Literature DB >> 35313568

HuR Promotes the Progression of Gastric Cancer through Mediating CDC5L Expression.

Jing Cui1, Nanjing Cao2,3, Guochao Wang4, Fuhua Wang3, Bin Yang5, Jian Wang5, Yongqiang Lv6, Yunqing Chen5, Feng Li3.   

Abstract

Methods: We performed qRT-PCR, cell cycle assay, cell migration, and mouse transplantation model analysis in our experiments. It has been clarified that HuR and microRNAs (miRNAs) have important interplays in the regulation of tumor progression.
Results: This study found microRNA-133b (miR-133b), as a HuR-sponged miRNA in GC cells. Downregulation of HuR can promote the expression of miR-133b and further affect the downstream cyclin CDC5L. The expressions of miR-133b were slightly lower in GC tissues than adjacent normal tissues.
Conclusion: Our studies suggest that HuR and miR-133b are involved in the development and pathological process of GC cells.
Copyright © 2022 Jing Cui et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35313568      PMCID: PMC8934217          DOI: 10.1155/2022/5141927

Source DB:  PubMed          Journal:  Dis Markers        ISSN: 0278-0240            Impact factor:   3.434


1. Introduction

Gastric cancer (GC) is one of the most common gastrointestinal tumors. In China, the diagnosis and treatment rates of early GC are less than 10%. The 5-year survival rate is about 30% after radical resection of advanced [1]. Clinical statistics show that the incidence and death rate of GC is high, but the early diagnosis rate and 5-year survival rate are low. The pathogenesis of GC has yet to clear, but the diagnosis of 80% ~ 90% of progression has spread to the lymph nodes and even distant metastasis over time. Lymph node metastasis of GC, nearly 20%, is the main route of GC metastasis. Studies have shown that lymphatic metastasis of GC is an important factor affecting the prognosis of early GC [2]. Therefore, it is of great clinical significance to explore the related factors of GC metastasis, early prediction of the risk of lymph node metastasis to improve the survival rate of patients. Human antigen receptor (HuR) belongs to the RNA binding protein family, embryonic lethal abnormal vision (ELAV). It is known as the class embryonic death abnormal visual, widely expressed in mammalian cells [3]. HuR was first detected in the serum from lung cancer patients in 1990. In 1996, Ma et al. [4] applied the polymerase chain reaction (PCR) technology identifying and cloning HuR. HuR includes four members: HuB, HuC, HuD, and HuR. The first three members are mainly expressed in neural tissues and reproductive organs and related to neural development. HuR can be connected with multiple regulatory factors such as Von Hippel Lindau tumor suppressor (VHL), cyclooxygenase 2 (cox-2) [5], cyclin A, and matrix metallopeptidase-9 (MMP-9) [6] and participate in various cell responses and inflammatory tumor formation. In recent years, increasing studies have found that HuR is associated with the occurrence, invasion, metastasis, and prognosis of oesophageal squamous cell carcinoma [7], glioma [8], breast cancer [9], lung cancer [10], and colorectal cancer [11]. MicroRNA (miRNA) is a kind of short RNAs, which are nonprotein coding and mainly regulate the expression of target mRNA at the transcriptional or posttranscriptional level. Many studies have confirmed that miRNA plays an essential role in cell proliferation, differentiation, apoptosis, and metabolism and participates in the regulation of various signals in the process of tumorigenesis [12]. Different types of miRNAs with abnormal expression have been detected in multiple malignant tumors. They are related to the occurrence, development, treatment, and prognosis of tumors. A single miRNA can regulate one or more invasion-related genes, and multiple miRNAs can control a single invasion-related gene simultaneously [13]. In the early stage, we conducted miRNA microarray analysis on GC tissues. We found that the expression of many miRNAs was upregulated or downregulated, among which miR-133b was most significantly downregulated in GC tissues. In other tumors, overexpressed miR-133b can inhibit the proliferation and induce apoptosis of tumor cells, suggesting that it has a classical pattern of regulating miRNA target genes. Then, we will study the interaction between HuR and miR-133b as posttranscriptional regulators.

