| Literature DB >> 35335300 |
Parag Palit1, Farhana Tasnim Chowdhury2, Namrata Baruah3, Bonoshree Sarkar2, Sadia Noor Mou2, Mehnaz Kamal1, Towfida Jahan Siddiqua1, Zannatun Noor1, Tahmeed Ahmed1.
Abstract
Shigella species account for the second-leading cause of deaths due to diarrheal diseases among children of less than 5 years of age. The emergence of multi-drug-resistant Shigella isolates and the lack of availability of Shigella vaccines have led to the pertinence in the efforts made for the development of new therapeutic strategies against shigellosis. Consequently, designing small-interfering RNA (siRNA) candidates against such infectious agents represents a novel approach to propose new therapeutic candidates to curb the rampant rise of anti-microbial resistance in such pathogens. In this study, we analyzed 264 conserved sequences from 15 different conserved virulence genes of Shigella sp., through extensive rational validation using a plethora of first-generation and second-generation computational algorithms for siRNA designing. Fifty-eight siRNA candidates were obtained by using the first-generation algorithms, out of which only 38 siRNA candidates complied with the second-generation rules of siRNA designing. Further computational validation showed that 16 siRNA candidates were found to have a substantial functional efficiency, out of which 11 siRNA candidates were found to be non-immunogenic. Finally, three siRNA candidates exhibited a sterically feasible three-dimensional structure as exhibited by parameters of nucleic acid geometry such as: the probability of wrong sugar puckers, bad backbone confirmations, bad bonds, and bad angles being within the accepted threshold for stable tertiary structure. Although the findings of our study require further wet-lab validation and optimization for therapeutic use in the treatment of shigellosis, the computationally validated siRNA candidates are expected to suppress the expression of the virulence genes, namely: IpgD (siRNA 9) and OspB (siRNA 15 and siRNA 17) and thus act as a prospective tool in the RNA interference (RNAi) pathway. However, the findings of our study require further wet-lab validation and optimization for regular therapeutic use for treatment of shigellosis.Entities:
Keywords: RNAi pathway; Shigella; computational algorithms; shigellosis; small-interfering RNA
Mesh:
Substances:
Year: 2022 PMID: 35335300 PMCID: PMC8950558 DOI: 10.3390/molecules27061936
Source DB: PubMed Journal: Molecules ISSN: 1420-3049 Impact factor: 4.411
Figure 1Overview of the workflow of the methodology followed in the study.
List of webservers used in this study and their corresponding functions. (URL accessed on date 12 January 2021).
| Name of Webserver | URL | Function |
|---|---|---|
| NCBI Nucleotide |
| Databases consisting of nucleotide sequences from sources such as: GenBank, RefSeq, TPA, and PDB. |
| Clustal Omega |
| Multiple sequence-alignment tools that use seeded guide trees and Hidden Markov Models (HMM) to generate alignments between three or more sequences. |
| siDirect 2.0 |
| Candidate siRNA designing on the basis of the first generation algorithms for siRNA designing (Ui-Tei, Amarzguioui, and Reynolds rules) and using target mRNA sequences as query. |
| i-SCORE Designer |
| Validation of potential siRNA candidates on the basis of the second generation rules for siRNA designing (i-Score‚ s-Biopredsi‚ and DSIR) |
| BLAST |
| Locating regions of similarity between biological sequences for the determination of off-target sequence similarity between candidate siRNA and other nucleotide sequences in the host system. |
| RNAstructure |
| Prediction and validation of the secondary structures of the siRNA candidates. |
| OligoCalC: Oligonucleotide Properties Calculator |
| Calculating the GC content in the predicted siRNA candidates. |
| OligoWalk |
| Assessment of thermodynamic stability of the predicted candidate siRNA and determination of its strand, functional efficiency, and target accessibility. |
| siRNAPred |
| Validation of the functional efficiency of the predicted siRNA candidates against the Main21 dataset. |
| imRNA |
| Prediction of the immunotoxicity of the designed siRNA candidates. |
| RNAComposer |
| Prediction of tertiary structure siRNA candidates. |
| MOLprobity |
| Validation of the tertiary structure of siRNA candidates. |
Effective siRNA candidates for each of the conserved virulence-associated Shigella genes as analyzed by both the first-generation and second-generation algorithms for designing siRNAs along with their respective free energy of folding and GC content.
