Literature DB >> 35312719

Identification of a coproporphyrinogen-III oxidase gene and its correlation with nacre color in Hyriopsis cumingii.

Xiajun Chen1,2,3, Jixiang He1, Mengying Zhang2,3, Zhiyi Bai2,3,4, Jiale Li2,3,4.   

Abstract

Pearl color is an important factor influencing pearl value, and is affected by the nacre color of the shell in Hyriopsis cumingii. Coproporphyrinogen-III oxidase (CPOX) is a key enzyme in porphyrin synthesis, and porphyrins are involved in color formation in different organisms, including in the nacre color of mussels. In this study, a CPOX gene (HcCPOX) was identified from H. cumingii, and its amino acid sequence was found to contain a coprogen-oxidase domain. HcCPOX mRNA was expressed widely in the tissues of white and purple mussels, and the highest expression was found in the gill, followed by the fringe mantle. The expression of HcCPOX in all tissues of purple mussels (except in the middle mantle) was higher than that of white mussels. Strong hybridization signals for HcCPOX were observed in the dorsal epithelial cells of the outer fold of the mantle. The activity of CPOX in the gill, fringe mantle, and foot of purple mussels was significantly higher than that in white mussels. Moreover, the expression of HcCPOX and CPOX activity were decreased in RNA interference experiments. The findings indicate that HcCPOX might contributes to nacre color formation in H. cumingii by being involved in porphyrin synthesis.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35312719      PMCID: PMC8936452          DOI: 10.1371/journal.pone.0265318

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


1. Introduction

Hyriopsis cumingii is a freshwater mussel that is widely distributed in China and produces high-quality freshwater pearls [1]. Pearl size, shape, color, and luster influence the value of pearls, with color being the primary factor [2]. Some studies have indicated that the pearl color of host mussels is affected by the nacre color of the donor mussels [3] and, therefore, nacre color has a substantial impact on the value of pearls. The nacre color of a shell is not only influenced by water environmental factors, but also by genetic factors [4]. Studies have reported that melanin and carotenoids are involved in nacre color formation, and related genes (e.g., HcTyr, HcMitf, hcApo) have also been found to play a role in nacre color in H. cumingii [5-9]. The pearl oyster shells are usually composed of nacre, prismatic layer and periostracum. The nacre is the inner layer of a shell, and its formation occurs as the shell is made, which involves a complex biomineralization process. Briefly, the gill, foot, and mantle epidermis absorb Ca2+ and HCO3− from the water, which is transported into the mantle through hemolymph or other mechanisms. These compounds are then secreted by epithelial cells between the hemolymph and mantle cavity, and deposited on the shell. However, some specific mechanisms of this process occur remain unclear [10-12]. Porphyrins are common natural pigments in multiple organisms. Different porphyrins show different colors, such as uroporphyrin is red and protoporphyrin is purple [13]. Moreover, they usually exist in organisms in the form of metal chelates, and the different metal ions they bind will result in different colors. For example, manganese porphyrin and magnesium porphyrin are green, while iron porphyrin is red [14]. Based on the organic chromophore theory and the chemical structure characteristics of porphyrins, Hao et al. [15] revealed that there are multiple conjugated double bonds in porphyrins, and its structure belongs to a cyclic conjugated system. The π-π conjugated structure of porphyrin will affect its spectral absorption band. When porphyrin is combined with different metal ions, the original conjugated structure of the porphyrin is distorted or deformed due to differences in the size of the metal ions, which cause the absorption band to shift, resulting in color differences. Porphyrins are important for the color of organisms. In fact, a large number of studies have shown that porphyrins are the key substances that determine the color of bird eggshells, and that different metal porphyrins can lead to different shell colors [16-19]. Mussel shells are similar to eggshells in that they are both comprised of calcium carbonate. Williams et al. found that uroporphyrin I and uroporphyrin III are involved in shell color formation in marine snails [20]. Bonnard et al. indicated that the shell color is also related to uroporphyrin in Crassostrea gigas oyster [21]. Moreover, studies found that the color of freshwater pearls produced by H. cumingii related to porphyrins [22]. It is widely known that the nacre formation is similar to the pearl formation, so the effect of porphyrins on the nacre color formation is worth studying. The synthesis of porphyrin in organisms is a complex process in which coproporphyrinogen-III oxidase (CPOX) is a key enzyme. CPOX catalyzes coproporphyrin III to synthesize protoporphyrinogen IX, and then further synthesis protoporphyrin IX under the action of protoporphyrinogen oxidase, and finally combines with metal atoms to synthesize metalloporphyrin. However, the CPOX effect on shell color has only been reported in Meretrix meretrix [23]. Therefore, the effect of CPOX on nacre color in H. cumingii requires further investigation. In this paper, the full-length cDNA of the H. cumingii coproporphyrinogen III oxidase gene (HcCPOX) was obtained. The expression of HcCPOX and the activity of CPOX in different tissues were also determined. The distribution of HcCPOX in the mantle was detected using in situ hybridization. RNA interference (RNAi) was performed in purple mussels and the changes in HcCPOX expression and CPOX activity were evaluated in different tissues. The findings indicated that HcCPOX may affect nacre color by affecting the synthesis of porphyrins.

