| Literature DB >> 35299953 |
Yudong Shen1, Qishuai Wang1, Weimin Wang1, Yanhe Li1.
Abstract
Many economic crustacean species have sex dimorphisms during their growth. Exploring the sex determination system and developing sex-specific molecular marker(s) are very helpful for carrying out sex control breeding, and next-generation sequencing has been used as an efficient way to explore them in recent years. In this study, first, the genetic sex determination system of P. clarkii was explored as an XX/XY system by analyzing the 2b-RAD sequencing data. Furthermore, DNA samples of male and female individuals from a P. clarkii family were pooled separately for whole-genome resequencing. Based on the data of whole-genome resequencing, the 9,163 male- and female-specific bias sites with higher feasibility were obtained based on the assumption of the XX/XY sex determination system, and four sites were selected to design the sex-specific marker primers. One efficient sex-specific marker was identified with a sex discrimination rate of 99.49% (195/196) when applied to five different geographical groups with 196 individuals. The results of this study would provide a foundation for the realization of P. clarkii sex control and could provide some reference for investigating the sex determination system and sex molecular marker(s) of other crustacean species based on next-generation sequencing data.Entities:
Keywords: Procambarus clarkii; genetic sex; next-generation sequencing; sex determination system; sex-specific markers
Year: 2022 PMID: 35299953 PMCID: PMC8923706 DOI: 10.3389/fgene.2022.850983
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primers for developing PCR-based sex-specific molecular markers.
| Primer name | Sequence | Product length | Location |
|---|---|---|---|
| Marker1_F | CACTTTTGTTCCGGCAATACTTCT | 300–400 bp | Scaffold 38:18680471 |
| Marker1_R | ATTCACCTGGACTTTATGGGTTGA | ||
| Marker3_F | CTTCCACTTTTGTTCCGGCAATAC | 300–400 bp | Scaffold 38:18680471 |
| Marker3_R | ACCTGGACTTTATGGGTTGAGTTA | ||
| Marker6_F | AGTACGAGTATGACACTGGTTCAC | 300–400 bp | Scaffold 38:17791823 |
| Marker6_R | TATGGCATATACATCGTCACCGTC | ||
| Marker7_F | CGAGTATGACACTGGTTCACCAAT | 300–400 bp | Scaffold 38:17791823 |
| Marker7_R | CATATACATCGTCACCGTCCCTG |
FIGURE 1Schematic diagram of the overall research framework for exploring the sex determination system based on next-generation sequencing data.
Statistics results of the reads of whole-genome resequencing.
| Sample | Clean reads | Clean base | Read length (bp) | Q20 (%) | GC content (%) | Depth_mean | Coverage (%) |
|---|---|---|---|---|---|---|---|
| Males | 854,329,136 | 128,149,370,400 | 150 | 95.60 | 41.97 | 57.81 | 97.52 |
| Females | 841,301,244 | 126,195,186,600 | 150 | 95.92 | 41.84 | 56.83 | 97.53 |
FIGURE 2Schematic diagram of design principles of the sex-specific marker primers.
FIGURE 3External form of P. clarkii sex and PCR detection. (A) External form of P. clarkii sex and PCR detection of female and male individuals. (B) PCR detection of 30 females and 30 males of P. clarkii by the primer pair Marker7_F/R. M, D 2000 DNA marker; C, negative control.