| siRNA | Gene | Target Sequence | Predicted siRNA Duplex siRNA Candidate at 37 °C (5′ to 3′) | Combined Second-Generation Algorithm Scoring a | Free Energy of Self-Folding of Guide Strand (kcal/mol) | GC Content (%) |
|---|---|---|---|---|---|---|
| siRNA 1 | IcsA | TGGAATGGATGCGTGGTATATAA | AUAUACCACGCAUCCAUUCCA | <90% threshold | ----- | ----- |
| GAAUGGAUGCGUGGUAUAUAA | ||||||
| siRNA 2 | IcsA | TACGGATTAACTCTGATATTATG | UUAUAUAUCCGCUAUUAGCAA | >90% threshold | 1.0 | 28.57 |
| GCUAAUAGCGGAUAUAUAAUU | ||||||
| siRNA 3 | IcsA | TTGCTAATAGCGGATATATAATT | UUAUAUAUCCGCUAUUAGCAA | >90% threshold | −1.30 | ----- |
| GCUAAUAGCGGAUAUAUAAUU | ||||||
| siRNA 4 | IcsA | TGGTGATGTACAGGTTAACAATT | UUGUUAACCUGUACAUCACCA | >90% threshold | 1.50 | 38.10 |
| GUGAUGUACAGGUUAACAAUU | ||||||
| siRNA 5 | IpaJ | ATGGAATTAGGTGCAAGAAGAAG | UCUUCUUGCACCUAAUUCCAU | >90% threshold | 1.80 | 38.10 |
| GGAAUUAGGUGCAAGAAGAAG | ||||||
| siRNA6 | IpaJ | TGGAATTAGGTGCAAGAAGAAGT | UUCUUCUUGCACCUAAUUCCA | >90% threshold | 1.80 | 38.10 |
| GAAUUAGGUGCAAGAAGAAGU | ||||||
| siRNA7 | IpgB | AAGGATCTTACAAATCTAGTATC | UACUAGAUUUGUAAGAUCCUU | >90% threshold | 1.70 | 28.57 |
| GGAUCUUACAAAUCUAGUAUC | ||||||
| siRNA8 | IpgD | AGCCATGATGGAACGATTAGATA | UCUAAUCGUUCCAUCAUGGCU | <90% threshold | ----- | ----- |
| CCAUGAUGGAACGAUUAGAUA | ||||||
| siRNA 9 | IpgD | GAGGAATGTTGACAAGCTTAATG | UUAAGCUUGUCAACAUUCCUC | >90% threshold | 1.80 | 38.10 |
| GGAAUGUUGACAAGCUUAAUG | ||||||
| siRNA 10 | IpgD | TGGAAATCCAAGAGATGAATACT | UAUUCAUCUCUUGGAUUUCCA | <90% threshold | ----- | ----- |
| GAAAUCCAAGAGAUGAAUACU | ||||||
| siRNA 11 | MxiC | TTCAGCTATACAGGCTAAATTAT | AAUUUAGCCUGUAUAGCUGAA | <90% threshold | ----- | ----- |
| CAGCUAUACAGGCUAAAUUAU | ||||||
| siRNA 12 | MxiC | GTGAAAGTGAGCAAATTCTTACT | UAAGAAUUUGCUCACUUUCAC | <90% threshold | ----- | ----- |
| GAAAGUGAGCAAAUUCUUACU | ||||||
| siRNA 13 | MxiC | GAGGATTCTGTAGTGTATCAAAC | UUGAUACACUACAGAAUCCUC | >90% threshold | 1.70 | 38.10 |
| GGAUUCUGUAGUGUAUCAAAC | ||||||
| siRNA 14 | OspB | ATGTACAAACAATCATTTCAAGA | UUGAAAUGAUUGUUUGUACAU | >90% threshold | 1.70 | 23.80 |
| GUACAAACAAUCAUUUCAAGA | ||||||
| siRNA 15 | OspB | CTGCTGAAAGTCTTTCTTGTATC | UACAAGAAAGACUUUCAGCAG | >90% threshold | 1.70 | 38.10 |
| GCUGAAAGUCUUUCUUGUAUC | ||||||
| siRNA 16 | OspB | ATCTTTGCTAGAGCAGATAAAAA | UUUAUCUGCUCUAGCAAAGAU | >90% threshold | −1.40 | ----- |
| CUUUGCUAGAGCAGAUAAAAA | ||||||
| siRNA 17 | OspB | ATGAAAGACTGTGGTATTCTAAA | UAGAAUACCACAGUCUUUCAU | >90% threshold | 1.60 | 33.33 |
| GAAAGACUGUGGUAUUCUAAA | ||||||
