The growth plates are cartilage tissues found at both ends of developing bones, and vital proliferation and differentiation of growth plate chondrocytes are primarily responsible for bone growth. C-type natriuretic peptide (CNP) stimulates bone growth by activating natriuretic peptide receptor 2 (NPR2) which is equipped with guanylate cyclase on the cytoplasmic side, but its signaling pathway is unclear in growth plate chondrocytes. We previously reported that transient receptor potential melastatin-like 7 (TRPM7) channels mediate intermissive Ca2+ influx in growth plate chondrocytes, leading to activation of Ca2+/calmodulin-dependent protein kinase II (CaMKII) for promoting bone growth. In this report, we provide evidence from experiments using mutant mice, indicating a functional link between CNP and TRPM7 channels. Our pharmacological data suggest that CNP-evoked NPR2 activation elevates cellular cGMP content and stimulates big-conductance Ca2+-dependent K+ (BK) channels as a substrate for cGMP-dependent protein kinase (PKG). BK channel-induced hyperpolarization likely enhances the driving force of TRPM7-mediated Ca2+ entry and seems to accordingly activate CaMKII. Indeed, ex vivo organ culture analysis indicates that CNP-facilitated bone growth is abolished by chondrocyte-specific Trpm7 gene ablation. The defined CNP signaling pathway, the NPR2-PKG-BK channel-TRPM7 channel-CaMKII axis, likely pinpoints promising target proteins for developing new therapeutic treatments for divergent growth disorders.
The growth plates are cartilage tissues found at both ends of developing bones, and vital proliferation and differentiation of growth plate chondrocytes are primarily responsible for bone growth. C-type natriuretic peptide (CNP) stimulates bone growth by activating natriuretic peptide receptor 2 (NPR2) which is equipped with guanylate cyclase on the cytoplasmic side, but its signaling pathway is unclear in growth plate chondrocytes. We previously reported that transient receptor potential melastatin-like 7 (TRPM7) channels mediate intermissive Ca2+ influx in growth plate chondrocytes, leading to activation of Ca2+/calmodulin-dependent protein kinase II (CaMKII) for promoting bone growth. In this report, we provide evidence from experiments using mutant mice, indicating a functional link between CNP and TRPM7 channels. Our pharmacological data suggest that CNP-evoked NPR2 activation elevates cellular cGMP content and stimulates big-conductance Ca2+-dependent K+ (BK) channels as a substrate for cGMP-dependent protein kinase (PKG). BK channel-induced hyperpolarization likely enhances the driving force of TRPM7-mediated Ca2+ entry and seems to accordingly activate CaMKII. Indeed, ex vivo organ culture analysis indicates that CNP-facilitated bone growth is abolished by chondrocyte-specific Trpm7 gene ablation. The defined CNP signaling pathway, the NPR2-PKG-BK channel-TRPM7 channel-CaMKII axis, likely pinpoints promising target proteins for developing new therapeutic treatments for divergent growth disorders.
The development of skeletal long bones occurs through endochondral ossification processes, during which chondrocyte layers form the growth plates at both ends of bone rudiments, and then the expanded cartilage portions are gradually replaced by trabecular bones through the action of osteoclasts and osteoblasts (Berendsen and Olsen, 2015). Therefore, bone size largely depends on the proliferation of growth plate chondrocytes during endochondral development. On the other hand, atrial (ANP), brain (BNP), and C-type (CNP) natriuretic peptides regulate diverse cellular functions by activating the receptor guanylate cyclases, NPR1 and NPR2 (Nakao et al., 1996). Of the natriuretic peptides, CNP exclusively stimulates bone development by acting on growth plate chondrocytes expressing the CNP-specific receptor NPR2 (Nakao et al., 1996; Wit and Camacho-Hübner, 2011; Peake et al., 2014). Indeed, loss- and gain-of-function mutations in the human NPR2 gene cause acromesomelic dysplasia and skeletal overgrowth disorder, respectively (Vasques et al., 2014; Wit et al., 2016). Furthermore, translational studies have been probing the benefits of CNP treatments in various animal models with impaired skeletal growth, and a phase III clinical trial of CNP therapy has recently been completed and approved for treatment of achondroplasia patients primarily resulting from mutations in the FGFR3 gene (Savarirayan et al., 2020). It is thus likely that NPR2 guanylate cyclase controls chondrocytic cGMP content during growth plate development. Downstream of NPR2 activation, cGMP-dependent protein kinase (PKG) seems to phosphorylate target proteins to facilitate growth plate chondrogenesis (Peake et al., 2014). Activated PKG is postulated to stimulate the biosynthesis of growth plate extracellular matrix by playing an inhibitory role in the mitogen-activated protein kinase Raf–MEK–ERK cascade (Krejci et al., 2005). In parallel, glycogen synthase kinase 3β (GSK3β) is likely activated by PKG-mediated phosphorylation, leading to the hypertrophic maturation of growth plate chondrocytes (Kawasaki et al., 2008). However, it is still unclear how CNP promotes bone growth at the molecular level, and it is important to further address CNP signaling cascade in growth plate chondrocytes.In the transient receptor potential channel superfamily, the melastatin subfamily member 7 (TRPM7) forms a mono- and divalent cation-permeable channel in various cell types and participates in important cellular processes including cell growth and adhesion (Fleig and Chubanov, 2014). We recently reported that growth plate chondrocytes generate autonomic intracellular Ca2+ fluctuations, which are generated by the intermittent gating of TRPM7 channels, and also that TRPM7-mediated Ca2+ entry activates Ca2+/calmodulin-dependent protein kinase II (CaMKII), facilitating endochondral bone growth (Qian et al., 2019). Based on these observations, we explored the link between CNP signaling and TRPM7-mediated Ca2+ entry through the experiments described in this report. Our data obtained clearly indicate that big-conductance Ca2+-dependent K+ (BK) channels play a key role in the functional coupling between NPR2 and TRPM7 channels in growth plate chondrocytes.
