| Literature DB >> 35309930 |
Jaione Lasa-Elgarresta1,2, Laura Mosqueira-Martín1,2, Klaudia González-Imaz2, Pablo Marco-Moreno2, Gorka Gerenu2,3,4, Kamel Mamchaoui5, Vincent Mouly5, Adolfo López de Munain1,2,3, Ainara Vallejo-Illarramendi1,2,3.
Abstract
LGMDR1 is caused by mutations in the CAPN3 gene that encodes calpain 3 (CAPN3), a non-lysosomal cysteine protease necessary for proper muscle function. Our previous findings show that CAPN3 deficiency leads to reduced SERCA levels through increased protein degradation. This work investigates the potential contribution of the ubiquitin-proteasome pathway to increased SERCA degradation in LGMDR1. Consistent with our previous results, we observed that CAPN3-deficient human myotubes exhibit reduced SERCA protein levels and high cytosolic calcium concentration. Treatment with the proteasome inhibitor bortezomib (Velcade) increased SERCA2 protein levels and normalized intracellular calcium levels in CAPN3-deficient myotubes. Moreover, bortezomib was able to recover mutated CAPN3 protein in a patient carrying R289W and R546L missense mutations. We found that CAPN3 knockout mice (C3KO) presented SERCA deficits in skeletal muscle in the early stages of the disease, prior to the manifestation of muscle deficits. However, treatment with bortezomib (0.8 mg/kg every 72 h) for 3 weeks did not rescue SERCA levels. No change in muscle proteasome activity was observed in bortezomib-treated animals, suggesting that higher bortezomib doses are needed to rescue SERCA levels in this model. Overall, our results lay the foundation for exploring inhibition of the ubiquitin-proteasome as a new therapeutic target to treat LGMDR1 patients. Moreover, patients carrying missense mutations in CAPN3 and presumably other genes may benefit from proteasome inhibition by rescuing mutant protein levels. Further studies in suitable models will be necessary to demonstrate the therapeutic efficacy of proteasome inhibition for different missense mutations.Entities:
Keywords: LGMD2A; SERCA1; SERCA2; bortezomib (BTZ); calcium; calpain 3 (CAPN3); muscular dystrophies
Year: 2022 PMID: 35309930 PMCID: PMC8924035 DOI: 10.3389/fcell.2022.822563
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
Sequence of primers used for real-time qPCR analysis.
| Gene | Forward primer | Reverse primer |
|---|---|---|
|
| TACGATGAGATCACAGCCATGAC | ATCCCATGGCAATGCCAAT |
|
| AAAGCTAAAGACATAGTTCCTGGTGAT | AGCAGGACTTTGTCACCAACA |
|
| CTGTTCAAAGGTGAGAAGGTGAAG | AGCTCCAGTCCTTCCAACCAT |
|
| CCTCATCAACTATGTCACCAGCAT | CCACCATCACCTCAAAGTACCATT |
|
| GAAGCTCTCTGTGGAAGCTCTCA | CCTTCTCCGTCATGCTCTTCA |
|
| GCCATCTCCGTGGTGAAGAT | CACTGCACCACGTGCTTCA |
|
| ACAGGGCAAAAACTGCCAAA | CGCAGTGCCTTGTTGACATT |
|
| CATGGACTAATTATGGACAGGACTGA | TGAGCACACAGAGGGCTACAA |
FIGURE 1Effect of UPS inhibition in 8220 CAPN3-deficient human myotubes. (A) Representative bright-field images of human control (NS-shRNA) and CAPN3 knockdown (shCAPN3) myotubes after 5 days in differentiation. Treatment with 5 nM BTZ was performed for 24 h where indicated. Scale bar: 50 μm. (B) Western blot analysis of Ca2+-handling proteins in control and CAPN3-deficient cells treated or not with BTZ. White line depicts non-continuous lanes within the same blot. Protein signals are normalized to MyHC and expressed as fold change over each control (NS-shRNA), which is represented as a discontinuous line in the bar chart. Data are expressed as mean fold-change ± SEM of n = 3 independent experiments; **p < 0.01 vs. non-treated shCAPN3 (ratio paired t-test). (C) Analysis of mRNA expression in CAPN3-deficient myotubes with or without BTZ treatment. Data expressed as mean fold-change ± SEM over NS-shRNA. n = 3 independent experiments (one-way ANOVA post hoc Tukey’s multiple comparisons test). (D) Representative pseudocolored images of human myotubes (NS-shRNA, shCAPN3, and shCAPN3 treated with BTZ) loaded with Fura-2AM. Scale bar: 25 μm. (E) Bar chart shows the resting intracellular calcium levels of human myotubes. Data expressed as mean % over NS-shRNA ± SEM based on calcium concentration levels. Dots represent individual experiments (n = 5) with a total of 120–160 myotubes analyzed per group (one-way ANOVA post hoc Dunnett’s multiple comparisons test).