| siRNA 18 | OspF | ATGCTTTCTGCGAATGAAAGATT | UCUUUCAUUCGCAGAAAGCAU | <90% threshold | ----- | ----- |
| GCUUUCUGCGAAUGAAAGA | ||||||
| siRNA 19 | OspF | TGGAAGATAACTGATATGAATCG | AUUCAUAUCAGUUAUCUUCCA | >90% threshold | 1.80 | 28.57 |
| GAAGAUAACUGAUAUGAAUCG | ||||||
| siRNA 20 | OspF | ATGGAAGATAACTGATATGAATC | UUCAUAUCAGUUAUCUUCCAU | >90% threshold | 1.80 | 28.57 |
| GGAAGAUAACUGAUAUGAAUC | ||||||
| siRNA 21 | OspF | TCGCAATATAGTGCTTTATTACT | UAAUAAAGCACUAUAUUGCGA | >90% threshold | −2.0 | ----- |
| GCAAUAUAGUGCUUUAUUACU | ||||||
| siRNA 22 | OspG | GCCCATTCTCGGTAAGTTAATAG | AUUAACUUACCGAGAAUGGGC | <90% threshold | ----- | ----- |
| CCAUUCUCGGUAAGUUAAUAG | ||||||
| siRNA 23 | OspG | CAGCTGATATCCCTGATAATATA | UAUUAUCAGGGAUAUCAGCUG | >90% threshold | 1.50 | 38.10 |
| GCUGAUAUCCCUGAUAAUAUA | ||||||
| siRNA 24 | OspG | ATCTACAGTTGATATGTAAATTG | AUUUACAUAUCAACUGUAGAU | <90% threshold | ----- | ----- |
| CUACAGUUGAUAUGUAAAUUG | ||||||
| siRNA 25 | OspG | ATCCATTACGATCTTAATACAGG | UGUAUUAAGAUCGUAAUGGAU | >90% threshold | 1.60 | 28.57 |
| CCAUUACGAUCUUAAUACAGG | ||||||
| siRNA 26 | OspG | CGCAATATTTATGCTGAATATTA | AUAUUCAGCAUAAAUAUUGCG | >90% threshold | −2.40 | ----- |
| CAAUAUUUAUGCUGAAUAUUA | ||||||
| siRNA 27 | Spa33 | GACAATCAATGAACTAAAAATGT | AUUUUUAGUUCAUUGAUUGUC | <90% threshold | ----- | ----- |
| CAAUCAAUGAACUAAAAAUGU | ||||||
| siRNA 28 | Spa33 | AACTAAAAATGTATGTAGAAAAC | UUUCUACAUACAUUUUUAGUU | >90% threshold | 1.60 | 19.05 |
| CUAAAAAUGUAUGUAGAAAAC | ||||||
| siRNA 29 | Spa33 | ATGTATGTAGAAAACGAATTATT | UAAUUCGUUUUCUACAUACAU | >90% threshold | 1.60 | 28.10 |
| GUAUGUAGAAAACGAAUUAUU | ||||||
| siRNA 30 | Spa33 | TTCAAGTTTCCCGATGACATAGT | UAUGUCAUCGGGAAACUUGAA | >90% threshold | −1.30 | ----- |
| CAAGUUUCCCGAUGACAUAGU | ||||||
| siRNA 31 | VirF | TTCAACAAATCCTTCTTGATATT | UAUCAAGAAGGAUUUGUUGAA | <90% threshold | ----- | ----- |
| CAACAAAUCCUUCUUGAUAUU | ||||||
| siRNA 32 | VirF | TGGCGTCTTTCTGATATTTCAAA | UGAAAUAUCAGAAAGACGCCA | >90% threshold | 1.80 | 38.10 |
| GCGUCUUUCUGAUAUUUCAAA | ||||||
| siRNA 33 | VirF | GTCTTTCTGATATTTCAAATAAC | UAUUUGAAAUAUCAGAAAGAC | >90% threshold | −1.40 | ----- |
| CUUUCUGAUAUUUCAAAUAAC | ||||||
| siRNA 34 | VirF | AACTTGAATTTATCAGAAATAGC | UAUUUCUGAUAAAUUCAAGUU | <90% threshold | ----- | ----- |
| CUUGAAUUUAUCAGAAAUAGC | ||||||
| siRNA 35 | VirA | GCCTGAACAACGAGTTATTAACA | UUAAUAACUCGUUGUUCAGGC | <90% threshold | ----- | ----- |
| CUGAACAACGAGUUAUUAACA | ||||||
| siRNA 36 | VirA | CTGAACAACGAGTTATTAACAAT | UGUUAAUAACUCGUUGUUCAG | <90% threshold | ----- | ----- |
