| Literature DB >> 35295950 |
Yue Li1,2, Xueru Liu1,2, Wenyue Zhang1,2, Xuefei Song1,2, Leilei Zhang1,2, Caiwen Xiao1,2.
Abstract
This study was designed to identify differently expressed circular RNAs (circRNAs) and investigate their potential roles in lacrimal sacs from patients with chronic dacryocystitis. The lacrimal sac samples of three chronic dacryocystitis patients and three control subjects were collected for RNA sequencing after ribosomal RNA was depleted. Differently expressed circRNAs and messenger RNAs (mRNAs) were used for co-expression analysis. CircRNA-microRNA (miRNA)-mRNA interaction network were also established by miRanda software. Meanwhile, pathway and functional enrichment analysis were conducted for the down- and up-regulated mRNAs in the circRNA-mRNA co-expression network. The expression levels of circRNAs and mRNAs in chronic dacryocystitis and control samples were validated by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). In all the 3,909 circRNAs predicted through RNA sequencing, 25 circRNAs (20 up-regulated and 5 down-regulated) expressed differently in chronic dacryocystitis samples. Besides, there identified 1,486 differentially expressed mRNAs. Of these differently expressed circRNAs and mRNAs, eight were validated by qRT-PCR, including MYH2, DSP, CD27, CCL5, FN1, has_circ_0004792, has_circ_0001062, and has_circ_0115476. Gene Ontology (GO) analysis indicated that the majority of altered mRNAs in this co-expression network were involved in immune system processes and meanwhile Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis revealed that these altered expressed mRNAs were also amplified in bacterial invasion of epithelial cells, both of which were thought to be involved in the pathogenesis of chronic dacryocystitis. In the circRNA-miRNA-mRNA interaction network, six circRNAs were found to be related to Th1 and Th2 cell differentiation, which was closely associated with the development of chronic dacryocystitis. This study identified statistically significant differences between circRNAs and mRNAs of lacrimal sac samples of chronic dacryocystitis patients and control individuals and provides novel insight into the regulatory mechanism of circRNAs, miRNAs, and mRNAs in the pathogenesis of chronic dacryocystitis.Entities:
Keywords: CirRNA; RNA sequnce; chronic dacryocystitis; competing endogenous RNA; pathogenesis
Year: 2022 PMID: 35295950 PMCID: PMC8918544 DOI: 10.3389/fgene.2022.834111
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primer sequences for quantitative real-time polymerase chain reaction (qRT-PCR) analysis.
| Gene symbol | Forward primer | Reverse primer | Product length (bp) |
|---|---|---|---|
| CD27 | TGCAGAGCCTTGTCGTTACAG | GCTCCGGTTTTCGGTAATCCT | 83 |
| CCL5 | TGCTGCTTTGCCTACATTGC | CTTGTTCAGCCGGGAGTCAT | 168 |
| MYH2 | CTGAGGGAGGAGCGACTCT | CTCGGGCTTATACACAGGCA | 224 |
| DSP | GGAGAACCTTGGTTGGCAGA | TTCATATTCTCTCTTCCGGGTG | 118 |
| FN1 | CGGTGGCTGTCAGTCAAAG | AAACCTCGGCTTCCTCCATAA | 130 |
| GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG | 197 |
| has_circ_0115476 | CACCCGAACACCATTCACAG | TTTCTAGCTCCTCGTCCGTC | 181 |
| has_circ_0004792 | CGGGAGGAGAATGACAAGGA | TCACGTTCTTCTGATGGCCT | 162 |
| has_circ_0001062 | TCCAAAAGGAGAAAACGTGAGA | TCTGCTTTTCATTCTCTTTTGCT | 119 |
Demographic data of chronic dacryocystitis and control groups.
| Case | Age (years) | Gender | Disease | Side | Lacrimal duct irrigation within 1 month | Eye drops within 1 month |
|---|---|---|---|---|---|---|
| 1 | 44 | F | Chronic dacryocystitis | L | No | No |
| 2 | 61 | F | Chronic dacryocystitis | R | No | No |
| 3 | 50 | M | Chronic dacryocystitis | R | No | No |
| 4 | 51 | F | Chronic dacryocystitis | L | No | No |
| 5 | 44 | M | Chronic dacryocystitis | L | No | No |
| 6 | 53 | F | Chronic dacryocystitis | L | No | No |
| 7 | 50 | M | Chronic dacryocystitis | L | No | No |
| 8 | 55 | F | Chronic dacryocystitis | R | No | No |
| 9 | 63 | F | Chronic dacryocystitis | R | No | No |
| 10 | 50 | F | Orbital trauma | R | No | No |
| 11 | 54 | F | Orbital trauma | R | No | No |
| 12 | 53 | M | Orbital trauma | L | No | No |
| 13 | 53 | M | Orbital trauma | R | No | No |
| 14 | 45 | F | Orbital trauma | L | No | No |
| 15 | 55 | F | Orbital trauma | R | No | No |
| 16 | 53 | M | Orbital trauma | L | No | No |
| 17 | 47 | M | Orbital trauma | L | No | No |
| 18 | 43 | F | Orbital trauma | R | No | No |
F, female; M, male; L, left eye; R, right eye; mean age, 52.3 ± 6.6 (chronic dacryocystitis), 50.3 ± 4.3 (orbital trauma).