2. Materials and Methods

2.1. Clinical Specimens and Cell Culture

GC tissue and paired adjacent normal tissue samples from 80 patients were collected from Shanxi Cancer Hospital/Institute. GC tissue microarrays were from Shanghai Qiagen Biotech (China). The ethical board approved the experiment by the Shanxi Cancer Hospital/Institute. GC tissues were obtained with the patient's informed content and were confirmed by clinical. GC cell lines BGC-823, MKN-45, MGC-803, SGC-7901, and AGS were obtained from the ATCC. GC cells were grown in a 5% CO2 culture incubator with 10% FBS DMEM (Hyclone, Utah) at 37°C. Mycoplasma detected cell lines according to the verification recommendations of the ATCC.

2.2. RNA Isolation and qRT-PCR Analysis

Total RNA was extracted from the cultured cells using TRIzol reagent (Invitrogen, CA, USA). RNA isolation and quantitative real-time PCR (qPCR) analysis were conducted with the Vii7 Q-PCR system (ABI, USA) in the Thermal Cycler Dice Real-time System (Takara). The qPCR primers are listed in Table 1.
Table 1

Primers used for qRT-PCR.

NameSequence (5′-3′)
CDC5LForwardGAGAGCTCTCAAGTGAAGCTTA
ReverseTCTTCTTTTCCATCTTTGCAGC
BCAS2ForwardACCGACCTACTAAGAACTACCT
ReverseATTCTTGCCATGCAGTAATGTC
PTBP1ForwardTCTACTTGTGTCACTAACGGAC
ReverseTGAACTTCTTGCTGTCATTTCC
TRA2BForwardGCAGGTCTTACAGTCGAGATTA
ReverseACAAAGGCAAATCCTCTTGAAC
SRSF3ForwardTTGAATTTGAAGATCCCCGAGA
ReverseAGAATCACTTGAACCCAGTAGG
SF3B1ForwardACATGCAAACTGAAGATCGAAC
ReverseTTGCTCTTCTGGACTAAGTGTT
SF3A1ForwardCTGCTCCAGATGAGTATCTTGT
ReverseGCTTCAAGCTGCTCTCAATATC
HNRNPCForwardACAGATCCTCGCTCCATGAACTCC
ReverseTTCTGCCATCCTCTCCTGCTACAG
PLRG1ForwardTCTGACCGTCCACAGCCTACAG
ReverseTCCAGGTTCCACAGCAATACATCG
HuRForwardAAGCCTGTTCAGCAGCATTG
ReverseCTTCGCGGTCACGTAGTTCA
GAPDHForwardTCAACGACCACTTTGTCAAGCTCA
ReverseGCTGGTGGTCCAGGGGTCTTACT
miR-133b mimicsForwardUUUGGUCCCCUUCAACCAGCUA
ReverseGCUGGUUGAAGGGGACCAAAUU
miR-133b ncForwardUUCUCCGAACGUGUCAGGUTT
ReverseACGUGACACGUUGGGAGAATT

2.3. Oligonucleotide

Cells were transfected (100 nM) with HuR (si-HuR) and control siRNA (si-control) using Lipofectamine TM 2000 (Invitrogen, USA). The results were measured relative to light units per luciferase activity by qRT-PCR.

2.4. Cell Proliferation and Migration

In cell proliferation, si-HuR and si-control transfected GC cells were seeded in 96-well plates at 2000 cells per well. The assay was evaluated by 10% CCK-8 (DOJINDO) diluted on a microtiter plate reader (Spectra Rainbow, Tecan) after 1, 2, 3, and 4 days posttransfection. Proliferation rates were determined under the manufacturer's recommended protocol. In wound-healing assays, GC cells were transfected with si-HuR and si-control on 6-well plates. Linear scratch wounds were created after 1 day of transfection in a serum-free medium. The degree of convergence was obtained at every 24 h. Each group had three duplicate holes.

2.5. Colony Formation Assays

Transfected cells were growing in 24-well plates at 1 × 103 cells per well. Cells treated with trypsin were maintained in an incubator for 7-10 days. Then, the cells were washed with PBS, fixed with formalin, and stained with methyl violet. The number of colonies was counted using a microscope (Olympus IX-7, Japan) [35].

2.6. Cell Cycle Assay

Si-HuR and si-control transfected GC cells were seeded at 3 × 105 cells per well in 6-well plates. The cells were maintained in complete medium for 2 days. By using precooling, 1 × PBS contained EDTA washing cells twice, suspending cells, blending, and washing cells. The cell cycle of GC cells was examined after treatment with si-HuR or si-control and staining with PI.

