Literature DB >> 35333897

Role of sphingosine kinase and sphingosine-1-phosphate receptor in the liver pathology of mice infected with Plasmodium berghei ANKA.

Tachpon Techarang1, Pitchanee Jariyapong1, Chuchard Punsawad1,2.   

Abstract

Decreased serum sphingosine 1-phosphate (S1P) has been reported in severe malaria patients, but the expression of receptors and enzymes associated with S1P has not been investigated in the liver of malaria patients. Therefore, this study aimed to investigate the expression of sphingosine kinase (SphK) and S1P receptors (S1PRs) in the liver of malaria-infected mice. C57BL/6 male mice were divided into a control group (n = 10) and a Plasmodium berghei (PbA)-infected group (n = 10). Mice in the malaria group were intraperitoneally injected with 1×106 P. berghei ANKA-infected red blood cells, whereas control mice were intraperitoneally injected with normal saline. Liver tissues were collected on Day 13 of the experiment to evaluate histopathological changes by hematoxylin and eosin staining and to investigate SphK and S1PR expression by immunohistochemistry and real-time PCR. Histological examination of liver tissues from the PbA-infected group revealed sinusoidal dilatation, hemozoin deposition, portal tract inflammation and apoptotic hepatocytes, which were absent in the control group. Immunohistochemical staining showed significant increases in the expression of SphK1 and SphK2 and significant decreases in the expression of S1PR1, S1PR2, and S1PR3 in the endothelium, hepatocytes, and Kupffer cells in liver tissue from the PbA-infected group compared with the control group. Real-time PCR analysis showed the upregulation of SphK1 and the downregulation of S1PR1, S1PR2, and S1PR3 in the liver in the PbA-infected group compared with the control group. In conclusion, this study demonstrates for the first time that SphK1 mRNA expression is upregulated and that S1PR1, S1PR2, and S1PR3 expression is decreased in the liver tissue of PbA-infected mice. Our findings suggest that the decreased levels of S1PR1, S1PR2, and S1PR3 might play an important role in liver injury during malaria infection.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35333897      PMCID: PMC8956183          DOI: 10.1371/journal.pone.0266055

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Malaria is a life-threatening infectious disease caused by Plasmodium parasites that remains a cause of morbidity and mortality in humans; there were 229 million clinical cases in 2019 and 409,000 deaths worldwide, of which 67% were children under 5 years of age [1]. Plasmodium parasites are typically transmitted to humans by the bite of an infected female Anopheles mosquito. Plasmodium parasites travel to the liver, where they mature and reproduce [2]. There are several severe complications of malaria, such as cerebral malaria, acute lung injury/acute respiratory distress syndrome, acute kidney injury, hypoglycemia, lactic acidosis, severe anemia and acute liver failure [3]. The liver is the first important organ affected during the hepatic stage of infection and is the site in which malaria sporozoites develop into merozoites. Protozoan parasites damage hepatocytes in all stages of the malaria parasite life cycle, especially in the hepatic stage [4]. In addition, liver damage may be caused by the binding of infected red blood cells to endothelial cells, leading to the obstruction of hepatic sinusoids and intrahepatic blood flow. It has been reported that histopathological changes in liver tissue during malaria infection are characterized by Kupffer cell hyperplasia, abundant hemozoin pigment in hyperplastic Kupffer cells and hepatocytes, inflammatory cell infiltration in the portal tract, (especially neutrophils and monocytes), fatty liver changes, liver fibrosis, cholestasis, bile stasis, granulomatous lesions and malarial nodules [4-6]. Sphingosine 1-phosphate (S1P) is a lysophospholipid mediator that can stimulate a wide variety of intracellular and extracellular responses, such as cell proliferation, differentiation, migration, contraction, and survival, as well as the immune response [7-10]. S1P is released after the phosphorylation of sphingosine by sphingosine kinase (SphK) [11]. Indeed, previous studies revealed that S1P signaling is mediated by a family of five high-affinity G protein-coupled receptors, including S1PR1, S1PR2, S1PR3, S1PR4, and S1PR5 [11-13]. However, only three receptors for S1P are expressed in the liver: S1PR1, S1PR2, and S1PR3. SphKs and S1PRs have been shown to have novel therapeutic potential in the treatment of cancer, gastrointestinal disease, obesity, and diabetes mellitus and its associated complications [9, 10, 14, 15]. In addition, the overexpression of SphK1 in macrophages conferred resistance to mycobacterial infection [16]. In the context of malaria, a recent investigation showed reduced serum levels of S1P in patients with severe malaria [17, 18]. Therefore, we hypothesized that SphK/S1PR plays a role in the severity of malaria and liver damage. However, there have been no reports on the expression of receptors and enzymes associated with S1P in the liver in the context of malaria. Therefore, this study aimed to investigate histopathological changes and the expression of SphKs (SphK1 and SphK2) and S1P receptors (S1PR1, S1PR2, and S1PR3) in the liver tissue of malaria-infected mice compared with control mice. Understanding the pathophysiological role of the receptors and enzymes associated with S1P may provide new insights into malaria pathogenesis and new therapeutic options for the treatment of malaria infection.