FIGURE 1Clinical manifestation of chronic dacryocystitis patients. (A–D) Representative clinical characteristics of patients with chronic dacryocystitis. (E,F) Representative computed tomography-dacryocystography (CT-DCG) images of patients with chronic dacryocystitis.
FIGURE 2Prediction of circRNAs in the lacrimal sac samples through high-throughput RNA sequencing. (A) The number of circRNAs predicted in lacrimal sac samples from chronic dacryocystitis patients (CD1, CD2, and CD3) and control individuals (N1, N2, and N3). (B) Venn diagram for predicted circRNAs. (C) CircRNA length distribution. (D) CircRNA chromosome distribution. (E) Box plots of counts of exon model per million mapped reads (CPM) values of circRNAs in each lacrimal sac sample.
FIGURE 3mRNA expression profiles in chronic dacryocystitis and control groups. (A,B) Differentially expressed mRNAs between in lacrimal sac samples from chronic dacryocystitis patients (CD1, CD2, and CD3) and control individuals (N1, N2, and N3). (C) Chromosome distribution of differently expressed mRNAs. (D) Hierarchical clustering analysis of differentially expressed mRNAs in chronic dacryocystitis and normal lacrimal sac samples.
FIGURE 4CircRNA expression profiles in chronic dacryocystitis and control groups. (A,B) Differentially expressed circRNAs between in lacrimal sac samples from chronic dacryocystitis patients (CD1, CD2, and CD3) and control individuals (N1, N2, and N3). (C,D) Chromosome distribution of up- and down-regulated circRNAs. (E) Hierarchical clustering analysis of differentially expressed circRNAs in chronic dacryocystitis and normal lacrimal sac samples.
FIGURE 5CircRNA-mRNA co-expression network of differentially expressed mRNAs and dysregulated circRNAs. Triangles represent dysregulated circRNAs. Round dots in red represent up-regulated mRNAs, round dots in green represent down-regulated mRNAs. Black lines represent correlations between circRNAs and mRNAs.
FIGURE 6Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis for mRNAs in the circRNA-mRNA co-expression network. (A, B) The top 45 GO terms of biological process (BP), cellular component (CC) and molecular function (MF) categories for up-regulated mRNAs (A) and down-regulated mRNAs (B). (C,D) The top 15 KEGG pathways of upregulated mRNAs (C) and downregulated mRNAs (D).
The top 30 Gene Ontology (GO) terms for up- and down-regulated mRNAs in the circRNA-mRNA co-expression network in biological process (BP), cellular component (CC), and molecular function (MF) categories.