2. Materials and methods

2.1 Experimental animals

Sixty experimental mussels (aged, ~2 years; average shell length, 8.7 cm) were provided by Xuancheng Farm of the Zhexing Pearl Trading Co. Ltd. (Anhui Province, China), including 30 white mussels and 30 purple mussels (Fig 1). Before experimentation, mussels were acclimated for 1 week in tanks containing aerated fresh water (26 ± 1°C).
Fig 1

Mussels with white (left) and purple (right) nacre.

2.2 RNA extraction and full-length cDNA cloning

First, mantle tissue was collected and immediately frozen in liquid nitrogen and stored at −80°C until use. Then, total RNA was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. The quality of RNA was examined by a spectrophotometer (NanoDrop 2000c, Thermo, USA) and electrophoresis on 1% agarose gels. The SMART RACE cDNA amplification kit (Clontech, Dalian, China) was used to obtain mantle cDNA, and then 5′- and 3′-RACE was performed to clone the full-length cDNA of HcCPOX. The specific primers (Table 1) were designed based on the HcCPOX expressed sequence tag obtained from the H. cumingii mantle transcriptome library [24]. The PCR parameters were as follows: 5 min at 94°C; 30 cycles at 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min, and a 10 min final extension at 72°C. The PCR products were sequenced using the Sanger method (Sangon, Shanghai, China).
Table 1

Primers used in this study.

Primer nameSequence (5’-3’)Application
CPOX-3’ GGGAGTGGCAGCTGTTGAGACGAGGCCG 3’RACE
CPOX-5’ GGACGACAGAGATGTTGACCCC 5’RACE
CPOX-RTF TATGCAGAAAGGGAGTGGCA qPCR
CPOX-RTR TCCCATCTCGCAGTAAGTGG qPCR
EF1α-F GGAACTTCCCAGGCAGACTGTGC qPCR
EF1α-R TCAAAACGGGCCGCAGAGAAT qPCR
CPOX-ISHF TATGCAGAAAGGGAGTGGCA In situ hybridization
CPOX-ISHR TAATACGACTCACTATAGGGTCCCATCT In situ hybridization
CGCAGTAAGTGG
CPOX-iF+T7 GGATCCTAATACGACTCACTATAGG RNAi
GTCAACATCTCTGTCGTCCA
CPOX-iR CGAGTCTCCTCTCTGTGTTTG RNAi
CPOX-iF GTCAACATCTCTGTCGTCCA RNAi
CPOX-iR+T7 GGATCCTAATACGACTCACTATAGGCGA RNAi
GTCTCCTCTCTGTGTTTG
GFP-iF+T7 GGATCCTAATACGACTCACTATAGGAAG RNAi
GGCGAGGAGCTGTTCACCG
GFP-iR CAGCAGGACCATGTGATCGCGC RNAi
GFP-iF AAGGGCGAGGAGCTGTTCACCG RNAi
GFP-iR+T7 GGATCCTAATACGACTCACTATAGGCA RNAi
GCAGGACCATGTGATCGCGC