Results
CNP facilitates spontaneous Ca2+ fluctuations in growth plate chondrocytes
In the growth plates of developing bones, proliferating cartilage cells, designated as round and columnar chondrocytes, frequently exhibit weak increases and decreases in intracellular Ca2+ concentration under resting conditions (Qian et al., 2019). On the other hand, previous in vivo studies demonstrated that CNP application (>1 μmol/kg) stimulates endochondral bone growth (Nakao et al., 1996). In our Fura-2 imaging of round chondrocytes within femoral bone slices prepared from wild-type mice, CNP pretreatments (30–300 nM for 1 hr) dose-dependently facilitated spontaneous Ca2+ fluctuations (Figure 1A). In particular, fluctuation-positive cell ratio and fluctuation amplitude were remarkably elevated in response to the CNP treatments. In contrast, ANP treatments exerted no effects on Ca2+ fluctuations in growth plate chondrocytes.
Figure 1.
C-type natriuretic peptide (CNP)-induced facilitation of Ca2+ fluctuations in growth plate chondrocytes.
(A) Fura-2 imaging of round chondrocytes pretreated with or without natriuretic peptides. Femoral bone slices prepared from wild-type C57BL embryos were pretreated with or without CNP and atrial natriuretic peptide (ANP), and subjected to Ca2+ imaging. Representative recording traces from three cells are shown in each pretreatment group (upper panels). The effects of CNP and ANP pretreatments on spontaneous Ca2+ fluctuations are summarized (lower graphs). The fluctuation-positive cell ratio, fluctuation amplitude and frequency were statistically analyzed, and significant differences from the control vehicle pretreatment are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance (ANOVA) and Dunnett’s test). The data are presented as the means ± standard error of the mean (SEM). with n values indicating the number of examined mice. (B) Fura-2 imaging of round chondrocytes prepared from chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/−) and control (Npr2fl/fl, Col2a1-Cre−/−) mice. The bone slices were pretreated with CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panels) and the CNP-pretreated effects are summarized (right graphs); significant differences from the wild-type group are marked with asterisks (*p < 0.05 in one-way ANOVA and Tukey’s test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
(A) Organization of floxed and deleted Npr2 alleles. The chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/−) mice were previously generated (Nakao et al., 2015). In this study, genotyping primers were newly designed, and Npr2 ablation was evaluated in growth plates. The genomic map shows PCR primers for detecting the mutated Npr2 alleles and Npr2 mRNA. (B) Npr2 gene ablation in various tissues from the chondrocyte-specific Npr2-knockout mice. Genomic DNAs were prepared from tissues (Gp, humeral growth plate; Br, brain; Lu, lung; Hr, heart; Lv, liver; Ki, kidney) from the E17.5 chondrocyte-specific Npr2-knockout and control embryos, and subjected to PCR analysis to detect the floxed and deleted Npr2 alleles; the Col2a1-Cre transgene was also examined. (C) Reduction of Npr2 mRNA in mutant growth plates prepared from the chondrocyte-specific Npr2-knockout mice. Total RNAs were prepared from humeral growth plates from the E17.5 embryos, and subjected to reverse transcription PCR (RT-PCR) analysis for estimating Npr2 mRNA content. 18S ribosomal RNA was examined as an internal control. The relative mRNA contents were estimated from cycle thresholds in RT-PCR reactions and are summarized in the bar graph. (D) Total RNAs were prepared from humeral growth plate sections of the chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre) and control (Npr2fl/fl, Col2a1-Cre−/−) E17.5 embryos and subjected to quantitative RT-PCR analysis. The cycle threshold (Ct) was determined for each RT-PCR reaction for estimating relative mRNA content. The data represent means ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses. A significant difference between the genotype is marked with an asterisk (**p < 0.01 in t-test).
