| Literature DB >> 35333906 |
Bandik Föh1,2, Jana Sophia Buhre1, Hanna B Lunding1, Maria E Moreno-Fernandez3, Peter König4, Christian Sina1,2, Senad Divanovic3,5,6, Marc Ehlers1,7.
Abstract
The microbially-derived short-chain fatty acid butyrate is a central inhibitor of inflammatory innate and adaptive immune responses. Emerging evidence suggests that butyrate induces differentiation of IL-10-producing (IL-10+) regulatory B cells. However, the underlying mechanisms of butyrate-driven modulation of B cell differentiation are not fully defined. Given the dominant role of regulatory plasma cells (PCs) as the main source of anti-inflammatory cytokines including IL-10 and the observation that butyrate also induces the differentiation of PCs, we here investigated the effect of the microbial metabolite butyrate on the induction of regulatory IL-10+ PCs and underlying mechanisms. Here we show that butyrate induces the differentiation of IL-10+IgM+ PCs. Ex vivo, butyrate, but hardly propionate, another microbially-derived short-chain fatty acid, induced the differentiation of IL-10+IgM+ CD138high PCs from isolated splenic murine B cells. In vivo, administration of butyrate via drinking water or by daily intraperitoneal injection increased the number of IL-10+IgM+ CD138high PCs in the spleens of Ovalbumin (Ova)/complete Freund's adjuvant-immunized mice. The induction of these regulatory PCs was associated with an increase of anti-Ova IgM, but a reduction of anti-Ova class-switched pathogenic IgG2b serum antibodies. Based on the knowledge that butyrate inhibits histone deacetylases (HDACs) thereby increasing histone acetylation, we identified here that HDAC3 inhibition was sufficient to induce PC differentiation and IL-10+ expression. Furthermore, reduced mitochondrial superoxide levels following butyrate treatment and HDAC3 inhibition were necessary for PC differentiation, but not IL-10 expression. In summary, the microbial metabolite butyrate promotes the differentiation of IgM+ PCs and their expression of IL-10. HDAC3 inhibition may be involved as an underlying pathway for both PC differentiation and IL-10 expression, while reduced mitochondrial superoxide levels are crucial only for PC differentiation. The induction of regulatory IL-10+IgM+ PCs and the inhibition of class switching to antigen-specific pathogenic IgG subclasses might represent important pathways of butyrate to limit inflammation.Entities:
Mesh:
Substances:
Year: 2022 PMID: 35333906 PMCID: PMC8956175 DOI: 10.1371/journal.pone.0266071
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
qRT-PCR primers.
Gene targets, forward and reverse RT-PCR primer sequences, and product lengths.
| Gene target | Primer sequence (5’-3’) | Product length | |
|---|---|---|---|
|
| forward |
| 382 bp |
| reverse |
| ||
|
| forward |
| 237 bp |
| reverse |
| ||
|
| forward |
| 427 bp |
| reverse |
| ||
|
| forward |
| 217 bp |
| reverse |
| ||
|
| forward |
| 277 bp |
| reverse |
| ||
|
| forward |
| 468 bp |
| reverse |
| ||
|
| forward |
| 388 bp |
| reverse |
| ||
|
| forward |
| 465 bp |
| reverse |
| ||
|
| forward | ACCAACTATTGCTTCAGCTCC | 275 bp |
| reverse |
| ||
|
| forward |
| 171 bp |
| reverse |
|
*bp: base pair.