| Literature DB >> 35335192 |
Łukasz Kaczorowski1, Jolanta Powierska-Czarny1, Łukasz Wolko2, Agnieszka Piotrowska-Cyplik3, Paweł Cyplik4, Jakub Czarny1.
Abstract
Mastitis is the most expensive disease of dairy cattle across the world and is the main reason for the use of antibiotics in animal husbandry. The aim of this study was to analyze the microbiome of raw milk obtained from a semi-subsistence farm located in the Kuyavian-Pomeranian Voivodeship in Poland. Milk from healthy cows and from cows with subclinical mastitis was analyzed. The following pathogenic bacteria were found in milk from individuals with subclinical mastitis: Escherichia coli or Streptococcus agalactiae. The composition of drinking milk was assessed on the basis of 16S rRNA gene sequencing using the Ion Torrent platform. Based on the conducted research, significant changes in the composition of the milk microbiome were found depending on the physiological state of the cows. The microbiome of milk from healthy cows differed significantly from the milk from cows with subclinical mastitis. Two phyla dominated in the milk from healthy cows: Firmicutes and Proteobacteria, in equal amounts. On the contrary, in the milk from cows with diagnosed subclinical mastitis, one of the types dominated: either Firmicutes or Proteobacteria, and was largely predominant. Moreover, the milk microflora from the ill animals were characterized by lower values of the determined biodiversity indicators than the milk from healthy cows. The presence of pathogenic bacteria in the milk resulted in a significant reduction in the share of lactic acid bacteria in the structure of the population of microorganisms, which are of great importance in the production technology of regional products.Entities:
Keywords: lactic acid bacteria; mastitis; microbiome; milk
Mesh:
Substances:
Year: 2022 PMID: 35335192 PMCID: PMC8950352 DOI: 10.3390/molecules27061829
Source DB: PubMed Journal: Molecules ISSN: 1420-3049 Impact factor: 4.411
Basic characteristics and classifications of the milk samples (coded) included in this study.
| Milk Samples | Identified Bacteria | SSC 1 < 225,000 | 225,000 < SSC < 400,000 |
|---|---|---|---|
|
| Negative | Positive (M1–M15) | |
|
| Negative | Positive (E1–E16) | |
| - | H1–H24 | - |
1 Cells/mL.
Figure 1The relative abundance of bacterial phyla in milk from healthy cows and cows with subclinical mastitis.
Figure 2The relative abundance of bacterial genera in the milk from healthy cows and cows with subclinical mastitis.
Analysis of the alpha-biodiversity of the bacteria present in the analyzed milk samples.
| Healthy Milk | |||
|---|---|---|---|
| OUT number | 5319 ± 96 | 4239 ± 102 | 3987 ± 156 |
| Chao 1 | 5498 ± 82 | 4519 ± 52 | 4019 ± 69 |
| Shannon index | 7.98 ± 0.54 | 6.81 ± 0.19 | 6.51 ± 0.38 |
| Phylogenetic diversity | 10.11 ± 0.52 | 8.54 ± 0.39 | 7.85 ± 0.68 |
Also shown is the significance between the parameters determined by ANOVA (p, F).
Figure 3Principal coordinate analysis (PCoA) based on the Bray–Curtis index of bacterial metapopulations in milk (raw data). H1–H24, healthy milk; M1–M15, subclinical mastitis milk with S. agalactiae; E1–E16, subclinical mastitis milk with E. coli.
Figure 4Venn diagram of the microorganisms shared among the milk metagenome. H, healthy milk; M, S. agalactiae subclinical mastitis milk; E, E. coli subclinical mastitis milk.
Primers and probes for quantitative real time PCR.
| Microorganism | Gene | Sequences of Primers and Probes | |
|---|---|---|---|
|
| uidA | Forward primer (5′–3′) | GTGTGATATCTACCCGCTTCGC |
|
| cfb | Forward primer (5′–3′) | AGCTGTATTAGAAGTACATGCT |
|
| Forward primer (5′–3′) | CGGAGTAATCCTTCTGCTCACAGT | |