Total RNAs were prepared from growth plate sections packed with round chondrocytes or enriched with columnar and hypertrophic chondrocytes, and subjected to RT-PCR analysis. The cycle threshold (Ct) was determined for each RT-PCR reaction for estimating relative mRNA content. The data represent the mean ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses. Significant differences between the growth plate sections are marked with asterisks (*p < 0.05 and **p < 0.01 in t-test). n.d.: not detectable.
C-type natriuretic peptide (CNP)-induced facilitation of Ca2+ fluctuations in growth plate chondrocytes.
(A) Fura-2 imaging of round chondrocytes pretreated with or without natriuretic peptides. Femoral bone slices prepared from wild-type C57BL embryos were pretreated with or without CNP and atrial natriuretic peptide (ANP), and subjected to Ca2+ imaging. Representative recording traces from three cells are shown in each pretreatment group (upper panels). The effects of CNP and ANP pretreatments on spontaneous Ca2+ fluctuations are summarized (lower graphs). The fluctuation-positive cell ratio, fluctuation amplitude and frequency were statistically analyzed, and significant differences from the control vehicle pretreatment are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance (ANOVA) and Dunnett’s test). The data are presented as the means ± standard error of the mean (SEM). with n values indicating the number of examined mice. (B) Fura-2 imaging of round chondrocytes prepared from chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/−) and control (Npr2fl/fl, Col2a1-Cre−/−) mice. The bone slices were pretreated with CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panels) and the CNP-pretreated effects are summarized (right graphs); significant differences from the wild-type group are marked with asterisks (*p < 0.05 in one-way ANOVA and Tukey’s test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
Chondrocyte-specific Npr2 ablation.
(A) Organization of floxed and deleted Npr2 alleles. The chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/−) mice were previously generated (Nakao et al., 2015). In this study, genotyping primers were newly designed, and Npr2 ablation was evaluated in growth plates. The genomic map shows PCR primers for detecting the mutated Npr2 alleles and Npr2 mRNA. (B) Npr2 gene ablation in various tissues from the chondrocyte-specific Npr2-knockout mice. Genomic DNAs were prepared from tissues (Gp, humeral growth plate; Br, brain; Lu, lung; Hr, heart; Lv, liver; Ki, kidney) from the E17.5 chondrocyte-specific Npr2-knockout and control embryos, and subjected to PCR analysis to detect the floxed and deleted Npr2 alleles; the Col2a1-Cre transgene was also examined. (C) Reduction of Npr2 mRNA in mutant growth plates prepared from the chondrocyte-specific Npr2-knockout mice. Total RNAs were prepared from humeral growth plates from the E17.5 embryos, and subjected to reverse transcription PCR (RT-PCR) analysis for estimating Npr2 mRNA content. 18S ribosomal RNA was examined as an internal control. The relative mRNA contents were estimated from cycle thresholds in RT-PCR reactions and are summarized in the bar graph. (D) Total RNAs were prepared from humeral growth plate sections of the chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre) and control (Npr2fl/fl, Col2a1-Cre−/−) E17.5 embryos and subjected to quantitative RT-PCR analysis. The cycle threshold (Ct) was determined for each RT-PCR reaction for estimating relative mRNA content. The data represent means ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses. A significant difference between the genotype is marked with an asterisk (**p < 0.01 in t-test).
Gene expression analysis in wild-type growth plate chondrocytes.