| mRNAs | ID | Term | Category | Count |
| Enrichment score | Gene |
|---|---|---|---|---|---|---|---|
| Up-regulated | GO:0002376 | Immune system process | BP | 65 | 6.71E-19 | 18.17 | ITGAM; C5AR1; FCN1; MNDA; PSMD14; CLEC4D; ICAM2; RNASE2; SELENOK; CSF1R; PLEK; CTSL; PRKCB; LAT2; RIPK2; CD3E; MFNG; BATF; CCR2; FPR1; NCF1; WAS; TLR9; BST2; CD33; NRROS; PTAFR; SEMA7A; TNFSF12; C1QB; C2; RAB32; IFI30; ADD2; IKZF1; HHEX; LYL1; MMP9; CD22; CD300LF; SLC7A11; UBD; NFATC1; RAC2; PIK3R6; COTL1; ARSB; P2RX1; LPCAT1; DOK3; CNPY3; RNF166; TNFAIP8L2; PSTPIP1; GBP5; TRIB1; KLF13; RASSF2; COL1A1; PILRA; THEMIS2; IFNAR2; OAS3; MPP1; TMEM176A |
| GO:0006955 | Immune response | BP | 52 | 7.70E-17 | 16.11 | FCN1; MNDA; PSMD14; CLEC4D; ICAM2; RNASE2; CTSL; PRKCB; LAT2; RIPK2; CD3E; MFNG; FPR1; C5AR1; WAS; CCR2; BST2; CD33; C1QB; C2; UBD; NFATC1; PIK3R6; RAC2; COTL1; ITGAM; ARSB; MMP9; P2RX1; PTAFR; LPCAT1; DOK3; BATF; CNPY3; RNF166; CSF1R; TLR9; NCF1; TNFAIP8L2; PSTPIP1; GBP5; COL1A1; CD300LF; PILRA; CD22; THEMIS2; IFI30; OAS3; IFNAR2; SEMA7A; NRROS; TNFSF12 | |
| GO:0001775 | Cell activation | BP | 41 | 5.45E-16 | 15.26 | ITGAM; C5AR1; CLEC4D; MFNG; PLEK; IKZF1; COL1A1; PIK3R6; PIK3R5; P2RX1; PRKCB; HHEX; LYL1; CD3E; CD22; MNDA; TLR9; CD300LF; RIPK2; SELENOK; WAS; BST2; LAT2; RAC2; UBD; BATF; CCR2; PSMD14; FCN1; COTL1; FPR1; ARSB; MMP9; PTAFR; RNASE2; LPCAT1; DOK3; CD33; CTSL; TNFAIP8L2; SLC7A11 | |
| GO:0045321 | Leukocyte activation | BP | 37 | 1.54E-14 | 13.81 | ITGAM; C5AR1; CLEC4D; MFNG; IKZF1; HHEX; LYL1; CD3E; CD22; MNDA; TLR9; CD300LF; RIPK2; SELENOK; WAS; PRKCB; BST2; LAT2; RAC2; UBD; BATF; CCR2; PSMD14; FCN1; COTL1; FPR1; ARSB; MMP9; P2RX1; PTAFR; RNASE2; LPCAT1; DOK3; CD33; CTSL; PIK3R6; TNFAIP8L2 | |
| GO:0002682 | Regulation of immune system process | BP | 40 | 1.04E-13 | 12.98 | FCN1; MNDA; PSMD14; CLEC4D; ICAM2; SELENOK; FPR1; C5AR1; WAS; TLR9; CD3E; CCR2; BST2; CD33; C1QB; C2; CSF1R; CD22; CD300LF; SLC7A11; RIPK2; NFATC1; LAT2; RAC2; PIK3R6; ITGAM; PTAFR; GBP5; PRKCB; TRIB1; KLF13; RASSF2; COL1A1; PILRA; THEMIS2; TNFAIP8L2; IFNAR2; SEMA7A; MPP1; TMEM176A | |
| GO:0050776 | Regulation of immune response | BP | 30 | 2.97E-12 | 11.53 | FCN1; MNDA; PSMD14; CLEC4D; ICAM2; FPR1; C5AR1; WAS; CCR2; BST2; CD33; C1QB; C2; NFATC1; LAT2; PIK3R6; RAC2; ITGAM; PTAFR; GBP5; RIPK2; CD3E; THEMIS2; PRKCB; CD22; IFNAR2; SEMA7A; COL1A1; CD300LF; PILRA | |
| GO:0002252 | Immune effector process | BP | 33 | 8.50E-12 | 11.07 | FCN1; SELENOK; CLEC4D; MFNG; WAS; TLR9; CCR2; BST2; C1QB; C2; C5AR1; PIK3R6; LAT2; RAC2; PSMD14; COTL1; FPR1; ITGAM; ARSB; MMP9; MNDA; P2RX1; PTAFR; RNASE2; LPCAT1; DOK3; CD33; BATF; RIPK2; CD22; IFNAR2; OAS3; SEMA7A | |
| GO:0006952 | Defense response | BP | 39 | 1.29E-11 | 10.89 | ITGAM; C5AR1; FCN1; MNDA; PSMD14; CLEC4D; ICAM2; RNASE2; SELENOK; P2RX1; GBP5; CSF1R; FPR1; NRROS; TLR9; PTAFR; CCR2; SEMA7A; RIPK2; PSTPIP1; THEMIS2; NCF1; UBD; BST2; PIK3R6; BATF; CNPY3; RNF166; C1QB; C2; TNFAIP8L2; ACP5; COTL1; IFNAR2; OAS3; IFI30; WAS; MMP9; PTPRCAP | |