Methods

Ethics statement

This study protocol was reviewed and approved by the Animal Ethics Committee of Walailak University (Clearance no. 007/2018). All protocols in this study were conducted in accordance with the relevant guidelines and regulations for using animals in compliance with Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. Animals were anesthetized with pentobarbital to minimize pain and suffering.

Animal preparation and experimental protocols

Male C57BL/6 mice (6–10 weeks old) were purchased from Nomura Siam International Co., Ltd. (Bangkok, Thailand). The mice were housed at 22–24°C in standard polycarbonate cages (5 animals per cage) on wood-shaving bedding with free access to food and fresh water and a standard 12 h light/dark cycle. Plasmodium berghei ANKA was obtained from BEI Resources (NIAID, NIH: P. berghei, Strain ANKA, MRA-311) and was contributed by Thomas F. McCutchan. Donor mice were inoculated with P. berghei ANKA-infected red blood cells, and blood was collected via cardiac puncture into a heparinized vacutainer tube for the induction of malaria in experimental mice [19]. For the malaria-infected group, the mice were intraperitoneally infected with 1×106 Plasmodium berghei ANKA (PbA)-infected red blood cells as previously described [20, 21]. Control mice were intraperitoneally administered 200 μl of saline. After infection, parasitemia levels were monitored daily using Giemsa-stained peripheral blood smears. On the 13th day after infection (DAI), the mice were sacrificed under anesthesia with an intraperitoneal injection of pentobarbital (60 mg/kg body weight) to minimize suffering. After opening the abdominal cavity, liver tissues were collected immediately for histopathological, immunohistochemical and real-time PCR analyses. Finally, the mice were intraperitoneally injected with an overdose of pentobarbital (150 mg/kg) for euthanasia.

Histopathological examination

Liver tissues were fixed in 10% formalin for 24–48 h, embedded in paraffin, sectioned (5 μm thickness) and stained with hematoxylin and eosin as previously described [22]. For histological assessments, alterations in four histological parameters (sinusoidal dilatation, hemozoin deposition, portal tract inflammation and apoptotic hepatocytes) were assessed under a light microscope at high magnification (400×) by two expert pathologists. Based on a previous study with modifications [4], the severity of each parameter was graded using a semiquantitative scoring system, as shown in Table 1. The total histological score was calculated as the sum of the scores for each of the four histological parameters and ranged from 0 to 12 points.
Table 1

Grading system for four main histological features to assess the severity of liver injury.

ParametersGrading score
0123
Sinusoidal dilatationNo dilatationMild dilatationModerate dilatationSevere dilatation
Hemozoin depositionNo depositionMild depositionModerate depositionSevere deposition
Portal tract inflammation< 5% of portal tract area5–15% of portal tract area16–30% of portal tract area> 30% of portal tract area
Hepatocyte apoptosisNo apoptosisMild apoptosisModerate apoptosisSevere apoptosis

Immunohistochemistry

Formalin-fixed, paraffin-embedded (FFPE) sections of liver tissue were deparaffinized in xylene and rehydrated in a series of ethanol solutions. FFPE tissue sections were incubated in 3% hydrogen peroxide to quench endogenous peroxidase activity. To improve antigen retrieval, the sections were incubated in Vector Antigen Unmasking Solution (Vector Laboratories Inc., USA) according to the manufacturer’s instructions. After being washed in Tris-buffered saline (TBS), the sections were blocked for 30 min in normal goat serum in TBS. FFPE tissue sections were further incubated for 1 h at room temperature with rabbit polyclonal antibodies against SphK1 or SphK2 (1:200; Ab71700 and Ab264042, Abcam, UK) or S1PR1, S1PR2 or S1PR3 (1:200; sc-25489, Santa Cruz Biotechnology, Inc., USA), followed by a 30 min incubation with diluted biotinylated secondary antibodies and a 30 min incubation with VECTASTAIN ABC Reagent (Vector Laboratories Inc., USA). Then, all FFPE tissue sections were incubated in DAB reagent (brown chromogen staining; Vector Laboratories Inc., USA), counterstained with hematoxylin, rehydrated, and mounted for light microscopy analysis. Negative controls were prepared in the same manner but without primary antibodies. To evaluate the expression of SphKs (SphK1 and SphK2) and S1P receptors (S1PR1, S1PR2 and S1PR3), the number of positive cells and the intensity of staining in 10 randomly selected microscopic fields of each immunostained section were determined at high magnification (400×). The expression of each protein was separately examined in endothelial cells, hepatocytes, and Kupffer cells. The percentage of positively stained cells for each protein marker was calculated by dividing the number of positive cells by the total cell count and multiplying this number by 100. The staining intensity was subjectively scored as follows: 0 = no staining, 1 = weakly positive, 2 = moderately positive, and 3 = strongly positive. Finally, the total score (TS) was calculated by multiplying the percentage of positive cells (%) and staining intensity (I), according to a previous study [23].