2.7. Luciferase Assay

After 48 h of cell transfection, the old culture medium was sucked off and washed twice with PBS. PLB (Passive Lysis Buffer) of 100 μL was added to each cell hole. Then, it was shaken gently for 10-15 minutes and collected the cell lysate. Then, we added 100 μL LAR II working fluid to each sample, mixed it immediately and read the value 2 s, added 100 μL Stop & Glo® Reagent, mixed it quickly, and put it into the luminescent detector to read the value 2 s.

2.8. Tumorigenicity Assay In Vivo

Animal experiment was conducted according to the guide for the Care and Use of Laboratory Animals (NIH publications nos. 80–23, revised 1996) and the institutional ethical guidelines for animal experiments. si-control and si-HuR transduced GC cells (1 × 107) with 100 μL of PBS were placed into one side of the posterior flank of the nude mouse at 5-6 weeks of age. Tumor growth was examined and tumor volume (V) was monitored with the width (W) and length (L) (V = (L × W2) × 0.5).

2.9. Immunoblotting Analysis

GC cells were cultured in 8-well chamber slides (Thermo Scientific), then fixed, washed, incubated (0.01% NaAzide, 3% BSA, TBS pH 7.8, 1% Triton X-100, 1% normal goat serum), and stained. At last, they were incubated with an IgG-antibody (Life Technologies) and captured images by Zeiss microscope.

2.10. Immunohistochemistry and H&E Staining

In H&E staining, GC tissues were embedded, sectioned, dewaxed, and hydrated. Then, tissues were incubated with antibodies, stained with hematoxylin and eosin (H&E), and observed with a microscope finally. For immunohistochemistry, 0.3% H2O2 was incubated for 15 minutes and antigen was extracted from 0.01 M sodium citrate-hydrochloric acid buffer. HuR (Proteintech) and GAPDH (Cell Signaling Technology) antibodies were used for immunohistochemical analysis. Cells were viewed and photographed with a Zeiss UV LSM confocal microscope.

3. Results

3.1. Abnormal Expression of HuR in Human Cell Lines and GC Tissues

To determine the expression of HuR (ELAVL1, ELAV like RNA binding protein 1) in GC, 80 pairs of clinic GC tissues and matched adjacent normal tissues were analyzed with quantitative PCR (qPCR). Results show that the expression of mRNA in 66 cases (82.5%) was rising in tumor tissues compared with their normal tissues, while only 14 cases (17.5%) showed a reduced level in GC (Figure 1(a)). Therefore, the overall expression of HuR in GC tissues was upregulated significantly (Figure 1(b), p < 0.001, GC vs. normal). To further study the relationship between the expression of HuR and the development of GC, we analyzed the relationship between metastatic and nonmetastatic of GC and the level of HuR statistically (nonparametric test). We found that a high HuR level was associated with the pM stage (Figure 1(c), p < 0.001, metastasis vs. nonmetastasis) in GC patients. However, there was no significant difference between HuR and other clinicopathological features such as Borrmann typing, age, position, gender, and venous invasion. Besides, overall survival and disease-free survival were significantly worse in GC patients with high HuR expression (Figure 1(d)).
Figure 1

Expression of HuR in GC tissues and cell lines. (a) Relative abundance of HuR was detected in 80 pairs of GC cancers and adjacent normal cancers by RT-qPCR. (b) Scatter plots show the relative HuR mRNA level between cancer tissues and normal tissues. (c) The statistical analysis of the association between the HuR level and pM stage (metastasis and no metastasis). (d) Statistical analysis of survival probability of HuR high- (n = 26) and low-expressing (n = 6) GC patients using Kaplan–Meier analysis. Statistical analysis is described in the Materials and Methods. (e) Immunoblotting analysis of HuR proteins in 6 pairs of GC samples. GAPDH was used as a loading control. The HuR expression level was normalized to loading control. (f) Levels of HuR protein in GC cell lines (MKN-45, SGC-7901, AGS, BGC-823, and MGC-803) relative to one normal control sample. For all qPCR results, the data are presented as the mean ± SEM, and the error bars represent the standard deviation obtained from three independent experiments. ∗p < 0.05; ∗∗p < 0.01.