Total RNAs were prepared from growth plate sections packed with round chondrocytes or enriched with columnar and hypertrophic chondrocytes, and subjected to RT-PCR analysis. The cycle threshold (Ct) was determined for each RT-PCR reaction for estimating relative mRNA content. The data represent the mean ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses. Significant differences between the growth plate sections are marked with asterisks (*p < 0.05 and **p < 0.01 in t-test). n.d.: not detectable.In chondrocyte-specific Npr2-knockout mice (Npr2fl/fl, Col2a1-Cre+/−), Cre recombinase is expressed under the control of the collagen type 2α1 gene promoter and thus inactivates the floxed Npr2 alleles in a chondrocyte-specific manner (Nakao et al., 2015). Our RT-PCR analysis indicated that the floxed Npr2 gene was largely inactivated in the growth plates prepared from the E17.5 mutant embryos, but such recombination events were not detected in other tissues examined (Figure 1—figure supplement 1A, B). Accordingly, Npr2 mRNA contents in the mutant growth plates were reduced to less than 40% of controls (Figure 1—figure supplement 1C), despite the growth plate preparations contain not only chondrocytes but also perichondrium-resident cells including undifferentiated mesenchymal cells and immature chondroblasts. Further RT-PCR analysis detected similar expression of representative chondrogenic marker genes between chondrocyte-specific Npr2-knockout and control bones, suggesting that the Npr2 deficiency does not affect fundamental chondrogenesis in growth plates (Figure 1—figure supplement 1D). In contrast to the imaging observations in wild-type and control bone slices, CNP treatments failed to enhance Ca2+ fluctuations in the mutant round chondrocytes prepared from the chondrocyte-specific Npr2-knockout mice (Figure 1B). Therefore, CNP seems to facilitate spontaneous Ca2+ fluctuations downstream of NPR2 activation in growth plate chondrocytes.
Figure 1—figure supplement 1.
Chondrocyte-specific Npr2 ablation.
(A) Organization of floxed and deleted Npr2 alleles. The chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/−) mice were previously generated (Nakao et al., 2015). In this study, genotyping primers were newly designed, and Npr2 ablation was evaluated in growth plates. The genomic map shows PCR primers for detecting the mutated Npr2 alleles and Npr2 mRNA. (B) Npr2 gene ablation in various tissues from the chondrocyte-specific Npr2-knockout mice. Genomic DNAs were prepared from tissues (Gp, humeral growth plate; Br, brain; Lu, lung; Hr, heart; Lv, liver; Ki, kidney) from the E17.5 chondrocyte-specific Npr2-knockout and control embryos, and subjected to PCR analysis to detect the floxed and deleted Npr2 alleles; the Col2a1-Cre transgene was also examined. (C) Reduction of Npr2 mRNA in mutant growth plates prepared from the chondrocyte-specific Npr2-knockout mice. Total RNAs were prepared from humeral growth plates from the E17.5 embryos, and subjected to reverse transcription PCR (RT-PCR) analysis for estimating Npr2 mRNA content. 18S ribosomal RNA was examined as an internal control. The relative mRNA contents were estimated from cycle thresholds in RT-PCR reactions and are summarized in the bar graph. (D) Total RNAs were prepared from humeral growth plate sections of the chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre) and control (Npr2fl/fl, Col2a1-Cre−/−) E17.5 embryos and subjected to quantitative RT-PCR analysis. The cycle threshold (Ct) was determined for each RT-PCR reaction for estimating relative mRNA content. The data represent means ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses. A significant difference between the genotype is marked with an asterisk (**p < 0.01 in t-test).
CNP binds to NPR2 to activate its intrinsic guanylate cyclase and thus stimulates PKG by elevating cellular cGMP contents (Nakao et al., 1996). CNP also binds to NPR3 which acts as a decoy receptor for ligand clearance, but the Npr3 gene seemed to be inactive in growth plate chondrocytes (Figure 1—figure supplement 2). Next, we pharmacologically verified the contribution of PKG to CNP-facilitated Ca2+ fluctuations. The cGMP analog 8-(4-chlorophenylthio)-cyclic GMP (8-pCPT-cGMP) is widely used as a PKG-selective activator, while KT5823 is a typical PKG inhibitor. In wild-type growth plate chondrocytes pretreated with 8-pCPT-cGMP (100 μM for 1 hr), spontaneous Ca2+ fluctuations were remarkably facilitated (Figure 2A); both fluctuation-positive cell rate and fluctuation amplitude were highly increased. In contrast, the bath application of KT5823 (2 μM) clearly attenuated CNP-facilitated Ca2+ fluctuations within a short time frame (Figure 2B). Therefore, PKG activation seems to be essential for CNP-facilitated Ca2+ fluctuations in growth plate chondrocytes.
Figure 1—figure supplement 2.
Gene expression analysis in wild-type growth plate chondrocytes.
Total RNAs were prepared from growth plate sections packed with round chondrocytes or enriched with columnar and hypertrophic chondrocytes, and subjected to RT-PCR analysis. The cycle threshold (Ct) was determined for each RT-PCR reaction for estimating relative mRNA content. The data represent the mean ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses. Significant differences between the growth plate sections are marked with asterisks (*p < 0.05 and **p < 0.01 in t-test). n.d.: not detectable.
Figure 2.
Contribution of cGMP-dependent protein kinase (PKG) to C-type natriuretic peptide (CNP)-facilitated Ca2+ fluctuations.