2.3 Bioinformatics analysis

The open reading frame (ORF) of HcCPOX was predicted using the NCBI ORF Finder tool (http://www.ncbi.nlm.nih.gov/projects/gorf/) [25]. The BLAST program (http://www.ncbi.nlm.gov/blast) was used to perform homology analyses of the nucleotide and protein sequences [25]. The Simple Modular Architecture Research Tool (SMART, (http://smart.embl-heidelberg.de/)) was used to analyze the structural domains contained in the amino acid sequence. The online Protparam (http://www.expasy.org/tools/protparam) tool was used to obtain amino acid sequence composition, molecular weight, isoelectric point, and other physical parameter information [26]. Clustalx software was used to perform multiple sequence comparisons [27]. MEGA 5.2 was used to construct a phylogenetic tree using the maximum likelihood method, and the aligned sequences were bootstrapped till 1000 replicates were obtained [28].

2.4 Tissue-specific expression analysis of HcCPOX

Quantitative RT-PCR was used to detect the tissue-specific expression of HcCPOX in different tissues. Different tissues (fringe mantle, middle mantle, adductor muscle, gill, foot, hepatopancreas, and hemolymph) were obtained from 12 healthy H. cumingii (six white mussels and six purple mussels), and total RNA extraction was performed as described above. The PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, Dalian, China) was used to synthesize cDNA for qPCR analysis. Specific primers (Table 1) were designed based on the sequence of HcCPOX, and EF-1α (Table 1) was used as the internal reference [29]. qPCR was carried out in a quantitative thermal cycler (Bio-Rad CFX-96; Bio-Rad, USA), with the following parameters: 3 min at 95°C; then 40 cycles of 95°C for 5 s, 57.5°C for 30 s and 72°C for 30 s. Finally, tissue-specific expression of HcCPOX was analyzed using the comparative CT method (2−ΔΔCt) [30].

2.5 In situ hybridization of HcCPOX in the mantle

In situ hybridization was used to detect the precise locations of expression of HcCPOX in the mantle of purple mussels. First, the RNA probes were synthesized using the T7 in vitro Transcription Kit (Promega, USA), according to the manufacturer’s instructions. The mantle samples (including outer fold, middle fold, inner fold of the mantle) were then collected and fixed in 4% paraformaldehyde for 6 h at 4°C, and then placed in 20% sucrose overnight at 4°C [5, 7]. A freezing microtome (Leica CM 1950; Wetzlar, Germany) was used to slice mantle samples into 13-μm thicknesses and stored at −80°C. Finally, in situ hybridization was performed according to the manufacturer’s instructions (Enhanced Sensitive ISH Detection Kit, Boster, Switzerland).

2.6 Analysis of the coproporphyrinogen-III oxidase activity

Eight mussels (four white mussels and four purple mussels) were used to detect the coproporphyrinogen-III oxidase activity in H. cumingii. Tissues (gill, fringe mantle, middle mantle, hemolymph) were collected and enzyme activity analyses were performed using the Shellfish Coproporphyrinogen Oxidase ELISA Kit (LanPai, Shanghai, China) according to the manufacturer’s instructions. In brief, 300 mg of each tissue was comminuted in liquid nitrogen. Phosphate-buffered saline (PBS) was then added, centrifuged at 3000 rpm for 10 min at room temperature, and the supernatant was taken as a test sample. Then set standard wells (add 50 μl standard) and testing sample wells (add 10 μl test sample then add 40 μl sample diluent) in the microtiter plate, which pre-coated with CPOX antibody. Horseradish Peroxidase-conjugated reagent (100 μl) was added to each well, covered with an adhesive strip, and incubated for 60 min at 37°C. Each well was then washed with wash solution (400 μl) five times, with complete removal of liquid at each step. Chromogen solution A and B were then added (50 μl) to each well, and incubated for 15 min at 37°C in the dark. Finally, 50 μl of stop solution was added to each well and the O.D. at 450 nm was read using a microplate reader (UV-3010; Shimadzu, Japan). The CPOX activity of H. cumingii was obtained by comparing the O.D. of the samples with the standard curve.