Real-time polymerase chain reaction (real-time PCR)

SphK and S1PR mRNA levels in liver tissue in the control and PbA-infected groups were measured by quantitative real-time PCR. RNA was extracted using TriPure isolation reagent (Roche, Mannheim, Germany) according to the manufacturer’s instructions. First strand cDNA was generated using an iScript™ cDNA Synthesis Kit (Bio–Rad, Philadelphia, PA). The reaction was incubated at 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. cDNA (50 ng) from each sample was subsequently amplified using gene-specific primer sets (). The thermal conditions consisted of initial denaturation at 94°C for 10 s, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and elongation at 72°C for 30 s, and a final elongation step at 72°C for 5 min. The relative expression of target genes was determined using the 2−ΔΔCt method and beta-actin as a comparator.

Statistical analysis

Statistical analysis was performed using IBM SPSS version 23.0 (SPSS, IL, USA). The normality of distribution was tested with the Kolmogorov–Smirnov test. Differences between groups (malaria-infected and control groups) were analyzed by a nonparametric Mann–Whitney U test. A p value < 0.05 was considered to indicate statistical significance.

Results

Histopathological analysis of liver tissues from the PbA-infected group (Fig 1A and 1C) showed sinusoidal dilatation, hemozoin deposition, portal tract inflammation and hepatocyte apoptosis compared to those in the control group (Fig 1B and 1C). Semiquantitative analysis demonstrated that the mean scores of all histological parameters were significantly higher in the PbA-infected group than in the control group (all p < 0.05) (Table 3). The histopathological change with the highest mean was hemozoin deposition (2.64 ± 0.13), followed by portal tract inflammation (1.40 ± 0.09).
Fig 1

Histopathological changes in liver tissues from control (A) and PbA-infected mice (B). The histomorphological changes in PbA-infected mice include hemozoin deposition (indicated by yellow arrowheads) and apoptotic hepatocytes (indicated by black asterisks) around the central vein. Central vein (CV); Portal tract (PT). All images are shown at 200× magnification. Scale bar = 100 μm.

Table 3

Mean scores of four main histological features in tissues from the control (n = 10) and PbA-infected groups (n = 10).

ParametersScore (Mean ± SD)
Control groupPbA-infected group
Sinusoidal dilatation0.12 ± 0.141.56 ± 0.13*
Hemozoin deposition0.00 ± 0.002.64 ± 0.13*
Portal tract inflammation0.10 ± 0.102.20 ± 0.09*
Hepatocyte apoptosis0.22 ± 0.111.40 ± 0.09*
Total score0.11 ± 0.091.95 ± 0.57*

*p < 0.05 compared with the control group.

Histopathological changes in liver tissues from control (A) and PbA-infected mice (B). The histomorphological changes in PbA-infected mice include hemozoin deposition (indicated by yellow arrowheads) and apoptotic hepatocytes (indicated by black asterisks) around the central vein. Central vein (CV); Portal tract (PT). All images are shown at 200× magnification. Scale bar = 100 μm. *p < 0.05 compared with the control group.

SphK and S1PR expression as indicated by immunohistochemical staining

Immunohistochemical analysis of SphK and S1PR expression in liver tissues from control and PbA-infected mice is shown in Fig 2. Positive staining is indicated by brown. The number of positively stained cells and the staining intensity for each protein were independently examined in each individual cell type, including endothelial, epithelial, and Kupffer cells. The mean TS for SphK1 and SphK2 expression was significantly increased in endothelial cells, hepatocytes, and Kupffer cells in liver tissue from PbA-infected mice compared with control mice (p < 0.05). However, the mean TS for S1PR1, S1PR2, and S1PR3 was significantly decreased in endothelial cells, hepatocytes, and Kupffer cells in liver tissue from PbA-infected mice compared with control mice (p < 0.05) (Table 4).
Fig 2

Immunoperoxidase staining for SphK and S1PR in liver tissues from control (A, C, E, G, I) and PbA-infected mice (B, D, F, H, J). Hepatocytes (H), Kupffer cells (K), sinusoids (S), and central veins (CVs). All images are shown at 200× magnification. Scale bar = 50 μm.

Table 4

Mean TS for S1PR and SphK expression in liver tissues from the control (n = 10) and PbA-infected (n = 10) groups.

MarkerGroupEndotheliumHepatocyteKupffer cell
SphK1Control48.80 ± 5.7972.70 ± 6.7124.70 ± 2.29
PbA-infected90.90 ± 9.14*141.00 ± 10.62*58.80 ± 7.16*
SphK2Control35.20 ± 3.9762.10 ± 6.5232.30 ± 3.80
PbA-infected52.30 ± 6.56*117.80 ± 10.04*60.50 ± 3.04*
S1PR1Control123.80 ± 9.54196.20 ± 12.7827.30 ± 1.94
PbA-infected47.30 ± 3.71*95.80 ± 11.00*68.40 ± 8.03*
S1PR2Control158.90 ± 14.13221.90 ± 15.0825.40 ± 2.41
PbA-infected50.70 ± 5.57*115.40 ± 11.58*70.60 ± 7.12*
S1PR3Control91.40 ± 11.11142.10 ± 12.8227.80 ± 2.84
PbA-infected44.40 ± 3.60*72.90 ± 8.81*56.30 ± 7.05*

*p < 0.05 compared with the control group.

Immunoperoxidase staining for SphK and S1PR in liver tissues from control (A, C, E, G, I) and PbA-infected mice (B, D, F, H, J). Hepatocytes (H), Kupffer cells (K), sinusoids (S), and central veins (CVs). All images are shown at 200× magnification. Scale bar = 50 μm. *p < 0.05 compared with the control group.