| GAACAACGAGUUAUUAACAAU | ||||||
| siRNA 37 | VirA | TACGAAGTTAGCTCATCAATATT | UAUUGAUGAGCUAACUUCGUA | >90% threshold | −0.90 | ----- |
| CGAAGUUAGCUCAUCAAUAUU | ||||||
| siRNA 38 | VirA | ACGAAGTTAGCTCATCAATATTA | AUAUUGAUGAGCUAACUUCGU | >90% threshold | 1.60 | 33.33 |
| GAAGUUAGCUCAUCAAUAUUA | ||||||
| siRNA 39 | VirA | CTCCAGAAAGTCGTCAAGTATCA | AUACUUGACGACUUUCUGGAG | >90% threshold | 1.60 | 42.86 |
| CCAGAAAGUCGUCAAGUAUCA | ||||||
| siRNA 40 | VirB | CTCCATTCTGGTAATAAAGTTTC | AACUUUAUUACCAGAAUGGAG | <90% threshold | ----- | ----- |
| CCAUUCUGGUAAUAAAGUUUC | ||||||
| siRNA 41 | VirB | AACGAATGTACGCGATCAAGAAT | UCUUGAUCGCGUACAUUCGUU | <90% threshold | ----- | ----- |
| CGAAUGUACGCGAUCAAGAAU | ||||||
| siRNA 42 | VirB | GAGATTGATGGTAGAATTGAAAT | UUCAAUUCUACCAUCAAUCUC | >90% threshold | 1.80 | 33.33 |
| GAUUGAUGGUAGAAUUGAAAU | ||||||
| siRNA 43 | VirB | AACTAGCAAACGATATACAAACA | UUUGUAUAUCGUUUGCUAGUU | >90% threshold | 1.80 | 28.57 |
| CUAGCAAACGAUAUACAAACA | ||||||
| siRNA 44 | VirB | TAGTTCTACACTACCAATATTAA | AAUAUUGGUAGUGUAGAACUA | >90% threshold | −1.10 | ----- |
| GUUCUACACUACCAAUAUUAA | ||||||
| siRNA 45 | IpaA | GGGAAAGAAGATGTGTTAAGAAG | UCUUAACACAUCUUCUUUCCC | <90% threshold | ----- | ----- |
| GAAAGAAGAUGUGUUAAGAAG | ||||||
| siRNA 46 | IpaA | CACAGTATTCGGAACTAATTATA | UAAUUAGUUCCGAAUACUGUG | >90% threshold | 1.90 | 30.96 |
| CAGUAUUCGGAACUAAUUAUA | ||||||
| siRNA 47 | IpaA | TTGCACTATAGCACAACAACACA | UGUUGUUGUGCUAUAGUGCAA | <90% threshold | ----- | ----- |
| GCACUAUAGCACAACAACACA | ||||||
| siRNA 48 | IpaA | CTCCTCAATACTGAAGTATCATC | UGAUACUUCAGUAUUGAGGAG | >90% threshold | −3.20 | ----- |
| CCUCAAUACUGAAGUAUCAUC | ||||||
| siRNA 49 | IpaA | TCCGTTCTACCACACTCTATATC | UAUAGAGUGUGGUAGAACGGA | >90% threshold | 1.70 | 42.86 |
| CGUUCUACCACACUCUAUAUC | ||||||
| siRNA 50 | IpaA | TTCAACCATACTCCAGATAATTC | AUUAUCUGGAGUAUGGUUGAA | >90% threshold | 1.50 | 35.71 |
| CAACCAUACUCCAGAUAAUUC | ||||||
| siRNA 51 | IpaB | CACCAAAGTCATTAAATGCAAGT | UUGCAUUUAAUGACUUUGGUG | >90% threshold | 1.50 | 33.33 |
| CCAAAGUCAUUAAAUGCAAGU | ||||||
| siRNA 52 | IpaB | AAGAAATACAACTCACTATCAAA | UGAUAGUGAGUUGUAUUUCUU | >90% threshold | 1.50 | 28.57 |
| GAAAUACAACUCACUAUCAAA | ||||||
| siRNA 53 | IpaB | CAGTTAAAGACAGGACATTGATT | UCAAUGUCCUGUCUUUAACUG | >90% threshold | 1.80 | 35.71 |
| GUUAAAGACAGGACAUUGAUU | ||||||
| siRNA 54 | IpaB | CTCAATTGATGGCAACCTTTATT | UAAAGGUUGCCAUCAAUUGAG | >90% threshold | 1.40 | 35.71 |
| CAAUUGAUGGCAACCUUUAUU | ||||||
| siRNA 55 | IpaB | CTCCTTTCAGATGCATTTACAAA | UGUAAAUGCAUCUGAAAGGAG | <90% threshold | ----- | ----- |