| GO:0098542 | Defense response to other organism | BP | 31 | 3.67E-11 | 10.43 | FCN1; MNDA; PSMD14; CLEC4D; ICAM2; RNASE2; SELENOK; UBD; BST2; PIK3R6; TLR9; BATF; CNPY3; RNF166; CSF1R; ITGAM; NCF1; C1QB; C2; TNFAIP8L2; RIPK2; PSTPIP1; GBP5; ACP5; C5AR1; COTL1; IFNAR2; OAS3; IFI30; PTAFR; WAS | |
| GO:0002274 | Myeloid leukocyte activation | BP | 23 | 5.25E-11 | 10.28 | ITGAM; C5AR1; CLEC4D; CD300LF; UBD; BATF; LAT2; RAC2; CCR2; PSMD14; FCN1; COTL1; FPR1; ARSB; MMP9; MNDA; P2RX1; PTAFR; RNASE2; BST2; LPCAT1; DOK3; CD33 | |
| GO:0031410 | Cytoplasmic vesicle | CC | 37 | 3.33E-07 | 6.48 | MVB12B; TLR9; RAB32; CD22; CTSL; BST2; STX11; NECAP2; SIPA1; TMED5; RGS19; COL1A1; FPR1; P2RX1; PTAFR; C5AR1; DOK3; RAC2; SPARC; NCF1; PSMD14; FCN1; COTL1; LPCAT1; ARSB; MNDA; RNASE2; CLEC4D; ITGAM; CD33; WAS; FCHSD1; LAMTOR4; MMP9; GBP5; ADD2; RUBCNL | |
| GO:0097708 | Intracellular vesicle | CC | 37 | 3.47E-07 | 6.46 | MVB12B; TLR9; RAB32; CD22; CTSL; BST2; STX11; NECAP2; SIPA1; TMED5; RGS19; COL1A1; FPR1; P2RX1; PTAFR; C5AR1; DOK3; RAC2; SPARC; GBP5; ADD2; RUBCNL; NCF1; PSMD14; FCN1; COTL1; LPCAT1; ARSB; MNDA; RNASE2; CLEC4D; ITGAM; CD33; WAS; FCHSD1; LAMTOR4; MMP9 | |
| GO:0030141 | Secretory granule | CC | 20 | 6.41E-07 | 6.19 | FPR1; P2RX1; PTAFR; C5AR1; DOK3; SPARC; PSMD14; FCN1; COTL1; BST2; LPCAT1; ARSB; MNDA; RNASE2; CLEC4D; ITGAM; CD33; CTSL; MMP9; COL1A1 | |
| GO:0099503 | Secretory vesicle | CC | 21 | 2.40E-06 | 5.62 | STX11; COL1A1; FPR1; P2RX1; PTAFR; C5AR1; DOK3; SPARC; PSMD14; FCN1; COTL1; BST2; LPCAT1; ARSB; MNDA; RNASE2; CLEC4D; ITGAM; CD33; CTSL; MMP9 | |
| GO:0030667 | Secretory granule membrane | CC | 11 | 5.11E-06 | 5.29 | SPARC; FPR1; BST2; LPCAT1; CLEC4D; ITGAM; P2RX1; CD33; PTAFR; DOK3; C5AR1 | |
| GO:0031982 | Vesicle | CC | 46 | 4.40E-05 | 4.36 | MVB12B; TLR9; RAB32; CD22; CTSL; BST2; STX11; WAS; NECAP2; SIPA1; TMED5; RGS19; COL1A1; FPR1; P2RX1; PTAFR; C5AR1; DOK3; RAC2; SPARC; GBP5; ADD2; RUBCNL; NCF1; PSMD14; FCN1; COTL1; LPCAT1; ARSB; MNDA; RNASE2; CLEC4D; ITGAM; CD33; FCHSD1; PILRA; RPSA; LDHB; MMP9; PRKCB; BLVRA; C2; LAT2; LAMTOR4; MYO1F; RIPK2 | |
| GO:0070820 | Tertiary granule | CC | 7 | 9.86E-05 | 4.01 | CLEC4D; ITGAM; PTAFR; CD33; FPR1; DOK3; MMP9 | |
| GO:0062023 | Collagen-containing extracellular matrix | CC | 11 | 1.09E-04 | 3.96 | COL1A1; SPARC; CTSL; FCN1; FMOD; MFAP2; MMP9; C1QB; EMILIN2; SEMA7A; ADAM19 | |
| GO:0101002 | Ficolin-1-rich granule | CC | 6 | 1.59E-04 | 3.80 | PSMD14; FCN1; COTL1; ARSB; MMP9; MNDA | |
| GO:1904813 | Ficolin-1-rich granule lumen | CC | 6 | 1.59E-04 | 3.80 | PSMD14; FCN1; COTL1; ARSB; MMP9; MNDA | |