SphK and S1PR mRNA levels as determined by real-time PCR

The expression of genes encoding enzymes and receptors associated with S31P in liver tissues from control and PbA-infected mice was investigated by real-time PCR (Fig 3). The expression of enzymes responsible for regulating the concentration of S1P, including SphK1 and SphK2, was measured in liver tissue from PbA-infected mice. Our results showed that SphK1 mRNA levels were upregulated approximately 0.5-fold in liver tissue from PbA-infected mice, whereas SphK2 mRNA levels did not change (Fig 3A). In addition, S1PR1 and S1PR2 mRNA levels were decreased in liver tissue from PbA-infected mice compared to control mice, whereas S1PR3 mRNA levels were significantly decreased compared to those in the control group (Fig 3B).
Fig 3

Relative SphK and S1PR mRNA expression as measured by real-time PCR.

Data are presented as the mean ± SD of triplicate experiments. *p < 0.05 compared with the control group.

Relative SphK and S1PR mRNA expression as measured by real-time PCR.

Data are presented as the mean ± SD of triplicate experiments. *p < 0.05 compared with the control group.

Discussion

The liver is one of the organs in which infected red blood cells preferentially accumulate to avoid immune system surveillance inside the spleen, and infected red blood cell sequestration within the liver endothelium is now emerging as another factor that promotes liver damage [26-28]. In the present study, histopathological examination demonstrated that liver tissues from PbA-infected mice exhibited sinusoidal dilatation, hemozoin deposition, portal tract inflammation and hepatocyte apoptosis. These findings are consistent with previous studies showing evidence of portal tract inflammation and hemozoin pigment deposition in liver tissue from patients with severe P. falciparum malaria and hyperbilirubinemia [4] and from C57BL/6 mice infected with PbA [29], indicating that this murine model could be a potential resource for investigating the pathological mechanisms of liver damage caused by malaria infection. S1P is a bioactive sphingolipid mediator that functions intracellularly as a second messenger and extracellularly as a ligand for specific G protein-coupled receptors [11-13], affecting processes such as cell proliferation, differentiation, migration, contraction, and survival, as well as inflammation [7-10]. In the context of malaria, protozoan parasite infection can induce the release of proinflammatory cytokines and chemokines, resulting in parasite destruction and an inflammatory response [30, 31]. Our previous study reported that serum S1P concentrations were decreased in malaria patients infected with P. vivax and P. falciparum and that low levels of S1P were associated with the severity of malaria [18]. However, there have been no reports on the expression of SphK or S1PR in the liver during malaria infection. Herein, we investigated the expression of SphKs (SphK1 and 2) and S1PRs (S1PR1, 2, and 3) in liver tissue from mice infected with PbA. The present study demonstrated SphK and S1PR expression based on positive immunohistochemical staining in three liver cell types, including endothelial cells, hepatocytes, and Kupffer cells. Compared with control mice, PbA-infected mice showed a significant increase in the number of cells that were positively stained for both SphK1 and SphK2 and a significant decrease in the expression of all S1PRs in all cell types in liver tissue. Normally, S1P is located in both intra- and extracellular regions [32]. This protein is exported from cells via transporters such as spinster homolog 2 (Spns2) on the endothelial surface to maintain circulating S1P concentrations [32-34]. S1P is released into the extracellular space after the phosphorylation of sphingosine by SphKs. Therefore, the mRNA expression of receptors and enzymes responsible for S1P signaling was also investigated. The present study revealed that the mRNA expression of S1PRs, especially S1PR3, was downregulated, whereas only SphK1 mRNA was significantly upregulated in PbA-infected mice compared with control mice. These findings suggest the following. 1) When infected red blood cells rupture during parasite growth and differentiation [2], an important source of circulating S1P is needed due to a lack of cellular organelles [32, 35, 36], and S1P is released into the circulatory system. This protein can bind to plasma components such as high-density lipoprotein (HDL), low-density lipoprotein (LDL), and albumin [37] and thereby decrease S1P activity to stimulate S1PRs on the cell surface, leading to decreases in S1PR activation and expression. 2) Circulating S1P can induce apoptosis through G protein-coupled receptors on the cell surface via caspase-3 [38]. This signaling stimulates the production of inflammatory mediators, the expression of ICAM-1 and VCAM-1 on the cell surface, and the release of Weibel–Palade bodies, which are organelles in endothelial cells that store various proteins involved in inflammation, resulting in an inflammatory response and cell apoptosis [38-40]. 3) The inflammatory response to protozoan parasite infection and hemozoin, a waste product of hemoglobin digestion by the Plasmodium parasite, induces leucocyte accumulation. This accumulation leads to the secretion of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-α), transforming growth factor beta (TGF-β), interferon gamma (IFN-γ), interleukin-1 (IL-1), and IL-6 [41-43]. Some cytokines stimulate SphK1 activation, followed by the activation of RAS [44] and ERK1/2 and the transcription of NF-κB [45], resulting in inflammation. The inflammatory response to malaria destroys the Plasmodium parasite, but negative effects also occur, including cell membrane damage, especially in endothelial cells. Therefore, the expression of S1PRs on the cell surface was dramatically decreased in response to cell injury or cell death. This result suggested that S1PRs can be downregulated by cell injury, which might be stimulated by proinflammatory cytokines. In addition, the current study demonstrated an increase in SphK1 in malaria-infected mice, which was consistent with previous reports on inflammatory conditions and cancer [9, 14, 15, 46–48]. This finding may stem from inflammation-induced apoptosis. The potential role of SphK1 expression in this model might be the consequence of malaria infection. After malaria infection, the parasites travel to the liver, where they replicate to generate many schizonts in hepatocytes. This situation induces hepatocyte rupture, followed by merozoite release into circulation [2]. In addition, these merozoites can infect red blood cells, where they replicate and develop into the sexual form [2]. As a result, immunological responses are triggered, including the release of proinflammatory cytokines and white blood cell accumulation [30, 49, 50]. TNF-α and other proinflammatory cytokines (IL-1 and IL-6) have been shown to activate SphK1, leading to increased S1P synthesis and release [14]. Cytoplasmic S1P can be irreversibly degraded into ethanolamine phosphate and hexadecenal by the intracellular protein sphingosine phosphate lyase [51]. The hexadecenal molecule can form adducts with proteins, lipids, and DNA and inhibit histone deacetylases (HDACs) in the nucleus, thereby further promoting inflammatory responses in the cytoplasm [14]. In response to inflammation, proinflammatory cytokines stimulate sphingomyelin hydrolysis by alkaline sphingomyelinase [14]. This action initiates ceramide production from hepatocyte membranes. The increase in ceramide in hepatocytes leads to oxidative stress, proinflammatory cytokine secretion, and hepatocyte apoptosis [52]. Therefore, these proinflammatory cytokines can stimulate hepatocyte apoptosis, resulting in a decrease in S1PRs during SphK1 expression in malaria (Fig 4). In addition, SphK2 evokes apoptotic signaling by promoting the local production of S1P [10]. Alternately, the binding of released S1P and S1PRs initiates various intracellular downstream signaling pathways, such as the NF-κB, ERK1/2, and Rac/PLC pathways, which can induce cell survival, proliferation, and migration [10, 14]. A previous study reported that apoptosis stimulated SphK1 expression in Jurkat T cells and U937 monocytes [53]. In a final attempt to prevent cell death, a cell might increase the levels of SphK1 and S1P, which are survival mediators. In addition, the activation of intracellular SphK1 has been reported to protect pulmonary vascular endothelial cells during LPS-mediated inflammation in vivo [54]. This result suggested that SphK1 might play an important role in preventing cell injury under inflammatory conditions. Further studies should focus on the mechanism of SphK and S1PR signaling during liver injury caused by malaria infection.
Fig 4