(A) Facilitated Ca2+ fluctuations in round chondrocytes pretreated with the PKG activator 8-pCPT-cGMP. Wild-type bone slices were pretreated with or without the cGMP analog, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panels), and the pharmacological effects are summarized (right graphs). Significant differences between control and 8-pCPT-cGMP pretreatments are marked with asterisks (**p < 0.01 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice. (B) Attenuation of CNP-facilitated Ca2+ fluctuations by the PKG inhibitor KT5823. Wild-type bone slices were pretreated with CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panel), and KT5823-induced effects are summarized (right graphs). Significant KT5823-induced shifts are marked with asterisks (**p < 0.01 in t-test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
Contribution of cGMP-dependent protein kinase (PKG) to C-type natriuretic peptide (CNP)-facilitated Ca2+ fluctuations.
(A) Facilitated Ca2+ fluctuations in round chondrocytes pretreated with the PKG activator 8-pCPT-cGMP. Wild-type bone slices were pretreated with or without the cGMP analog, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panels), and the pharmacological effects are summarized (right graphs). Significant differences between control and 8-pCPT-cGMP pretreatments are marked with asterisks (**p < 0.01 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice. (B) Attenuation of CNP-facilitated Ca2+ fluctuations by the PKG inhibitor KT5823. Wild-type bone slices were pretreated with CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panel), and KT5823-induced effects are summarized (right graphs). Significant KT5823-induced shifts are marked with asterisks (**p < 0.01 in t-test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
Activated BK channels contribute to CNP-facilitated Ca2+ fluctuations
Spontaneous Ca2+ fluctuations are facilitated by activated BK channels in growth plate chondrocytes (Qian et al., 2019). Previous studies have established a functional link between PKG and BK channels in several cell types including smooth muscle and endothelial cells; activated PKG enhances BK channel gating by directly phosphorylating the α subunit KCNMA1 protein (Dong et al., 2008; Fukao et al., 1999; White et al., 2000). We thus examined whether altered BK channel activity is associated with CNP-facilitated Ca2+ fluctuations. The BK channel inhibitor paxilline (10 μM) exerted no obvious effects on basal Ca2+ fluctuations in nontreated chondrocytes. However, the same paxilline treatments remarkably inhibited CNP-facilitated Ca2+ fluctuations (Figure 3A); both fluctuation-positive cell ratio and fluctuation amplitude were clearly decreased after paxilline application. On the other hand, the BK channel activator NS1619 (30 μM) stimulated basal Ca2+ fluctuations in the growth plate chondrocytes prepared from control mice. The NS1619-induced effects were preserved in the mutant chondrocytes prepared from chondrocyte-specific Npr2-knockout mice (Figure 3B). Therefore, BK channel activation is likely involved in CNP-facilitated Ca2+ fluctuations in growth plate chondrocytes.
Figure 3.
Contribution of BK channels to C-type natriuretic peptide (CNP)-facilitated Ca2+ fluctuations.
(A) Attenuation of CNP-facilitated Ca2+ fluctuations by the BK channel inhibitor paxilline in round chondrocytes. Wild-type bone slices were pretreated with or without CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panels), and paxilline-induced effects are summarized (right graphs). Significant paxilline-induced shifts are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance (ANOVA) and Tukey’s test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice. (B) Ca2+ fluctuations facilitated by the BK channel activator NS1619 in Npr2-deficient chondrocytes. Bone slices were prepared from the chondrocyte-specific Npr2-knockout and control embryos, and NS1619-induced effects were examined in Ca2+ imaging. Representative recording traces are shown (left panels), and the effects of NS1619 are summarized (right graphs). Significant NS1619-induced shifts are marked with asterisks (**p < 0.01 in one-way ANOVA and Tukey’s test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
In Ca2+ imaging, U73122 was bath applied to wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and the effects of U73122 are summarized (right bar graphs). Data represent means ± standard error of the mean (SEM), and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. Significant differences between before and after the U73122 treatment are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance [ANOVA] and Tukey’s test).
(A) Store Ca2+ release triggered by 1-oleoyl lysophosphatidic acid (LPA) in wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and LPA-evoked Ca2+ responses are summarized (right graphs). Data represent means ± standard error of the mean (SEM), and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. No significant differences were observed between CNP- and vehicle-pretreated groups (one-way analysis of variance [ANOVA] and Tukey’s test). (B) Ca2+ leak responses evoked by the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) pump inhibitor thapsigargin (TG) in wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and TG-evoked Ca2+ responses are summarized (right bar graphs). Data represent means ± SEM, and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. No significant differences were observed between CNP- and vehicle-pretreated groups (t-test).