| GO:0005515 | Protein binding | MF | 109 | 2.04E-04 | 3.69 | STX11; NFATC1; FAM89B; FCN1; FPR1; ITGAM; C5AR1; RGS19; RIC8A; CTSL; COL1A1; ADD2; VASH1; COTL1; MYO1F; WAS; RPSA; PLEK; PRKCB; LAMTOR4; CNPY3; TNFSF12; RIPK2; CD22; CD300LF; TLR9; ICAM2; SEMA7A; KIF26B; IFT52; SIPA1; PSTPIP1; TRIB1; HHEX; NCF1; ADAM19; CD3E; IFNAR2; RAC2; CSF1R; CD33; IKZF1; CCR2; RAB32; TUBA1B; UBE2L6; CLEC4D; LAT2; PILRA; GBP5; RILPL2; LDHB; MMP9; P2RX1; SELENOK; BCAT1; BST2; DCLRE1B; LYL1; ALOX5AP; NRROS; PTAFR; CASS4; PSMD14; IFI30; UBD; BATF; RNF166; FAM43A; CSF2RB; PIK3R6; APLNR; ERH; KDM2A; ATMIN; ZNF281; SLC7A11; DNAJC15; MFAP2; MNDA; MPP1; OAS3; TMED5; PLEKHO1; KLF13; ASB1; TMEM176A; ADAP2; PTPRCAP; RFX5; RNASE2; BLVRA; MRPL32; SPARC; C1QB; C2; TNFAIP8L2; DOK3; C3ORF36; RUBCNL; ORAI2; LIMD2; EMILIN2; GINS4; MVB12B; NREP; THEMIS2; RASSF2; SPOCK2 | |
| GO:0044877 | Protein-containing complex binding | MF | 20 | 2.87E-04 | 3.54 | CD22; ICAM2; ITGAM; SEMA7A; CTSL; MMP9; SPARC; ADD2; PIK3R5; RAB32; CD3E; RPSA; COTL1; MYO1F; PSTPIP1; PSMD14; UBD; ATMIN; P2RX1; DCLRE1B | |
| GO:0033691 | Sialic acid binding | MF | 3 | 4.22E-04 | 3.37 | FCN1; CD22; CD33 | |
| GO:0038187 | Pattern recognition receptor activity | MF | 3 | 4.83E-04 | 3.32 | PTAFR; FCN1; TLR9 | |
| GO:0043325 | Phosphatidylinositol-3,4-bisphosphate binding | MF | 3 | 1.07E-03 | 2.97 | PLEK; ADAP2; NCF1 | |
| GO:0140375 | Immune receptor activity | MF | 5 | 2.24E-03 | 2.65 | FPR1; C5AR1; IFNAR2; CSF2RB; CCR2 | |
| GO:0004875 | Complement receptor activity | MF | 2 | 2.86E-03 | 2.54 | C5AR1; FPR1 | |
| GO:0008191 | Metalloendopeptidase inhibitor activity | MF | 2 | 5.11E-03 | 2.29 | BST2; SPOCK2 | |
| GO:0046935 | 1-phosphatidylinositol-3-kinase regulator activity | MF | 2 | 5.11E-03 | 2.29 | PIK3R6; PIK3R5 | |
| GO:0019901 | Protein kinase binding | MF | 11 | 5.55E-03 | 2.26 | PLEK; PRKCB; TRIB1; NFATC1; PTAFR; CASS4; ADD2; IFNAR2; RAC2; WAS; CD3E | |
| Down-regulated | GO:0003012 | Muscle system process | BP | 21 | 5.78E-19 | 18.24 | TNNT1; TNNT3; TTN; TRDN; MYOM3; MYLPF; NOS1; RYR1; SCN4A; CAV3; ATP1A2; KLHL41; ARG2; MYL2; MLIP; CASQ1; FBXO32; MYBPC2; NEB; MB; ATP2A1 |
| GO:0006936 | Muscle contraction | BP | 19 | 2.12E-18 | 17.67 | TNNT1; TNNT3; ATP1A2; KLHL41; ARG2; NOS1; TTN; MYL2; CASQ1; CAV3; MYBPC2; NEB; MB; ATP2A1; SCN4A; TRDN; MYOM3; MYLPF; RYR1 | |
| GO:0030239 | Myofibril assembly | BP | 11 | 1.74E-16 | 15.76 | TTN; KLHL41; TNNT1; TNNT3; OBSCN; CASQ1; MYPN; MYL2; CAV3; NEB; NRAP | |
| GO:0055002 | Striated muscle cell development | BP | 13 | 6.78E-15 | 14.17 | KLHL41; TTN; TNNT1; TNNT3; OBSCN; CASQ1; MYPN; KLHL40; RYR1; MYL2; NEB; NRAP; CAV3 | |
| GO:0006941 | Striated muscle contraction | BP | 13 | 1.34E-14 | 13.87 | TNNT1; TNNT3; MYL2; ATP1A2; CASQ1; CAV3; MB; ATP2A1; NOS1; TTN; SCN4A; KLHL41; ARG2 | |
| GO:0055001 | Muscle cell development | BP | 13 | 1.92E-14 | 13.72 | KLHL41; TTN; CAV3; TNNT1; TNNT3; OBSCN; CASQ1; MYPN; KLHL40; RYR1; MYL2; NEB; NRAP | |