A schematic illustration of SphK/S1PR signaling during malaria infection.

Plasmodium parasite-infected red blood cells induce the accumulation of macrophages, neutrophils, and monocytes, which further initiates the release of proinflammatory cytokines such as TNF-α, IL-1, and IL-6. These proinflammatory cytokines, especially TNF-α, bind to specific receptors on the cell membrane, which can activate sphingomyelin hydrolysis. Next, ceramide can be hydrolyzed to sphingosine by neutral ceramidase. Then, SphKs phosphorylate sphingosine to generate S1P, which directly induces NF-κB activation and translocates to the extracellular space, where it can bind S1PRs and stimulate intracellular downstream signaling, resulting in inflammation and cell survival, proliferation, and migration. In addition, S1P can be degraded into ethanolamine phosphate and hexadecenal; in particular, hexadecenal can stimulate further inflammation in the cytoplasm.

A schematic illustration of SphK/S1PR signaling during malaria infection.

Plasmodium parasite-infected red blood cells induce the accumulation of macrophages, neutrophils, and monocytes, which further initiates the release of proinflammatory cytokines such as TNF-α, IL-1, and IL-6. These proinflammatory cytokines, especially TNF-α, bind to specific receptors on the cell membrane, which can activate sphingomyelin hydrolysis. Next, ceramide can be hydrolyzed to sphingosine by neutral ceramidase. Then, SphKs phosphorylate sphingosine to generate S1P, which directly induces NF-κB activation and translocates to the extracellular space, where it can bind S1PRs and stimulate intracellular downstream signaling, resulting in inflammation and cell survival, proliferation, and migration. In addition, S1P can be degraded into ethanolamine phosphate and hexadecenal; in particular, hexadecenal can stimulate further inflammation in the cytoplasm. Some limitations of this study should be noted. The duration of SphK and S1PR changes during malaria infection could not be determined. Therefore, further kinetic studies on SphK and S1PR expression are required to characterize the time-dependent expression of these proteins. Second, the protein levels of SphKs in this animal model were not assessed. Thus, these protein levels should be monitored in future experiments.