Contribution of BK channels to C-type natriuretic peptide (CNP)-facilitated Ca2+ fluctuations.
(A) Attenuation of CNP-facilitated Ca2+ fluctuations by the BK channel inhibitor paxilline in round chondrocytes. Wild-type bone slices were pretreated with or without CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panels), and paxilline-induced effects are summarized (right graphs). Significant paxilline-induced shifts are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance (ANOVA) and Tukey’s test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice. (B) Ca2+ fluctuations facilitated by the BK channel activator NS1619 in Npr2-deficient chondrocytes. Bone slices were prepared from the chondrocyte-specific Npr2-knockout and control embryos, and NS1619-induced effects were examined in Ca2+ imaging. Representative recording traces are shown (left panels), and the effects of NS1619 are summarized (right graphs). Significant NS1619-induced shifts are marked with asterisks (**p < 0.01 in one-way ANOVA and Tukey’s test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
Effects of phospholipase C (PLC) inhibitor U73122 on C-type natriuretic peptide (CNP)-facilitated Ca2+ fluctuations.
In Ca2+ imaging, U73122 was bath applied to wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and the effects of U73122 are summarized (right bar graphs). Data represent means ± standard error of the mean (SEM), and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. Significant differences between before and after the U73122 treatment are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance [ANOVA] and Tukey’s test).
Store Ca2+ release in C-type natriuretic peptide (CNP)-treated round chondrocytes.
(A) Store Ca2+ release triggered by 1-oleoyl lysophosphatidic acid (LPA) in wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and LPA-evoked Ca2+ responses are summarized (right graphs). Data represent means ± standard error of the mean (SEM), and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. No significant differences were observed between CNP- and vehicle-pretreated groups (one-way analysis of variance [ANOVA] and Tukey’s test). (B) Ca2+ leak responses evoked by the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) pump inhibitor thapsigargin (TG) in wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and TG-evoked Ca2+ responses are summarized (right bar graphs). Data represent means ± SEM, and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. No significant differences were observed between CNP- and vehicle-pretreated groups (t-test).
Phospholipase C seems unrelated to CNP-facilitated Ca2+ fluctuations
Ca2+ fluctuations are maintained by phosphatidylinositol (PI) turnover in growth plate chondrocytes (Qian et al., 2019). Although it has been reported that activated PKG inhibits phospholipase C (PLC) in smooth muscle (Guo et al., 2018; Huang et al., 2007; Nalli et al., 2014; Xia et al., 2001), it might be possible that NPR2 activation enhances basal PLC activity to facilitate Ca2+ fluctuations. The PLC inhibitor U73122 (10 μM) remarkably inhibited basal Ca2+ fluctuations in nontreated chondrocytes: the fluctuation-positive cell ratio and fluctuation amplitude reduced less than half in response to U73122 application (Figure 3—figure supplement 1). U73122 was also effective for CNP-facilitated Ca2+ fluctuations, but the inhibitory efficiency seemed relatively weak compared to those on basal fluctuations. Given the different inhibitory effects, it is rather unlikely that PLC activation accompanies CNP-facilitated Ca2+ fluctuations.
Figure 3—figure supplement 1.
Effects of phospholipase C (PLC) inhibitor U73122 on C-type natriuretic peptide (CNP)-facilitated Ca2+ fluctuations.
In Ca2+ imaging, U73122 was bath applied to wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and the effects of U73122 are summarized (right bar graphs). Data represent means ± standard error of the mean (SEM), and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. Significant differences between before and after the U73122 treatment are marked with asterisks (*p < 0.05 and **p < 0.01 in one-way analysis of variance [ANOVA] and Tukey’s test).
PKG stimulates sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) by phosphorylating the Ca2+ pump regulatory peptide phospholamban (PLN) in smooth and cardiac muscle cells (Bibli et al., 2015; Raeymaekers et al., 1988; Lalli et al., 1999), and activated Ca2+ pumps generally elevate stored Ca2+ contents and thus stimulate store Ca2+ release. RT-PCR data suggested that the Pln gene and the Atp2a2 gene encoding SERCA2 are weakly active in growth plate chondrocytes (Figure 1—figure supplement 2). To examine the effects of CNP treatments on Ca2+ stores, we examined Ca2+ responses to the activation of Gq-coupled lysophosphatidic acid (LPA) receptors (Figure 3—figure supplement 2A) and the Ca2+ pump inhibitor thapsigargin (Figure 3—figure supplement 2B). CNP- and vehicle-pretreated chondrocytes exhibited similar LPA-induced Ca2+ release and thapsigargin-induced Ca2+ leak responses. Therefore, CNP treatments seem ineffective for store Ca2+ pumps in growth plate chondrocytes. Moreover, the dose dependency of Ca2+ release by LPA (1–10 μM) was not altered between CNP- and vehicle-pretreated chondrocytes, implying that CNP does not affect basal PLC activity.