| CCUUUCAGAUGCAUUUACAAA | ||||||
| siRNA 56 | IpaB | GGCCAATTGCAGGAAGTAATTGC | AAUUACUUCCUGCAAUUGGCC | <90% threshold | ----- | ----- |
| CCAAUUGCAGGAAGUAAUUGC | ||||||
| siRNA 57 | IpaC | TTGAAGAAGAAGAACAACTAATC | UUAGUUGUUCUUCUUCUUCAA | >90% threshold | 1.80 | 30.96 |
| GAAGAAGAAGAACAACUAAUC | ||||||
| siRNA 58 | IpaC | AAGAAGAAGAACAACTAATCAGT | UGAUUAGUUGUUCUUCUUCUU | <90% threshold | 1.70 | 30.963 |
| GAAGAAGAACAACUAAUCAGU |
a Combined score obtained from the results of the second-generation tools for siRNA designing, namely: i-SCORE, s-Biopredsi, Katoh, and DSIR. Free energy of self-folding and evaluation of GC content.
Designed siRNA molecules with their respective free energy of binding with target, melting temperature of siRNA–target duplex, target accessibility, functional efficiency, and immunogenicity.
| siRNA | Target Sequence | Free Energy of Binding with Target (kcal/mol) | Melting Temperature of siRNA–Target Duplex(°C) | End-Diff a | Break-Targ.∆G b | Probability of Being Efficient siRNA | siRNA Validity Score (Binary) | Immunogenicity |
|---|---|---|---|---|---|---|---|---|
| siRNA 4 | TGGTGATGTACAGGTTAACAATT | −32.6 | 79.1 | 1.76 | −1.8 | 0.951 | 0.901 | Non-immunomodulatory (IMscore:4.2) |
| siRNA 5 | ATGGAATTAGGTGCAAGAAGAAG | −32.1 | 79.8 | 0.17 | −0.1 | 0.951 | 0.95 | Non-immunomodulatory (IMscore:3.5) |
| siRNA 6 | TGGAATTAGGTGCAAGAAGAAGT | −32.5 | 78.2 | 0.17 | −0.1 | 0.951 | 0.95 | Non-immunomodulatory (IMscore:4.2) |
| siRNA 9 | GAGGAATGTTGACAAGCTTAATG | −31.8 | 78.2 | 2.33 | −1.4 | 0.961 | 0.967 | Non-immunomodulatory (IMscore:3.4) |
| siRNA 13 | GAGGATTCTGTAGTGTATCAAAC | −32.7 | 78.7 | 2.33 | −0.7 | 0.974 | 0.975 | Non-immunomodulatory (IMscore:2.6) |
| siRNA 15 | CTGCTGAAAGTCTTTCTTGTATC | −31 | 78.3 | 2.09 | −1.8 | 0.967 | 1.026 | Non-immunomodulatory (IMscore:2.7) |
| siRNA 17 | ATGAAAGACTGTGGTATTCTAAA | −30.1 | 78.9 | 0.03 | −0.9 | 0.947 | 1.026 | Non-immunomodulatory (IMscore:3.1) |
| siRNA 23 | CAGCTGATATCCCTGATAATATA | −32.4 | 79.1 | 2.09 | −0.9 | 0.96 | 0.989 | Immunomodulatory (IMscore:4.7) |
| siRNA 32 | TGGCGTCTTTCTGATATTTCAAA | −31.9 | 76.6 | 1.76 | −1.8 | 0.957 | 1.009 | Immunomodulatory (IMscore:4.8) |
| siRNA 38 | ACGAAGTTAGCTCATCAATATTA | −29.4 | 74.9 | 1.7 | −0.3 | 0.931 | 1.012 | Non-immunomodulatory (IMscore:4.0) |
| siRNA 39 | CTCCAGAAAGTCGTCAAGTATCA | −33 | 80.4 | 2.16 | −0.3 | 0.952 | 0.949 | Non-immunomodulatory (IMscore:2.8) |
| siRNA 42 | GAGATTGATGGTAGAATTGAAAT | −30.2 | 74 | 1.87 | −1 | 0.968 | 0.965 | Immunomodulatory (IMscore:5.6) |