Conclusion

The present study indicated that liver tissue from malaria-infected mice has decreased expression of S1PR1, S1PR2, and S1PR3 and increased expression of SphK1. These findings suggest that alterations in S1PR1, S1PR2, S1PR3 and SphK1 are involved in the inflammatory response and apoptosis and play important roles in the pathogenesis of malaria in the liver. 22 Dec 2021
PONE-D-21-35173
Role of sphingosine kinase and sphingosine-1-phosphate receptor on liver pathology in mice infected with Plasmodium berghei ANKA
PLOS ONE Dear Dr. Punsawad, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Feb 04 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Olga A Sukocheva, PhD Academic Editor PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2.  To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on methods of sacrifice. 3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 4. Thank you for stating the following in the Funding Section of your manuscript: (This work was partially supported by Walailak University, Thailand. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.) We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: (NO) Please include your amended statements within your cover letter; we will change the online submission form on your behalf. Additional Editor Comments: Sound study with interesting findings. However, Introduction and Discussion section should be improved; reference list should be extended and present recent relevant reviews in the field of Sphingosine kinase signaling role during activation of inflammation. All Reviewers' suggestions should be addressed. Immunohistopathology images with higher resolution or magnification should be presented. Suggested/ potential S1P-receptor -targeting agents/or other methods for malaria treatment should be indicated in the Discussion section. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript is interesting; however, there are a few issues that need to be corrected before the manuscript is considered for publication. 1. The main issue is with animal experiment execution. Why were control mice not injected with red blood cells but just saline? This is not a proper control as authors introduce additional variables! 2. The method of erythrocyte isolation, infection, etc., has not been described (and is not included in any of the referenced papers). Moreover, one of the referenced manuscripts on page 96 is a case study of an infected patient and does not include any animal experiment. What is the rationale for referencing it here? 3. Not all abbreviations are adequately explained (e.g., line 110) – please correct. 4. Figure 2 is of low quality, and it is impossible to evaluate the staining results. 5. More appropriate for expression data would be boxplot and not the histogram. Also, Figure 3 is incorrectly referenced in the text as Figure 2. 6. Line 208: Authors contradict themselves. First, they write that there are differences in mRNA level of SphK1, to add later that it did not change… Moreover, S1PR1 and S1PR2 mRNA expression are lower only by 30-40% when compared with appropriate controls, so it is not a 3-fold difference. Not to mention, these results are not statistically significant due to high variability between individual animals. 7. Line 251. Downregulation of mRNA expression was only shown for S1PR3, so writing that it affects all investigated receptors is an overstatement. 8. It is not unusual to not see differences at the mRNA level but notice the differences at the protein level (and vice versa), and authors should discuss this in their discussion. Moreover, it would be beneficial for the readers if possible explanation or more detailed information about receptors processing/degradation could be included in the discussion. Reviewer #2: The study tested levels of SphK1 mRNA expression in liver tissues of mice infected with malaria pathogens. Authors also found that S1PR1, S1PR2, and S1PR3 expressions are decreased in the liver tissue of Plasmodium berghei-infected mice. Data suggests that the decreased levels of S1PR1, S1PR2, and S1PR3 may be involved in liver injury during malaria infection. The study is very interesting. However, there are several issues to address. The manuscript should be improved/amended. 1. Text requires proper English language editing. 2. Figure 2 resolution is poor. Author should provide images with higher magnification and/or better resolution. 3. Introduction/discussion section sections do not provide enough information; several important citations are missing. Role of SPhK in the infection resolution should be covered in more details ( see these reviews: https://pubmed.ncbi.nlm.nih.gov/31863815/ ; https://pubmed.ncbi.nlm.nih.gov/28075451/ https://pubmed.ncbi.nlm.nih.gov/29385066/ 4. Was SphK1 protein level measured/compared? Authors should discuss SPhK1 protein expression and mechanisms of its regulation considering the activation of receptor degradation during inflammation. 5. S1P receptors intracellular processing was not discussed ( see this report https://pubmed.ncbi.nlm.nih.gov/23142484/) 6. The manuscript will benefit if authors include schematic signaling pathway for SPhK/S1P receptor signalling in the infected/normal liver. 7. Study limitations section should be extended. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 3 Mar 2022 POINT-BY-POINT RESPONSES TO THE REVIEWERS’ COMMENTS Additional Editor Comments: Sound study with interesting findings. However, Introduction and Discussion section should be improved; reference list should be extended and present recent relevant reviews in the field of Sphingosine kinase signaling role during activation of inflammation. All Reviewers' suggestions should be addressed. Immunohistopathology images with higher resolution or magnification should be presented. Suggested/ potential S1P-receptor -targeting agents/or other methods for malaria treatment should be indicated in the Discussion section. Response: We has been revised as suggested. Review Comments Reviewer #1: The manuscript is interesting; however, there are a few issues that need to be corrected before the manuscript is considered for publication. 1. The main issue is with animal experiment execution. Why were control mice not injected with red blood cells but just saline? This is not a proper control as authors introduce additional variables! Response: In the animal model, Plasmodium berghei ANKA-infected red blood cells were diluted to 1×106 cells/ml with saline solution as a diluent before intraperitoneal injection [1]. Therefore, the control mice were injected with the same volume of diluent (saline solution). 