| GO:0051146 | Striated muscle cell differentiation | BP | 15 | 2.12E-14 | 13.67 | NOS1; CAV3; SMYD1; KLHL41; TTN; TNNT1; TNNT3; OBSCN; CASQ1; MYPN; KLHL40; RYR1; MYL2; NEB; NRAP | |
| GO:0010927 | Cellular component assembly involved in morphogenesis | BP | 11 | 6.37E-14 | 13.20 | KLHL41; TTN; TNNT1; TNNT3; OBSCN; CASQ1; MYPN; MYL2; CAV3; NEB; NRAP | |
| GO:0042692 | Muscle cell differentiation | BP | 15 | 1.22E-12 | 11.91 | NOS1; CAV3; SMYD1; KLHL41; TTN; MYL2; TNNT1; TNNT3; OBSCN; CASQ1; MYPN; KLHL40; RYR1; NEB; NRAP | |
| GO:0045214 | Sarcomere organization | BP | 8 | 1.46E-12 | 11.84 | CAV3; KLHL41; TNNT1; TNNT3; TTN; OBSCN; CASQ1; MYPN | |
| GO:0043292 | Contractile fiber | CC | 20 | 1.92E-23 | 22.72 | MYLPF; TNNT1; TNNT3; MYL2; OBSCN; MYOM3; ABRA; FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; CASQ1; MYPN; CAV3; KLHL41; CMYA5; KLHL40 | |
| GO:0030017 | Sarcomere | CC | 19 | 5.17E-23 | 22.29 | TNNT1; TNNT3; FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; OBSCN; CASQ1; MYPN; CAV3; KLHL41; MYOM3; CMYA5; KLHL40; MYL2; ABRA | |
| GO:0030016 | Myofibril | CC | 19 | 3.09E-22 | 21.51 | TNNT1; TNNT3; MYOM3; ABRA; MYL2; FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; OBSCN; CASQ1; MYPN; CAV3; KLHL41; CMYA5; KLHL40 | |
| GO:0031674 | I band | CC | 12 | 2.19E-14 | 13.66 | FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; OBSCN; CASQ1; MYPN; CAV3; KLHL40 | |
| GO:0099512 | Supramolecular fiber | CC | 22 | 1.77E-13 | 12.75 | MYLPF; TNNT1; TNNT3; TRIM55; MYL2; OBSCN; MYOM3; ABRA; FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; CASQ1; MYPN; CAV3; KLHL41; CMYA5; KLHL40; MYBPC2 | |
| GO:0099081 | Supramolecular polymer | CC | 22 | 2.08E-13 | 12.68 | MYLPF; TNNT1; TNNT3; TRIM55; MYL2; OBSCN; MYOM3; ABRA; FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; CASQ1; MYPN; CAV3; KLHL41; CMYA5; KLHL40; MYBPC2 | |
| GO:0030018 | Z disc | CC | 11 | 2.81E-13 | 12.55 | FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; OBSCN; CASQ1; MYPN; CAV3 | |
| GO:0099080 | Supramolecular complex | CC | 22 | 4.74E-11 | 10.32 | MYLPF; TNNT1; TNNT3; TRIM55; MYL2; OBSCN; MYOM3; ABRA; FBXO32; XIRP2; NEB; NOS1; NRAP; RYR1; TTN; CASQ1; MYPN; CAV3; KLHL41; CMYA5; KLHL40; MYBPC2 | |
| GO:0031672 | A band | CC | 6 | 1.88E-09 | 8.73 | KLHL41; MYOM3; CMYA5; OBSCN; KLHL40; MYL2 | |
| GO:0016529 | Sarcoplasmic reticulum | CC | 7 | 2.89E-09 | 8.54 | TRDN; RYR1; CASQ1; KLHL41; ATP2A1; NOS1; CMYA5 | |
| GO:0008307 | Structural constituent of muscle | MF | 6 | 6.42E-09 | 8.19 | MYLPF; MYBPC2; MYL2; NEB; TTN; OBSCN | |
| GO:0003779 | Actin binding | MF | 12 | 2.10E-08 | 7.68 | MYL2; MYOM3; XIRP2; NEB; NRAP; TTN; CORO6; FGD4; ABRA; MYBPC2; TNNT3; MYPN | |
| GO:0008092 | Cytoskeletal protein binding | MF | 16 | 1.04E-07 | 6.98 | FGD4; ABRA; MYBPC2; NRAP; TNNT3; MYPN; MYL2; TNNT1; OBSCN; TTN; SPATA6; CAV3; MYOM3; XIRP2; NEB; CORO6 | |