2.7 RNAi assays

Specific primers (Table 1) were designed for double-stranded RNA (dsRNA) synthesis based on the sequence of HcCPOX. T7 RNA polymerase (TAATACGACTCACTATAGGG) was added to the 5′ end of the upstream and downstream primers. The PCR product was used for the synthesis of dsRNA using the T7 in vitro Transcription Kit (Promega, USA), according to the manufacturer’s instructions. Green fluorescent protein (GFP) dsRNA was synthesized as described above and used as the control group. Twenty-nine healthy purple mussels were divided equally into three groups (experimental group, negative control group, and blank group), and injected with dsHcCPOX (80 μg/100 μL), dsGFP (80 μg/100 μL) and 1 × PBS (100 μL) via the adductor muscle. Tissues (gill, fringe mantle, middle mantle, and hemolymph) from each mussel were collected after culturing in freshwater for one week. Finally, the expression of HcCPOX and the activity of CPOX in each tissue were detected as described above.

2.8 Statistical analysis

Data are shown as the mean ± SD, and a one-way ANOVA was performed using SPSS 17.0 (SPSS, Chicago, IL, USA) to determine whether there were any significant differences. A p-value < 0.05 was considered statistically significant.

3. Results

3.1 Cloning and sequence analysis of HcCPOX

The full-length cDNA of HcCPOX (Accession No. KX447817) was obtained by 3’- and 5’-RACE (S1 Fig). It contained a 3-bp 5’-UTR, an 1173-bp open reading frame (ORF) and a 346-bp 3’-UTR. The ORF encoded a polypeptide of 390 amino acids with a calculated molecular weight of 44.9 kDa and a theoretical isoelectric point of 8.26. The ORF also contained a coprogen-oxidase domain (PF01218). A phylogenetic tree was constructed and showed that the amino acid sequence of HcCPOX belonged to the same clade as CPOX from Meretrix meretrix, Mizuhopecten yessoensis, and Crassostrea gigas, with a support of 62% (Fig 2).
Fig 2

Phylogenetic analysis of HcCPOX from Hyriopsis cumingii and related species.

GenBank accession numbers: Crassostrea gigas (EKC32626.1), Mizuhopecten yessoensis (OWF48267.1), Meretrix meretrix (AMY96566.1), Hyriopsis cumingii (KX447817), Danio rerio (NP_001035183.2), Homo sapiens (NP_005247182.1), Mus musculus (NP_031783.2), Apis cerana cerana (PBC27150.1), Aplysia californica (AAP34327.1), and Penaeus vannamei (ROT62892.1). Numbers are the bootstrap values for 1000 trials.

Phylogenetic analysis of HcCPOX from Hyriopsis cumingii and related species.

GenBank accession numbers: Crassostrea gigas (EKC32626.1), Mizuhopecten yessoensis (OWF48267.1), Meretrix meretrix (AMY96566.1), Hyriopsis cumingii (KX447817), Danio rerio (NP_001035183.2), Homo sapiens (NP_005247182.1), Mus musculus (NP_031783.2), Apis cerana cerana (PBC27150.1), Aplysia californica (AAP34327.1), and Penaeus vannamei (ROT62892.1). Numbers are the bootstrap values for 1000 trials.