FIGURE 2Effect of UPS inhibition in myotubes from LGMDR1 patients. (A) Representative bright-field images showing immortalized human myotubes from a control and two LGMDR1 patients (LG1 and LG2) after 5 days in differentiation. Scale bar: 50 μm. (B) Cumulative distribution of myotube width from control, LG1 and LG2 myotubes. 90–170 myotubes analyzed from n = 3 independent experiments. Data are expressed as mean % ± SEM (two-way ANOVA test). (C) Western blot analysis of CAPN3, SERCA1, SERCA2, RyR1, and DHPRɑ2. Quantification of protein signals is shown below each blot, represented as fold change over control. (D) qPCR expression analysis of Ca2+-handling proteins in myotubes from control and LGMDR1 patients, treated or not with BTZ. Data are expressed as mean ± SEM. n = 3 independent experiments. *p < 0.05, One-way ANOVA post hoc Tukey’s multiple comparisons test. (E) Representative western blot signals from LG1 and LG2 myotubes treated with 5 nM BTZ for 24 h after 5 days of differentiation and their quantification. Protein signals are normalized to total protein (gel load) and represented by fold change over non-treated LGMDR1 myotubes. Non-treated LGMDR1 SERCA expression levels are shown as a discontinuous line.
FIGURE 3Characterization of early features in preclinical C3KO mice. (A) Grip strength normalized to body weight. Data expressed as mean ± SEM. n = 8 2-month-old male mice for each genotype (Mann-Whitney test). (B) Distance until exhaustion during forced exercise. Data expressed as mean ± SEM, n = 5 mice per group (Mann-Whitney test). (C) Serum creatine kinase (CK) levels. Data are expressed as mean ± SEM. n= 4 mice per group (Mann-Whitney test). (D) Resting intracellular calcium levels of fibers isolated from flexor digitorum brevis muscles. Data expressed as mean ± SEM. 115-155 fibers analyzed from n = 4 mice per group (Mann-Whitney test). (E,F) Western blot analyses of SERCA proteins normalized to MyHC in soleus (E) and diaphragm (F) muscles. Data are expressed as mean fold change ± SEM of n = 8 mice per genotype.**p < 0.01, ***p < 0.001 vs. control (Mann-Whitney test). Dots in the bar charts represent data from one mouse.
FIGURE 4Effect of BTZ on C3KO mice. (A) Body weight evolution during BTZ treatment of 9-month-old mice. Data are presented as mean ± SEM. n = 10 non-treated wild-type mice (Control), n = 9 vehicle-treated C3KO mice (C3KO), and n = 7 BTZ-treated (0.8 mg/kg) C3KO mice (C3KO BTZ). (Two-way ANOVA post hoc Tukey’s multiple comparisons test. (B) Hematoxylin and eosin staining images from WT, C3KO ND and C3KO BTZ diaphragm muscle samples. Scale bars: 100 μm for lower magnification images, and 50 μm for insets. (C) Ubiquitin proteasome activity measured by fluorometric enzymatic assay in muscles from control, non-treated C3KO and BTZ-treated C3KO mice. Data represented as mean % over control ± SEM. BTZ positive control levels are shown as a discontinuous line. n = 6 control; n = 3 C3KO ND; n = 3 BTZ-treated C3KO mice (Kruskal-Wallis post hoc Dunn’s multiple comparisons test). (D) Western blot analysis of Ca2+-handling proteins in diaphragms from Control, C3KO and BTZ-treated (0.8 mg/kg) mice. Protein signals were normalized to total protein (gel load). (E) Quantification of SERCA1, SERCA2, and p-CaMKII protein levels normalized to total protein. Data expressed as mean fold-change ± SEM. n = 5–9 per group (Kruskal-Wallis post hoc Dunn’s multiple comparisons test).
FIGURE 5Model of BTZ effect on CAPN3-deficient muscle fibers. CAPN3 deficiency induces increased ubiquitination and degradation of SERCA through the ubiquitin proteasome pathway (UPS). Bortezomib inhibits proteasome activity and thus degradation of SERCA proteins. However, BTZ also strongly inhibits SERCA1 expression at the mRNA level, so that BTZ rescue is mostly observed on SERCA2 proteins. On the other hand, BTZ is able to rescue mutant CAPN3 protein levels carrying missense mutations.