2. The method of erythrocyte isolation, infection, etc., has not been described (and is not included in any of the referenced papers). Moreover, one of the referenced manuscripts on page 96 is a case study of an infected patient and does not include any animal experiment. What is the rationale for referencing it here? Response: We apologize for our mistake regarding the reference. In response to this comment, the reference was changed, and malaria parasite inoculation and infected red blood cell collection were described in more detail. Please see page 5, lines 96-100. 3. Not all abbreviations are adequately explained (e.g., line 110) – please correct. Response: Thank you for this valuable suggestion. This abbreviation refers to the names and surnames of two expert pathologists. In response to this comment and to avoid confusion, the abbreviations have been deleted. Please see page 6, line 114. 4. Figure 2 is of low quality, and it is impossible to evaluate the staining results. Response: Figure 2 has been revised as suggested. The new image has a resolution of 600 dpi. Please see the attached file. 5. More appropriate for expression data would be boxplot and not the histogram. Also, Figure 3 is incorrectly referenced in the text as Figure 2. Response: Thank you very much for your comment. In response to this comment, we have revised the graph and corrected the reference as suggested. Please see Figure 3 and page 11 (lines 212 and 214). 6. Line 208: Authors contradict themselves. First, they write that there are differences in mRNA level of SphK1, to add later that it did not change… Moreover, S1PR1 and S1PR2 mRNA expression are lower only by 30-40% when compared with appropriate controls, so it is not a 3-fold difference. Not to mention, these results are not statistically significant due to high variability between individual animals. Response: First, we apologize for the error that you noted. In the later instance mentioned regarding SphK1, we were referring to SphK2 mRNA levels. Therefore, we altered the text to indicate the correct marker in response to this criticism. Please see page 11, line 211. Second, we double-checked and reanalyzed the laboratory results. As you mentioned, we discovered that the mRNA expression levels of S1PR1 and S1PR2 were reduced by 30–40% in the PbA-infected group. However, a significant decrease in S1PR3 mRNA expression was observed in the PbA-infected group compared with the control group. As a result, the text and graph have been updated. Please see lines 211–214 on page 11 and Figure 3. 7. Line 251. Downregulation of mRNA expression was only shown for S1PR3, so writing that it affects all investigated receptors is an overstatement. Response: In response to comment 6, we double-checked the results. Except for S1PR3, all the receptors had lower mRNA expression in the PbA-infected group, but the differences were not significant. 8. It is not unusual to not see differences at the mRNA level but notice the differences at the protein level (and vice versa), and authors should discuss this in their discussion. Moreover, it would be beneficial for the readers if possible explanation or more detailed information about receptors processing/degradation could be included in the discussion. Response: We have updated the discussion on the interaction between SphKs and S1PRs. Please see page 15, lines 293–298. Reviewer #2: The study tested levels of SphK1 mRNA expression in liver tissues of mice infected with malaria pathogens. Authors also found that S1PR1, S1PR2, and S1PR3 expressions are decreased in the liver tissue of Plasmodium berghei-infected mice. Data suggests that the decreased levels of S1PR1, S1PR2, and S1PR3 may be involved in liver injury during malaria infection. The study is very interesting. However, there are several issues to address. The manuscript should be improved/amended. 1. Text requires proper English language editing. Response: A revised manuscript was thoroughly edited by highly qualified native English-speaking editors at American Journal Experts. 2. Figure 2 resolution is poor. Author should provide images with higher magnification and/or better resolution. Response: Figure 2 has been revised as suggested. The new image has a resolution of 600 dpi. Please see the attached file. 3. Introduction/discussion section sections do not provide enough information; several important citations are missing. Role of SPhK in the infection resolution should be covered in more details (see these reviews: https://pubmed.ncbi.nlm.nih.gov/31863815/ ; https://pubmed.ncbi.nlm.nih.gov/28075451/ https://pubmed.ncbi.nlm.nih.gov/29385066/ Response: Thank you very much for this valuable suggestion. In response to this comment, we have added more information on the role of SphKs in the resolution of infection in the Introduction section. Please see page 4, lines 69–72. 4. Was SphK1 protein level measured/compared? Authors should discuss SPhK1 protein expression and mechanisms of its regulation considering the activation of receptor degradation during inflammation. Response: SphK1 protein levels were not measured. However, we qualitatively evaluated SphK and S1PR proteins in the liver by using an immunohistochemistry assay. In response to this comment, text on SphK1 protein expression and activity during inflammation has been added to the Discussion section. Please see pages 14–15, lines 278–298. 5. S1P receptors intracellular processing was not discussed (see this report https://pubmed.ncbi.nlm.nih.gov/23142484/) Response: We have discussed the interaction between SphKs and S1PRs. Please see page 15, lines 293–298. 6. The manuscript will benefit if authors include schematic signaling pathway for SPhK/S1P receptor signalling in the infected/normal liver. Response: Thank you very much for this valuable suggestion. A schematic illustration of the mechanism identified in this study has been added to the Discussion section. Please see pages 15, lines 313–323, and the attached file. 7. Study limitations section should be extended. Response: The study limitations have been updated. Please see page 15, lines 309–311. Submitted filename: Point by point to reviewers_AJE.pdf Click here for additional data file. 14 Mar 2022 Role of sphingosine kinase and sphingosine-1-phosphate receptor in the liver pathology of mice infected with Plasmodium berghei ANKA PONE-D-21-35173R1 Dear Dr. Punsawad, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Olga A Sukocheva, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: The revised version of the manuscript has been improved. Authors addressed all my comments properly. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 18 Mar 2022 PONE-D-21-35173R1 Role of sphingosine kinase and sphingosine-1-phosphate receptor in the liver pathology of mice infected with Plasmodium berghei ANKA Dear Dr. Punsawad: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Olga A Sukocheva Academic Editor PLOS ONE
Table 2