3.2 qPCR analysis and in situ hybridization

The relative expression level of HcCPOX in the tissues of white and purple mussels was detected by qPCR. As shown in Fig 3, HcCPOX was expressed in all tissues of white and purple mussels. In white mussels, the tissue with the highest expression was the gill, followed by the fringe mantle. The level of expression in gill and fringe mantle were significantly higher than that in other tissues (p < 0.05). No significant differences in the expression levels of HcCPOX in hemolymph, foot, and middle mantle were observed (p > 0.05). The expression of HcCPOX in the adductor muscle was significantly lower than that in the hepatopancreas (p < 0.05). In purple mussels, the highest level of HcCPOX expression was also in the gill, followed by the fringe mantle. The level of HcCPOX expression in the gill and fringe mantle was significantly higher than that in other tissues (p < 0.05). No significant differences were observed between HcCPOX expression in the foot and the hemolymph (p > 0.05). The levels of expression in the remaining tissues followed the order from high to low of middle mantle > hepatopancreas > adductor muscle (p < 0.05).
Fig 3

Relative expression of HcCPOX.

The relative expression of HcCPOX in various tissues from white (A) and purple (B) mussels. Comparisons of HcCPOX expression in white and purple mussels (C). FM, fringe mantle; MM, middle mantle; AM, adductor muscle; G, gill; F, foot; H, hepatopancreas; B, hemolymph. Bars with different letters or * indicate significant differences (p < 0.05), the same as below.

Relative expression of HcCPOX.

The relative expression of HcCPOX in various tissues from white (A) and purple (B) mussels. Comparisons of HcCPOX expression in white and purple mussels (C). FM, fringe mantle; MM, middle mantle; AM, adductor muscle; G, gill; F, foot; H, hepatopancreas; B, hemolymph. Bars with different letters or * indicate significant differences (p < 0.05), the same as below. Finally, comparing the expression levels of HcCPOX in different tissues of the two types of mussels, it was found that the expression of HcCPOX was higher in all tissues from purple mussels (with the exception of the middle mantle) than white mussels (p < 0.05). In situ hybridization revealed the specific locations of HcCPOX expression in the mantle. As shown in Fig 4, strong hybridization signals appeared in the dorsal epithelial cells of the outer fold of the mantle (arrowed), while no positive signals were detected in the negative control.
Fig 4

In situ hybridization analysis of HcCPOX in the mantle.

Panel B was a higher magnification of panel A. Panel C represents the negative control (using the sense probe). IF, inner fold; MF, middle fold; OF, outer fold. The arrows indicate the location of the positive signals.

In situ hybridization analysis of HcCPOX in the mantle.

Panel B was a higher magnification of panel A. Panel C represents the negative control (using the sense probe). IF, inner fold; MF, middle fold; OF, outer fold. The arrows indicate the location of the positive signals.

3.3 Coproporphyrinogen-III oxidase activity

As shown in Fig 5, CPOX activity in mussel tissues was consistent with the HcCPOX expression levels. CPOX activity was the highest is the gill, followed by the fringe mantle. Additionally, the activity of CPOX in the gill, fringe mantle, and foot of purple mussels was significantly higher than that of white mussels (p < 0.05), however, no significant differences were observed in the hemolymph (p > 0.05).
Fig 5

Coproporphyrinogen-III oxidase activity in tissues from white and purple mussels.

G, gill; FM, fringe mantle; F, foot; B, hemolymph.

Coproporphyrinogen-III oxidase activity in tissues from white and purple mussels.

G, gill; FM, fringe mantle; F, foot; B, hemolymph.

3.4 The impact of RNAi

HcCPOX expression levels and CPOX activities were detected after RNAi treatment. As shown in Fig 6A, the expression of HcCPOX in the gill, fringe mantle, foot, and hemolymph of the mussels injected with dsHcCPOX was significantly decreased compared to mussels injected with dsGFP and 1 × PBS (p < 0.05). However, the expression of HcCPOX in the tissues of mussels injected with dsGFP was not significantly different than that of mussels injected with 1× PBS (p > 0.05). Furthermore, CPOX activities in those tissues were also similar to the HcCPOX expression levels. After injection of dsHcCPOX, CPOX activities in all tissues were inhibited compared to that of mussels injected with dsGFP and 1 × PBS (p < 0.05). Additionally, no significant difference in CPOX activity was observed between mussels injected with dsGFP and 1 × PBS (p > 0.05) (Fig 6B).
Fig 6

Effects of HcCPOX knockdown by RNAi.