Figure 3—figure supplement 2.
Store Ca2+ release in C-type natriuretic peptide (CNP)-treated round chondrocytes.
(A) Store Ca2+ release triggered by 1-oleoyl lysophosphatidic acid (LPA) in wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and LPA-evoked Ca2+ responses are summarized (right graphs). Data represent means ± standard error of the mean (SEM), and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. No significant differences were observed between CNP- and vehicle-pretreated groups (one-way analysis of variance [ANOVA] and Tukey’s test). (B) Ca2+ leak responses evoked by the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) pump inhibitor thapsigargin (TG) in wild-type round chondrocytes pretreated with or without CNP. Representative recording traces are shown (left panels), and TG-evoked Ca2+ responses are summarized (right bar graphs). Data represent means ± SEM, and the numbers of cells and mice examined are shown in parentheses in the keys and graph bars, respectively. No significant differences were observed between CNP- and vehicle-pretreated groups (t-test).
Among diverse Ca2+ handling-related proteins, PLC, PLN, and BK channels have been reported as PKG substrates, however, our observations suggested that both PLC and PLN receive no obvious functional regulation in CNP-treated chondrocytes. On the other hand, the paxilline treatments diminished CNP-facilitated Ca2+ fluctuations down to nontreated basal levels (Figure 3A), suggesting that activated BK channels predominantly contribute to CNP-facilitated Ca2+ fluctuations in growth plate chondrocytes.
CNP induces BK channel-mediated hyperpolarization
To confirm the contribution of activated BK channels to CNP-facilitated Ca2+ fluctuations, we conducted confocal imaging using the voltage-dependent dye oxonol VI. In this imaging analysis, depolarization results in the accumulation of the dye into cells, in which the fractional fluorescence intensity, normalized to the maximum intensity monitored in the bath solution containing 100 mM KCl, is thus increased (Figure 4A, left panel). The fractional intensity of CNP-pretreated cells was significantly lower than that of nontreated cells in a normal bath solution (Figure 4A, middle graph), although both cells exhibited similar intensity shifts in high K+ bath solutions. Based on the recording data, we prepared a calibration plot for the relationship between the fractional intensity and theoretical membrane potential (Figure 4A, right panel). In the tentative linear correlation, resting potentials of −46.4 ± 0.2 and −43.6 ± 0.3 mV were estimated in CNP- and nontreated cells, respectively. The estimated potentials closely approximate the reported value from monitoring articular chondrocytes using sharp microelectrodes (Clark et al., 2010).
Figure 4.
BK channel-mediated hyperpolarization induced by C-type natriuretic peptide (CNP).
(A) Oxonol VI imaging of round chondrocytes pretreated with or without CNP. Wild-type bone slices were pretreated with or without CNP, and then subjected to membrane potential imaging. During contiguous treatments with high-K+ solutions, cellular fluorescence intensities were monitored and normalized to the maximum value in the 100 mM KCl-containing solution to yield the fractional intensity (left panel). The resting fractional intensities were quantified and statistically analyzed in CNP- and vehicle-pretreated cells (middle graph). For preparing the calibration plot (right panel), the data from 10 cells in bathing solutions containing 4 (normal solution), 20, 40, 60, and 100 mM KCl are summarized; red and black lines indicate the estimated resting membrane potentials of CNP- and vehicle-pretreated cells, respectively. (B) Effects of the BK channel inhibitor paxilline on resting membrane potential in round chondrocytes. Recording data from 10 cells pretreated with or without CNP were averaged (left panel), and the fractional intensities elevated by paxilline are summarized (right graph). (C) Effects of the BK channel activator NS1619 on membrane potential in round chondrocytes. Recording data from 10 cells pretreated with or without CNP were averaged (left panel), and the fractional intensities in normal, 20 mM KCl and NS1619-containing 20 mM KCl solutions are summarized (right graph). Significant differences between CNP- and vehicle-pretreated cells are indicated by asterisks in (A) (**p < 0.01 in t-test) and in (C) (**p < 0.01 in one-way analysis of variance [ANOVA] and Dunn’s test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
BK channel-mediated hyperpolarization induced by C-type natriuretic peptide (CNP).