For further determination, we examined HuR protein levels in 6 pairs of GC samples. In parallel with mRNA expression changes, the HuR protein levels were escalated significantly in GC tissues (>1.7-fold) compared with normal tissues (Figure 1(e)). Moreover, we used five GC cell lines (MKN-45, SGC-7901, AGS, BGC-823, and MGC-803) and normal cells to analyze the expression of the protein. It was shown that HuR was also elevated in GC cell lines in comparison with normal cells (Figure 1(f)). These results indicated that HuR was a potential oncogene in GC tumorigenesis.

3.2. HuR Promotes GC Cell Proliferation and Migration

Upregulated HuR expression in GC tissues was reminded us to explore the function of HuR in GC tumorigenesis. We selected SGC-7901 and MGC-803 cell lines to disclose the role of HuR in the pathogenesis of GC, in which the HuR expression was higher than other cells (Figure 1(f)). After transfecting si-HuR into SGC-7901 and MGC-803 cells, we confirmed the efficiency of low HuR expression. Compare with the empty vector si-control, the level of HuR protein was reduced in SGC-7901 and MGC-803 cells treated with si-HuR (Figure 2(a)). Then, we used propidium iodide staining assay to assess the effect of si-HuR on the cell cycle. As expected, the percentage of S-phase cells reduced markedly after being treated with si-HuR in SGC-7901 and MGC-803 cells (Figure 2(b)). Accordingly, the low expression of HuR pointed to more sluggish proliferation rate than controls after CCK-8 assay (Figure 2(c)). Moreover, clonogenic tests were indicated a noticeable decline in cell proliferation after si-HuR transfection into both SGC-7901 and MGC-803 cells (Figure 2(d)).
Figure 2

Functional analysis of HuR in GC cells. (a) HuR levels were detected in SGC-7901 and MGC-803 cells after treatment with si-HuR or si-control by immunoblotting. (b) Flow cytometry was conducted to examine the cell cycle of SGC-7901 and MGC-803 cells after treatment with si-HuR or si-control and staining with PI. (c) Cell proliferation assay of SGC-7901 and MGC-803 cells after treatment with si-HuR or si-control using CCK-8. (d) Wound healing assays of SGC-7901 and MGC-803 cells after treatment with si-HuR or si-control. The relative ratio of wound closure per field is shown in the right. (e) Clone formation assay of SGC-7901 and MGC-803 cells after treatment with si-HuR or si-control. For all qPCR results, the data are presented as the mean ± SEM, and the error bars represent the standard deviation obtained from three independent experiments. ∗p < 0.05; ∗∗p < 0.01.

Based on the communication between HuR expression and GC tumorigenesis, we suggested that the protein might regulate some cell functions of GC cells. To verify this hypothesis, we performed cell migration assays in SGC-7901 and MGC-803 cells with si-HuR or si-control treated. To compare with the si-control, the wound healing degree was decreased in si-HuR GC cells (Figure 2(e)). The above results vouched that HuR may act as an oncogene by promoting cell migration and proliferation, as well as promoting the cell cycle in GC cells.

3.3. HuR Promotes Tumor Cell Growth and Metastasis In Vivo

We further validated these findings in mouse models by subcutaneous injection of (s.c.) si-HuR or si-control lentivirus MGC-803 cells on the posterior flank of nude mice. The animals were sacrificed after six weeks. Low HuR expression was suppressed tumor growth significantly compared with the control group (Figure 3(a)). The mean final tumor volume was 217 mm3 and 355 mm3, respectively (Figure 3(b)). Final tumor weights were 2207 mg and 3446 mg, respectively. Similarly, immunohistochemistry showed that HuR staining was increased clearly in GC tissues (Figure 3(d)). Hematoxylin and eosin (H&E) staining was illustrated more metastatic nodules in GC tissues with high expression of HuR compared with adjacent normal tissues (Figure 3(d)). Thus, HuR may mediate tumorigenesis by promoting the degree of migration and proliferative in GC cells. The findings above reminded us that the HuR was played a visible role in tumor oncogenes in GC cells.
Figure 3

HuR promotes GC cell growth in vivo. (a) Xenograft model in nude mice. si-HuR or si-control transfected MGC-803 cells were injected s.c. into the posterior flank of nude mice. The graph is representative of tumors in mice at five weeks after inoculation. The right photo is representative of excised tumors from killed mice. (b) Tumor volume was calculated and all data are shown as the mean ± SD. (c) Tumor weight was calculated and all data are shown as the mean ± SD. (d) Pathology analysis of tumor sections from GC tissues and adjacent normal tissues. Immunohistochemistry, H&E staining, and labeling with HuR were performed. Bars: 20 μm. ∗p < 0.05; ∗∗p < 0.01.