A, RNAi attenuated HcCPOX expression after RNAi. B, RNAi attenuated coproporphyrinogen-III oxidase activity after RNAi. G, gill; FM, fringe mantle; F, foot; B, hemolymph.

Effects of HcCPOX knockdown by RNAi.

A, RNAi attenuated HcCPOX expression after RNAi. B, RNAi attenuated coproporphyrinogen-III oxidase activity after RNAi. G, gill; FM, fringe mantle; F, foot; B, hemolymph.

4. Discussion

CPOX is an indispensable enzyme that is required for the synthesis of heme in different organisms. Some studies found that many different pigments (e.g., uroporphyrin, cobalamin, phorcabilin, biliverdin, and bilirubin) are produced in the synthesis and decomposition pathways of heme, which affect the shell color in Pinctada margaritifera [31]. If the heme synthesis pathway is affected, it may also lead to the formation of different shell colors in marine snails [20]. In this study, the CPOX gene (HcCPOX) from H. cumingii was successfully cloned. The amino acid sequence contained a coprogen-oxidase domain, which belongs to the conserved sequence of the coproporphyrinogen oxidase superfamily. Phylogenetic analysis also revealed that the HcCPOX amino acid sequence was in the same clade as CPOX sequences from shellfish (M. meretrix, M. yessoensis, and C. gigas). Therefore, the data suggested that HcCPOX belongs to the CPOX superfamily. The CPOX gene encodes porphyrinogen III oxidase in organisms, which catalyzes the formation of porphyrin substances via an oxidation reaction. Studies have found that porphyrin plays an important role in the synthesis of haem in the blood of mammals and mollusks [32, 33]. Williams et al. identified some genes of the haem pathway in marine snails, which affect shell color by participating in the synthesis of porphyrin [20]. Moreover, similar results were also found in P. margaritifera [31]. In a study in which the CPOX gene was knocked out in zebrafish, it was found that the hemolymph changed from red to nearly colorless, thus, indicating that CPOX gene is involved in the formation of hemolymph color (heme) in zebrafish [34]. H. cumingii is a bivalve mollusk, and its hemolymph is typically nearly colorless, which occasionally appears light blue after being fully oxidized. This color change is mainly caused by the small amount of hemocyanin contained within its hemolymph [35]. Combined with the qPCR results, we found that HcCPOX was expressed in hemolymph, but only a low levels. This may be due to its colorless hemolymph. In addition, there was no significant difference in CPOX activity in the hemolymph of white and purple mussels, and was much lower than that in the gill and fringe mantle. The expression of HcCPOX in white and purple mussels was highest in the gills. Similar results were also obtained for CPOX activities. Cooper et al. found that the gills of mussels were the main locations for the uptake of metal ions from water environments [36]. The high levels of HcCPOX expression in the gill may be due to high level of metal ions contained therein, and gill may provide a suitable environment for the synthesis of metalloporphyrins, and then porphyrins transferred to the mantle. Comfort et al. indicated that metalloporphyrin is a key substance in the formation of color in shells [37]. Shi et al. found that a variety of metal ions exist in the pearls of H. cumingii by Raman spectroscopy, and speculated that they might affect the shell color in the form of metalloporphyrin [22]. The mantle is the tissue responsible for the nacre formation of shells and pearls. The qPCR results found that the levels of HcCPOX in the fringe mantle of white and purple mussels was high, and only lower than that of the gill. Moreover, positive signals were detected in the dorsal epithelial cells of the outer fold of the mantle using in situ hybridization. Studies indicated that outer fold of the mantle was directly involved in the nacre formation of shells [38]. Thus, these results suggested that HcCPOX may be involved in the formation of nacre in H. cumingii. Zhan et al. found that the CPOX gene (MmCPOX) in M. meretrix was highly expressed in the mantle, and expression was positively correlated with shell color [23]. The uroporphyrinogen III synthetase (an important enzyme involved in the structural formation of porphyrin) gene was found to be involved in nacre color formation in H. cumingii [39]. In this study, the expression of HcCPOX in tissues of white and purple mussels were compared. The result revealed that the expression levels of HcCPOX were significantly higher in all tissues of purple mussels (except the middle mantle) than in white mussels. We also found that the CPOX activity in the tissues (fringe mantle, gill, and foot) of purple mussels were also significantly higher than that in white mussels. The RNAi experiments revealed that the activity CPOX was decreased following the inhibition of HcCPOX expression in all tissues. Therefore, we hypothesize that HcCPOX might affect nacre color formation by participating in the synthesis of CPOX. In conclusion, the results of this study indicate that HcCPOX contributes to nacre color formation in H. cumingii. Such findings can help understand the mechanisms underlying the formation of pearl color, and assist in the cultivation of high quality pearls.