Primer used in this study.

NameSequence: 5’-3’Reference
SphK1-F GGAGGAGGCAGAGATAACCTT [24]
SphK1-R GACCCAACTCCTCTGCACACA [24]
SphK2-F GCCCGAGATGGTCTAGTCT [24]
SphK2-R GTGGGTAGGTGTAGATGCAGA [24]
S1P1-F ACTTTGCGAGTGAGCTG [25]
S1P1-R AGTGAGCCTTCAGTTACAGC [25]
S1P2-F TTCTGGAGGGTAACACAGTGGT [25]
S1P2-R ACACCCTTTGTATCAAGTGGCA [25]
S1P3-F TGGTGTGCGGCTGTCTAGTCAA [25]
S1P3-R CCCCGTTCTGAAACGACCTG This study
β-actin-F GTGACGTTGACATCCGTAAA This study
β-actin-R CTCAGGAGGAGCAATGATCT This study
  51 in total

Review 1.  Sphingosine 1-phosphate and inflammation.

Authors:  Hideru Obinata; Timothy Hla
Journal:  Int Immunol       Date:  2019-08-23       Impact factor: 4.823

2.  Possible roles of tumor necrosis factor in the pathology of malaria.

Authors:  I A Clark; W B Cowden; G A Butcher; N H Hunt
Journal:  Am J Pathol       Date:  1987-10       Impact factor: 4.307

Review 3.  Sphingosine kinase and sphingosine-1-phosphate receptor signaling pathway in inflammatory gastrointestinal disease and cancers: A novel therapeutic target.

Authors:  Olga A Sukocheva; Hideki Furuya; Mei Li Ng; Markus Friedemann; Mario Menschikowski; Vadim V Tarasov; Vladimir N Chubarev; Sergey G Klochkov; Margarita E Neganova; Arduino A Mangoni; Gjumrakch Aliev; Anupam Bishayee
Journal:  Pharmacol Ther       Date:  2019-12-18       Impact factor: 12.310

4.  Involvement of sphingosine 1-phosphate (SIP)/S1P3 signaling in cholestasis-induced liver fibrosis.

Authors:  Changyong Li; Xiangming Jiang; Lin Yang; Xihong Liu; Shi Yue; Liying Li
Journal:  Am J Pathol       Date:  2009-09-03       Impact factor: 4.307

5.  Vascular endothelium as a contributor of plasma sphingosine 1-phosphate.

Authors:  Krishnan Venkataraman; Yong-Moon Lee; Jason Michaud; Shobha Thangada; Youxi Ai; Herbert L Bonkovsky; Nehal S Parikh; Cheryl Habrukowich; Timothy Hla
Journal:  Circ Res       Date:  2008-02-07       Impact factor: 17.367

6.  Reduced CD36-dependent tissue sequestration of Plasmodium-infected erythrocytes is detrimental to malaria parasite growth in vivo.

Authors:  Jannik Fonager; Erica M Pasini; Joanna A M Braks; Onny Klop; Jai Ramesar; Edmond J Remarque; Irene O C M Vroegrijk; Sjoerd G van Duinen; Alan W Thomas; Shahid M Khan; Matthias Mann; Clemens H M Kocken; Chris J Janse; Blandine M D Franke-Fayard
Journal:  J Exp Med       Date:  2011-12-19       Impact factor: 14.307

7.  Sphingosine-1-phosphate receptor 3 mediates sphingosine-1-phosphate induced release of weibel-palade bodies from endothelial cells.

Authors:  Kathinka W E M van Hooren; Léon J A Spijkers; Dorothee van Breevoort; Mar Fernandez-Borja; Ruben Bierings; Jaap D van Buul; Astrid E Alewijnse; Stephan L M Peters; Jan Voorberg
Journal:  PLoS One       Date:  2014-03-14       Impact factor: 3.240

8.  Antioxidant and antimalarial properties of Sophora exigua Craib. root extract in Plasmodium berghei-infected mice.

Authors:  Kantarakorn Kaewdana; Prapaporn Chaniad; Pitchanee Jariyapong; Arisara Phuwajaroanpong; Chuchard Punsawad
Journal:  Trop Med Health       Date:  2021-03-19

9.  Upregulation of sphingosine kinase 1 is associated with recurrence and poor prognosis in papillary thyroid carcinoma.

Authors:  Jie Li; Bo Zhang; Yang Bai; Yonghong Liu; Buyong Zhang; Jian Jin
Journal:  Oncol Lett       Date:  2019-09-24       Impact factor: 2.967

10.  Overexpression of Sphingosine Kinase-1 and Sphingosine-1-Phosphate Receptor-3 in Severe Plasmodium falciparum Malaria with Pulmonary Edema.

Authors:  Parnpen Viriyavejakul; Chuchard Punsawad
Journal:  Biomed Res Int       Date:  2020-02-26       Impact factor: 3.411

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.