3.4. HuR Regulates the Expression of miR-133b in GC Cells

Recent work by Qin et al. has revealed that the appearance of HuR could mediate the miR-133b level in oesophageal squamous cell carcinoma [7]. Furthermore, the changes of contents of miR-133b were revealed in other human cancers, including glioma [8], colorectal [9], and lung cancers [10]. After that, we used MGC-803 cells with a high endogenous HuR level through si-HuR transfection to detect how HuR has regulated the expression of miR-133b in GC cells. miRNA array was performed to confirm the changes in HuR gene level leading to changes in miRNA (Figure 4(a)). In MGC-803 cells, si-HuR was considerably increased in miR-133b mRNA levels compared with si-control (Figure 4(a)). We determined significant enrichment of the HuR group and control group for normalizing expression. Biological replicates were analyzed by statistical methods showed a strong correlation. (Figure 4(b)). Luciferase reporter assay verified that the HuR was reduced in luciferase expression of miR-133b compared to NC (Figures 4(c) and 4(d)). Our data implied that HuR and miR-133b were a very close relationship in GC cells.
Figure 4

HuR regulates the expression of miR-133b in GC cells. (a) Relative expression of miR-133b and total miRNA in HuR knockdown cells as described. (b) Enrichment of HuR group and control group for normalized expression. (c) Luciferase reporter assay was conducted with HuR and mut-HuR. (d) Luciferase reporter assay detected the changes in fluorescence activity of mir-133b group and blank group in transfected 3′UTR HuR gene or mut 3′UTR HuR gene. Statistical analysis using Kaplan–Meier analysis. Statistical analysis is described in Materials and Methods. ∗p < 0.05; ∗∗p < 0.01.

3.5. miR-133b Functions as a Tumor Suppressor in GC

Based on the above findings, we selected 60 case tissues to study the mysterious effect of miR-133b. QPCR showed that the levels of miR-133b in normal tissues were increased compared with the cancer tissue cells (Figure 5(a)). To confirm the weakening effects of miR-133b on GC development, the known expression miRNAs were used as control (Figure 5(b)). Compared with high miR-133b expression GC patients, the low miR-133b expression had markedly worse overall (Figure 5(c)). We also found that a high miR-133b level impacted GC progression (Figure 5(d)), p < 0.001, nonmetastasis vs. metastasis) in GC patients. The CCK-8 proliferation assay in MGC-803 and SGC-7901 cells showed that cell growth was suppressed more severely after transfection with miR-133b mimics (Figure 5(e)). Moreover, clonogenic assays indicated an uncommon reduction in cell proliferation after miR-133b mimics transfection into SGC-7901, MGC-803, and BGC-823 cells (Figure 5(f)). These findings tell us that miR-133b had a tumor suppressor role in GC cells.
Figure 5

Functional analysis of miR-133b in GC cells. (a) miR-133b levels were detected in 60 pairs of GC tissues and adjacent normal regions by RT-qPCR. (b) Heat maps show the expression of miR-133b and known miRNAs in normal cells and GC cell lines. (c) Statistical analysis of survival probability of miR-133b high- (n = 10) and low-expressing (n = 40) GC patients using Kaplan–Meier analysis. Statistical analysis is described in the Materials and Methods. (d) The statistical analysis of the association between miR-133b level and pM stage (metastasis and no metastasis). (e) Cell proliferation assay of SGC-7901 and MGC-803 cells after treatment with miR-133b mimics or miR-133b nc using CCK-8. (f) Clone formation assay of SGC-7901 and MGC-803 cells after treatment with miR-133b mimics or miR-133b nc. For all qPCR results, the data are presented as the mean ± SEM, and the error bars represent the standard deviation obtained from three independent experiments. ∗p < 0.05; ∗∗p < 0.01.