| GO:0051393 | Alpha-actinin binding | MF | 4 | 1.95E-06 | 5.71 | NRAP; TTN; MYPN; XIRP2 | |
| GO:0042805 | Actinin binding | MF | 4 | 6.41E-06 | 5.19 | NRAP; TTN; MYPN; XIRP2 | |
| GO:0051371 | Muscle alpha-actinin binding | MF | 3 | 1.62E-05 | 4.79 | NRAP; TTN; MYPN | |
| GO:0051015 | Actin filament binding | MF | 6 | 6.77E-05 | 4.17 | MYOM3; XIRP2; NEB; NRAP; TTN; CORO6 | |
| GO:0005198 | Structural molecule activity | MF | 10 | 1.54E-04 | 3.81 | RPL3L; MYLPF; MYBPC2; MYL2; NEB; TTN; OBSCN; COL6A6; TUFT1; CLTCL1 | |
| GO:0005516 | Calmodulin binding | MF | 5 | 5.72E-04 | 3.24 | ARPP21; NOS1; RYR1; TTN; OBSCN | |
| GO:0005521 | Lamin binding | MF | 2 | 1.31E-03 | 2.88 | SUN1; MLIP |
The top 15 enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways for the up- and down-regulated mRNAs in the circRNA-mRNA co-expression network.
| mRNAs | ID | Term | Count | Selection counts | Fisher-P value | Enrichment score | Gene |
|---|---|---|---|---|---|---|---|
| Up-regulated | hsa05150 |
| 96 | 6 | 1.24E-04 | 3.91 | C1QB; C2; C5AR1; FPR1; ITGAM; PTAFR |
| hsa04670 | Leukocyte transendothelial migration - | 114 | 6 | 3.17E-04 | 3.50 | ITGAM; MMP9; NCF1; PRKCB; RAC2; SIPA1 | |
| hsa04062 | Chemokine signaling pathway - | 192 | 7 | 9.19E-04 | 3.04 | CCR2; NCF1; PIK3R5; PIK3R6; PRKCB; RAC2; WAS | |
| hsa04640 | Hematopoietic cell lineage - | 99 | 5 | 1.24E-03 | 2.91 | CD22; CD33; CD3E; CSF1R; ITGAM | |
| hsa04380 | Osteoclast differentiation - | 128 | 5 | 3.83E-03 | 2.42 | ACP5; CSF1R; IFNAR2; NCF1; NFATC1 | |
| hsa04650 | Natural killer cell mediated cytotoxicity - | 131 | 5 | 4.23E-03 | 2.37 | ICAM2; IFNAR2; NFATC1; PRKCB; RAC2 | |
| hsa04662 | B cell receptor signaling pathway - | 82 | 4 | 4.43E-03 | 2.35 | CD22; NFATC1; PRKCB; RAC2 | |
| hsa04610 | Complement and coagulation cascades - | 85 | 4 | 5.03E-03 | 2.30 | C1QB; C2; C5AR1; ITGAM | |
| hsa05235 | PD-L1 expression and PD-1 checkpoint pathway in cancer - | 89 | 4 | 5.92E-03 | 2.23 | BATF; CD3E; NFATC1; TLR9 | |
| hsa04015 | Rap1 signaling pathway - | 210 | 6 | 7.17E-03 | 2.14 | CSF1R; FPR1; ITGAM; PRKCB; RAC2; SIPA1 | |
| hsa04666 | Fc gamma R-mediated phagocytosis - | 97 | 4 | 8.00E-03 | 2.10 | NCF1; PRKCB; RAC2; WAS | |
| hsa04621 | NOD-like receptor signaling pathway - | 181 | 5 | 1.59E-02 | 1.80 | GBP5; IFNAR2; OAS3; PSTPIP1; RIPK2 | |
| hsa04611 | Platelet activation - | 124 | 4 | 1.84E-02 | 1.74 | COL1A1; P2RX1; PIK3R5; PIK3R6 | |
| hsa05202 | Transcriptional misregulation in cancer - | 192 | 5 | 2.01E-02 | 1.70 | CSF1R; HHEX; ITGAM; LYL1; MMP9 | |
| hsa05133 | Pertussis - | 76 | 3 | 2.40E-02 | 1.62 | C1QB; C2; ITGAM | |
| Down-regulated | hsa04260 | Cardiac muscle contraction - | 87 | 4 | 1.57E-04 | 3.80 | ATP1A2; ATP2A1; MYL2; TRDN |
| hsa04020 | Calcium signaling pathway - | 201 | 5 | 3.92E-04 | 3.41 | ATP2A1; CASQ1; NOS1; RYR1; TRDN | |