Full-length nucleotide sequence and deduced amino acid sequence of the HcCPOX (Gene accession is KX447817).

The gray box indicates the predicted coprogen-oxidase domain. (DOCX) Click here for additional data file.
  23 in total

1.  Mollusk shell formation: a source of new concepts for understanding biomineralization processes.

Authors:  Lia Addadi; Derk Joester; Fabio Nudelman; Steve Weiner
Journal:  Chemistry       Date:  2006-01-23       Impact factor: 5.236

2.  A theory of ion permeation through membranes with fixed neutral sites.

Authors:  P H Barry; J M Diamond
Journal:  J Membr Biol       Date:  1971-12       Impact factor: 1.843

3.  Complex formation between porphyrins and metal ions.

Authors:  B F Burnham; J J Zuckerman
Journal:  J Am Chem Soc       Date:  1970-03-25       Impact factor: 15.419

4.  Cloning, differential tissue expression of a novel hcApo gene, and its correlation with total carotenoid content in purple and white inner-shell color pearl mussel Hyriopsis cumingii.

Authors:  Xilei Li; Zhiyi Bai; Hongrui Luo; Yue Liu; Guiling Wang; Jiale Li
Journal:  Gene       Date:  2014-01-29       Impact factor: 3.688

5.  HcTyr and HcTyp-1 of Hyriopsis cumingii, novel tyrosinase and tyrosinase-related protein genes involved in nacre color formation.

Authors:  Xiajun Chen; Xiaojun Liu; Zhiyi Bai; Liting Zhao; Jiale Li
Journal:  Comp Biochem Physiol B Biochem Mol Biol       Date:  2016-11-10       Impact factor: 2.231

Review 6.  Structure-function relationships in heme-proteins.

Authors:  Massimo Paoli; Jon Marles-Wright; Ann Smith
Journal:  DNA Cell Biol       Date:  2002-04       Impact factor: 3.311

7.  Spatial analysis of biomineralization associated gene expression from the mantle organ of the pearl oyster Pinctada maxima.

Authors:  Luke D Gardner; David Mills; Aaron Wiegand; David Leavesley; Abigail Elizur
Journal:  BMC Genomics       Date:  2011-09-21       Impact factor: 3.969

8.  Colorful seashells: Identification of haem pathway genes associated with the synthesis of porphyrin shell color in marine snails.

Authors:  Suzanne T Williams; Anne E Lockyer; Patricia Dyal; Tomoyuki Nakano; Celia K C Churchill; Daniel I Speiser
Journal:  Ecol Evol       Date:  2017-10-30       Impact factor: 2.912

9.  Chemical evidence of rare porphyrins in purple shells of Crassostrea gigas oyster.

Authors:  Michel Bonnard; Sonia Cantel; Bruno Boury; Isabelle Parrot
Journal:  Sci Rep       Date:  2020-07-22       Impact factor: 4.379

10.  Molecular Pathways and Pigments Underlying the Colors of the Pearl Oyster Pinctada margaritifera var. cumingii (Linnaeus 1758).

Authors:  Pierre-Louis Stenger; Chin-Long Ky; Céline Reisser; Julien Duboisset; Hamadou Dicko; Patrick Durand; Laure Quintric; Serge Planes; Jeremie Vidal-Dupiol
Journal:  Genes (Basel)       Date:  2021-03-15       Impact factor: 4.096

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.