3.6. HuR and miR-133b Affect the Expression of CDC5L in GC Cells

GO analysis (string analysis) revealed that most of the interacting genes were splicing factors and transcriptional regulatory genes, especially CDC5L (cell division cycle 5-like protein), acted as a transcription activator (Figure 6(a)). We compared the expression of CDC5L between GC cell lines and normal cells (Figure 6(b)) and selected MGC-803 and BGC-823 for candidate cells. As shown in Figure 6(c), CDC5L displayed the obvious lessen upon HuR knockdown. Given its oncogenic roles in some cancers, colorectal [14] and hepatocellular [15] cancers, we selected CDC5L for western blot analysis. Western blot analysis confirmed that HuR and miR-133b were upstream of CDC5L in MGC-803 and BGC-823 cells (Figure 6(d)).
Figure 6

HuR and miR-133b coregulate the progression in GC cells. (a) String analysis reveal that most of the interacting genes between HuR and other genes. (b) Compared with the expression of the CDC5L between GC cell lines and normal cells. (c) CDC5L displayed the significant reduction changes upon HuR knock-down in MGC-803 and BGC-823 cells. (d) Western blots analysis and confirmed the function of HuR and miR-133b on the upstream of the CDC5L in MGC-803 and BGC-823 cells. (e) The axis diagram shows the relationship between HuR and miR-133b with the progression of GC.

The introduction of si-HuR into MGC-803 cells would weaken the expression of CDC5L and BCL2. However, we also detected the opposite changes in Cyclin B, P53, and caspase-3 protein expression after knockdown HuR expression in MGC-803 cells. Consistent with the reduced HuR levels in MGC-803 cells, the CDC5L level was markedly lower in BGC-823 cells compared with that in si-control (Figure 6(d)). Therefore, the novel miR-133b-HuR-CDC5L axis was present in GC cells (Figure 6(e)).

4. Discussion

GC, the third most lethal tumor, is a common gastrointestinal cancer worldwide, especially in some countries in East Asia and Eastern Europe [16]. GC is often diagnosed at the advanced stage, accompanied by malignant cell growth and metastasis. In recent years, considerable progress has been made in the clinical treatment of GC, but the survival rate of patients with GC is still not satisfactory [17-19]. Although scientists have identified several related oncogenes or tumor suppressor genes that are identified as crucial regulators of GC, few have been recognized or treated for early clinical screening [20]. Therefore, it is of great significance for clinical treatment to research new markers of GC and explore the related mechanism. In this study, we confirmed an RNA-binding protein, HuR, which is upregulated in GC patients. The reduced expression of HuR could inhibit the occurrence and development of GC, providing a new strategy for the treatment of GC. Human antigen receptor (HuR) belongs to the RNA binding protein family and embryonic lethal abnormal vision (ELAV). Moreover known as the class embryonic death abnormal visual, widely expressed in mammalian cells [3]. It has been found to affect mRNA translation [21], cell responses [22], and inflammatory tumor formation [6]. In recent years, more studies have found that HuR is associated with the occurrence and prognosis of different carcinoma, glioma [8], breast cancer [9], lung cancer [10], and colorectal cancer [11]. The HuR regulated COX-2 has been shown to promote the progression of nonsmall cell lung carcinoma [23]. HuR also regulates E-cadherin expression and barrier function [24]. Additionally, HuR regulates AKT phosphorylation level through the PI3K/AKT/NF-B signaling pathway [25]. Although numerous studies have strongly demonstrated that HuR promotes the progression of many cancers [26], the targets and functional mechanisms are only beginning. We established the axis between HuR miR-133b in GC in the study. Recently, Xue et al. reported that microRNA-133b (miR-133b) plays a suppressor role in several human cancers, as well as glioma [8], colorectal cancer [11]. MicroRNAs (miRNAs) are small noncoding RNAs that bind to mRNAs and regulate gene expression at the posttranscriptional level [5-7]. There are a lot of evidence revealing that miRNAs' expression is maladjusted in many cancers, but more studies are needed to confirm how it affects tumorigenesis and metastasis. miRNAs can act as oncogenes or tumor suppressors to regulate the occurrence and development of tumors. For example, miR-218 [27], miR-129 [28], miR-148 [29], and miR-7a [30] were considered as tumor suppressor. However, miR-21 [31], miR-221 [32], miR-214 [33], miR-34b [34], and miR-532 [35] were considered as oncogenes in GC [31-35]. In this study, we aimed to study the clinical diagnostic value of HuR and miR-133b in GC.
  33 in total

1.  miR-221 and miR-222 synergistically regulate hepatocyte growth factor activator inhibitor type 1 to promote cell proliferation and migration in gastric cancer.