| hsa00220 | Arginine biosynthesis - | 22 | 2 | 2.22E-03 | 2.65 | ARG2; NOS1 | |
| hsa05410 | Hypertrophic cardiomyopathy - | 90 | 3 | 2.90E-03 | 2.54 | ATP2A1; MYL2; TTN | |
| hsa05414 | Dilated cardiomyopathy - | 96 | 3 | 3.48E-03 | 2.46 | ATP2A1; MYL2; TTN | |
| hsa04510 | Focal adhesion - | 201 | 4 | 3.63E-03 | 2.44 | CAV3; COL6A6; MYL2; MYLPF | |
| hsa04371 | Apelin signaling pathway - | 137 | 3 | 9.35E-03 | 2.03 | MYL2; NOS1; RYR1 | |
| hsa00330 | Arginine and proline metabolism - | 51 | 2 | 1.16E-02 | 1.94 | ARG2; NOS1 | |
| hsa04261 | Adrenergic signaling in cardiomyocytes - | 150 | 3 | 1.20E-02 | 1.92 | ATP1A2; ATP2A1; MYL2 | |
| hsa04961 | Endocrine and other factor-regulated calcium reabsorption - | 53 | 2 | 1.24E-02 | 1.91 | ATP1A2; CLTCL1 | |
| hsa04730 | Long-term depression - | 60 | 2 | 1.58E-02 | 1.80 | NOS1; RYR1 | |
| hsa05100 | Bacterial invasion of epithelial cells - | 77 | 2 | 2.52E-02 | 1.60 | CAV3; CLTCL1 | |
| hsa04970 | Salivary secretion - | 93 | 2 | 3.57E-02 | 1.45 | ATP1A2; NOS1 | |
| hsa04713 | Circadian entrainment - | 97 | 2 | 3.85E-02 | 1.41 | NOS1; RYR1 | |
| hsa04972 | Pancreatic secretion - | 102 | 2 | 4.22E-02 | 1.37 | ATP1A2; ATP2A1 |
Lists of abbreviations: circRNA, circular RNAs; mRNA, messenger RNA; miRNA, microRNA; GO, gene ontology; BP, biological process; CC, cellular component; MF, molecular function; KEGG, kyoto encyclopedia of genes and genomes; qRT-PCR, quantitative real-time PCR; ceRNA, competing endogenous RNA; LDALT, lacrimal drainage–associated lymphoid tissue; MALT, mucosa-associated lymphoid tissue; En-DCR, endoscopic dacryocystorhinostomy; CT-DCG, computed tomography dacryocystography; CPM, counts of exon model per million mapped reads.
FIGURE 7Top 2 up- and top 2 down-regulated circRNAs-associated circRNA-miRNA-mRNA interaction networks in chronic dacryocystitis. Brown round dots represent cirRNAs, red round dots represent miRNAs, light-blue round dots represent mRNAs.
FIGURE 8Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis for mRNAs in the circRNA-miRNA-mRNA interaction network. (A) The top 30 GO terms of biological process (BP), cellular component (CC) and molecular function (MF) categories for dysregulated mRNAs. (B): The top 10 enriched KEGG pathways for dysregulated mRNAs.
FIGURE 9Th1 and Th2 cell differentiation-related circRNA-miRNA-mRNA network. Yellow round dots represent circRNAs, red round dots represent miRNAs, and blue dots represent mRNAs.
FIGURE 10Validation of expression levels of mRNAs and circRNAs in chronic dacryocystitis and control samples. (A,B) RNA sequencing analysis of the expression levels of five mRNAs (MYH2, DSP, CD27, CCL5, and FN1) and three circRNAs. (C,D) QRT-PCR results of the expression levels of mRNAs and circRNAs detected by in 6 chronic dacryocystitis samples and 6 control samples.