for EMT, literature search. Gomaa, A: managing all clinical & survival data for HCC cases from NLI. Nada, O: interpretation of immunohistochemical results. Abdelghaffar, M: managing clinical & survival data for HCC cases from Ain Shams. Farouk,K:managing clinical & survival data for HCC cases from Dar Al-Fouad Hospital. Ehsan, N: interpretation of immunohistochemical results, drafting the manuscript.
  54 in total

1.  The clinical significance of vimentin-expressing gastric cancer cells in bone marrow.

Authors:  Masaaki Iwatsuki; Koshi Mimori; Takeo Fukagawa; Hideshi Ishii; Takehiko Yokobori; Mitsuru Sasako; Hideo Baba; Masaki Mori
Journal:  Ann Surg Oncol       Date:  2010-04-01       Impact factor: 5.344

2.  Activation of STAT3 signal pathway correlates with twist and E-cadherin expression in hepatocellular carcinoma and their clinical significance.

Authors:  Chuan-Hai Zhang; Ge-Liang Xu; Wei-Dong Jia; Jian-Sheng Li; Jin-Liang Ma; Wei-Hua Ren; Yong-Sheng Ge; Ji-Hai Yu; Wen-Bin Liu; Wei Wang
Journal:  J Surg Res       Date:  2010-11-23       Impact factor: 2.192

3.  Hepatocellular carcinoma in Egypt: a single center study over a decade.

Authors:  Abdel-Rahman el-Zayadi; Hanaa M Badran; Eman M F Barakat; Mohy el-Deen Attia; Sherine Shawky; Mostafa K Mohamed; Osaima Selim; Ahmed Saeid
Journal:  World J Gastroenterol       Date:  2005-09-07       Impact factor: 5.742

Review 4.  Hepatocellular carcinoma.

Authors:  Alejandro Forner; Josep M Llovet; Jordi Bruix
Journal:  Lancet       Date:  2012-02-20       Impact factor: 79.321

5.  Epithelial-mesenchymal transition expression profiles as a prognostic factor for disease-free survival in hepatocellular carcinoma: Clinical significance of transforming growth factor-β signaling.

Authors:  Kosuke Mima; Hiromitsu Hayashi; Hideyuki Kuroki; Shigeki Nakagawa; Hirohisa Okabe; Akira Chikamoto; Masayuki Watanabe; Toru Beppu; Hideo Baba
Journal:  Oncol Lett       Date:  2012-10-05       Impact factor: 2.967

6.  Significance of Twist expression and its association with E-cadherin in esophageal squamous cell carcinoma.

Authors:  Ken Sasaki; Shoji Natsugoe; Sumiya Ishigami; Masataka Matsumoto; Hiroshi Okumura; Tetsuro Setoyama; Yasuto Uchikado; Yoshiaki Kita; Kiyokazu Tamotsu; Akihiko Sakamoto; Tetsuhiro Owaki; Takashi Aikou
Journal:  J Exp Clin Cancer Res       Date:  2009-12-21

7.  Resection or transplantation for early hepatocellular carcinoma in a cirrhotic liver: does size define the best oncological strategy?

Authors:  Rene Adam; Prashant Bhangui; Eric Vibert; Daniel Azoulay; Gilles Pelletier; Jean-Charles Duclos-Vallée; Didier Samuel; Catherine Guettier; Denis Castaing
Journal:  Ann Surg       Date:  2012-12       Impact factor: 12.969

Review 8.  Hepatocellular carcinoma: clinical frontiers and perspectives.

Authors:  Jordi Bruix; Gregory J Gores; Vincenzo Mazzaferro
Journal:  Gut       Date:  2014-02-14       Impact factor: 23.059

9.  Inhibition of JAK1, 2/STAT3 signaling induces apoptosis, cell cycle arrest, and reduces tumor cell invasion in colorectal cancer cells.

Authors:  Hua Xiong; Zhi-Gang Zhang; Xiao-Qing Tian; Dan-Feng Sun; Qin-Chuan Liang; Yan-Jie Zhang; Rong Lu; Ying-Xuan Chen; Jing-Yuan Fang
Journal:  Neoplasia       Date:  2008-03       Impact factor: 5.715

10.  Rearrangements of desmosomal and cytoskeletal proteins during the transition from epithelial to fibroblastoid organization in cultured rat bladder carcinoma cells.

Authors:  B Boyer; G C Tucker; A M Vallés; W W Franke; J P Thiery
Journal:  J Cell Biol       Date:  1989-10       Impact factor: 10.539

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.