Authors:  Tao Ning; Haiyang Zhang; Xinyi Wang; Shuang Li; Le Zhang; Ting Deng; Likun Zhou; Xia Wang; Rui Liu; Ming Bai; Shaohua Ge; Hongli Li; Dingzhi Huang; Guoguang Ying; Yi Ba
Journal:  Tumour Biol       Date:  2017-06

2.  Microarray analysis of long non-coding RNAs related to microRNA-148b in gastric cancer.

Authors:  Y Song; J Sun; Y Xu; J Liu; P Gao; X Chen; J Zhao; Z Wang
Journal:  Neoplasma       Date:  2017       Impact factor: 2.575

3.  Nuclear HuR accumulation through phosphorylation by Cdk1.

Authors:  Hyeon Ho Kim; Kotb Abdelmohsen; Ashish Lal; Rudolf Pullmann; Xiaoling Yang; Stefanie Galban; Subramanya Srikantan; Jennifer L Martindale; Justin Blethrow; Kevan M Shokat; Myriam Gorospe
Journal:  Genes Dev       Date:  2008-07-01       Impact factor: 11.361

4.  Multimodality Treatment of T4 Gastric Cancer in the United States: Utilization Trends and Impact on Survival.

Authors:  Lea Lowenfeld; Jashodeep Datta; Russell S Lewis; Matthew T McMillan; Ronac Mamtani; Nevena Damjanov; Vinay Chandrasekhara; Giorgos C Karakousis; Jeffrey A Drebin; Douglas L Fraker; Robert E Roses
Journal:  Ann Surg Oncol       Date:  2015-06-23       Impact factor: 5.344

5.  MiR-133b acts as a tumor suppressor and negatively regulates TBPL1 in colorectal cancer cells.

Authors:  Kai-Min Xiang; Xiao-Rong Li
Journal:  Asian Pac J Cancer Prev       Date:  2014

6.  Exosomes Serve as Nanoparticles to Deliver Anti-miR-214 to Reverse Chemoresistance to Cisplatin in Gastric Cancer.

Authors:  Xinyi Wang; Haiyang Zhang; Ming Bai; Tao Ning; Shaohua Ge; Ting Deng; Rui Liu; Le Zhang; Guoguang Ying; Yi Ba
Journal:  Mol Ther       Date:  2018-01-08       Impact factor: 11.454

7.  MicroRNA-133b expression associates with clinicopathological features and prognosis in glioma.

Authors:  Kun Xue; Junmei Yang; Jia Hu; Jianhui Liu; Xingang Li
Journal:  Artif Cells Nanomed Biotechnol       Date:  2017-07-04       Impact factor: 5.678

Review 8.  miR-206/133b Cluster: A Weapon against Lung Cancer?

Authors:  Jing-Yu Pan; Cheng-Cao Sun; Zhuo-Yue Bi; Zhen-Long Chen; Shu-Jun Li; Qing-Qun Li; Yu-Xuan Wang; Yong-Yi Bi; De-Jia Li
Journal:  Mol Ther Nucleic Acids       Date:  2017-06-07       Impact factor: 8.886

Review 9.  Inhibition of Caspase-2 Translation by the mRNA Binding Protein HuR: A Novel Path of Therapy Resistance in Colon Carcinoma Cells?

Authors:  Wolfgang Eberhardt; Usman Nasrullah; Kristina Haeussler
Journal:  Cells       Date:  2019-07-30       Impact factor: 6.600

10.  QKI5-mediated alternative splicing of the histone variant macroH2A1 regulates gastric carcinogenesis.

Authors:  Feng Li; Ping Yi; Jingnan Pi; Lanfang Li; Jingyi Hui; Fang Wang; Aihua Liang; Jia Yu
Journal:  Oncotarget       Date:  2016-05-31
View more
  2 in total

Review 1.  MicroRNAs, Tristetraprolin Family Members and HuR: A Complex Interplay Controlling Cancer-Related Processes.

Authors:  Cyril Sobolewski; Laurent Dubuquoy; Noémie Legrand
Journal:  Cancers (Basel)       Date:  2022-07-20       Impact factor: 6.575

2.  miR-33a-5p Targets RAP2A to Mediate the Sensitivity of Gastric Cancer Cells to 5-FU.

Authors:  Gang Ti; Zongliang Guo; Lili Li; Yongqiang Lv; Bin Yang; Jian Wang; Rui Guo; Yunqing Chen; Debin Meng; Feng Li
Journal:  Dis Markers       Date:  2022-08-22       Impact factor: 3.464

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.