| siRNA 46 | CACAGTATTCGGAACTAATTATA | −28.6 | 74.6 | 1.23 | −0.3 | 0.936 | 0.971 | Non-immunomodulatory (IMscore:2.2) |
| siRNA 49 | TCCGTTCTACCACACTCTATATC | −34.3 | 82 | 1.03 | −0.1 | 0.935 | 1.006 | Non-immunomodulatory (IMscore:1.1) |
| siRNA 50 | TTCAACCATACTCCAGATAATTC | −30.3 | 78.5 | 1.46 | 0 | 0.886 | 0.886 | - |
| siRNA 51 | CACCAAAGTCATTAAATGCAAGT | −29 | 76.1 | 0.13 | −0.3 | 0.818 | 0.818 | - |
| siRNA 53 | CAGTTAAAGACAGGACATTGATT | −31.3 | 78.1 | 0.79 | −1.1 | 0.926 | 0.909 | Immunomodulatory (IMscore:5.6) |
| siRNA 54 | CTCAATTGATGGCAACCTTTATT | −31 | 78 | 1.23 | −1 | 0.891 | - | - |
| siRNA 57 | TTGAAGAAGAAGAACAACTAATC | −27.8 | 76.2 | 0.33 | −0.2 | 0.906 | 0.999 | Immunomodulatory (IMscore:7.3) |
a The free energy difference between the 5′ and 3′ end of the antisense strand of siRNA. b The free energy cost for opening base pairs in the region complementary to the target.
Figure 2Secondary duplex structures between the siRNA candidates and their respective mRNA target sequences.
Validation scores for the predicted 3D structures of the 11 non-immunogenic siRNA candidates.
| siRNA | Nucleic Acid Geometry | All Atom Contacts (clashsccore, Percentile) b | Validity of Predicted 3D Structure of siRNA | |||
|---|---|---|---|---|---|---|
| Probability of Wrong Sugar Puckers a | Bad Backbone Confirmations a | Bad Bonds a | Bad Angles a | |||
| siRNA 4 | 0.00 | 0.00 | 0.00 | 0.00 | 36.81, 9th | Low |
| siRNA 5 | 0.00 | 0.00 | 0.00 | 0.00 | 30.67, 15th | Low |
| siRNA 6 | 0.00 | 0.00 | 0.00 | 0.00 | 36.81, 9th | Low |
| siRNA 9 | 0.00 | 0.00 | 0.00 | 0.00 | 19.76, 33rd | Acceptable |
| siRNA 13 | 0.00 | 0.00 | 0.00 | 0.00 | 24.1, 23rd | Low |
| siRNA 15 | 0.00 | 4.76 | 0.00 | 0.00 | 19.23, 35th | Acceptable |
| siRNA 17 | 0.00 | 0.00 | 0.00 | 0.00 | 19.61, 34th | Acceptable |
| siRNA 38 | 4.76 | 57.14 | 0.00 | 0.00 | 22.52, 26th | Low |
| siRNA 39 | 0.00 | 0.00 | 0.00 | 0.00 | 22.46, 26th | Low |
| siRNA 46 | 0.00 | 0.00 | 0.00 | 0.00 | 29.76, 16th | Low |
| siRNA 49 | 0.00 | 28.57 | 0.00 | 0.00 | 19.03, 35th | Low |
a 5% threshold is allowed for acceptance of the criteria for a valid 3D structure. 100th percentile is the best among the structures for a comparable resolution; 0th percentile ranks to be the worst. b Clashscore is the parameter that represents a comparable resolution.
Figure 3Tertiary structures of siRNA 9, siRNA 15, and siRNA 17. The validity of the tertiary structures of these siRNAs had been classified as “acceptable” on the basis of the analyzed criteria for nucleic acid geometry.