(A) Oxonol VI imaging of round chondrocytes pretreated with or without CNP. Wild-type bone slices were pretreated with or without CNP, and then subjected to membrane potential imaging. During contiguous treatments with high-K+ solutions, cellular fluorescence intensities were monitored and normalized to the maximum value in the 100 mM KCl-containing solution to yield the fractional intensity (left panel). The resting fractional intensities were quantified and statistically analyzed in CNP- and vehicle-pretreated cells (middle graph). For preparing the calibration plot (right panel), the data from 10 cells in bathing solutions containing 4 (normal solution), 20, 40, 60, and 100 mM KCl are summarized; red and black lines indicate the estimated resting membrane potentials of CNP- and vehicle-pretreated cells, respectively. (B) Effects of the BK channel inhibitor paxilline on resting membrane potential in round chondrocytes. Recording data from 10 cells pretreated with or without CNP were averaged (left panel), and the fractional intensities elevated by paxilline are summarized (right graph). (C) Effects of the BK channel activator NS1619 on membrane potential in round chondrocytes. Recording data from 10 cells pretreated with or without CNP were averaged (left panel), and the fractional intensities in normal, 20 mM KCl and NS1619-containing 20 mM KCl solutions are summarized (right graph). Significant differences between CNP- and vehicle-pretreated cells are indicated by asterisks in (A) (**p < 0.01 in t-test) and in (C) (**p < 0.01 in one-way analysis of variance [ANOVA] and Dunn’s test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.In pharmacological assessments, paxilline elevated fractional intensities to the same levels in CNP- and nontreated chondrocytes (Figure 4B). Moreover, NS1619 decreased fractional intensities to the same levels in both cells under 20 mM KCl bathing conditions, which enabled us to reliably evaluate the reducing intensity shifts (Figure 4C). The oxonol VI imaging data suggested that CNP treatments induce BK channel-mediated hyperpolarization and thus facilitate spontaneous Ca2+ fluctuations by enhancing Ca2+-driving forces in growth plate chondrocytes.
CNP enhances TRPM7-mediated Ca2+ entry and CaMKII activity
Spontaneous Ca2+ fluctuations are predominantly attributed to the intermissive gating of cell-surface TRPM7 channels in growth plate chondrocytes (Qian et al., 2019). For pharmacological characterization of TRPM7 channels, FTY720 is used as a typical inhibitor, while NNC550396 is an activator. As reasonably expected, bath application of FTY720 (10 μM) clearly diminished CNP-facilitated Ca2+ fluctuations (Figure 5A). On the other hand, NNC550396 (30 μM) remarkably facilitated Ca2+ fluctuations in nontreated chondrocytes, and this facilitation was preserved in the mutant chondrocytes prepared from chondrocyte-specific Npr2-knockout mice (Figure 5B). Therefore, CNP treatments likely facilitate TRPM7-mediated Ca2+ influx in growth plate chondrocytes.
Figure 5.
Enhanced TRPM7-mediated Ca2+ entry by C-type natriuretic peptide (CNP) treatments.
(A) Inhibition of CNP-facilitated Ca2+ fluctuations by the TRPM7 inhibitor FTY720 in round chondrocytes. Wild-type bone slices were pretreated with CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panel), and the effects of FTY720 are summarized (right graphs). Significant FTY720-induced shifts are marked with asterisks (**p < 0.01 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice. (B) Ca2+ fluctuations facilitated by the TRPM7 channel activator NNC550396 in Npr2-deficient round chondrocytes. Bone slices were prepared from the chondrocyte-specific Npr2-knockout and control embryos, and NNC550396-induced effects were examined in Ca2+ imaging. Representative recording traces are shown (left panels) and the effects of NNC550396 on Ca2+ fluctuations are summarized (right graphs). Significant NNC550396-induced shifts in each genotype are marked with asterisks (**p < 0.01 in one-way analysis of variance [ANOVA] and Tukey’s test). The data are presented as the means ± SEM with n values indicating the number of examined mice.
Enhanced TRPM7-mediated Ca2+ entry by C-type natriuretic peptide (CNP) treatments.
(A) Inhibition of CNP-facilitated Ca2+ fluctuations by the TRPM7 inhibitor FTY720 in round chondrocytes. Wild-type bone slices were pretreated with CNP, and then subjected to Ca2+ imaging. Representative recording traces are shown (left panel), and the effects of FTY720 are summarized (right graphs). Significant FTY720-induced shifts are marked with asterisks (**p < 0.01 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice. (B) Ca2+ fluctuations facilitated by the TRPM7 channel activator NNC550396 in Npr2-deficient round chondrocytes. Bone slices were prepared from the chondrocyte-specific Npr2-knockout and control embryos, and NNC550396-induced effects were examined in Ca2+ imaging. Representative recording traces are shown (left panels) and the effects of NNC550396 on Ca2+ fluctuations are summarized (right graphs). Significant NNC550396-induced shifts in each genotype are marked with asterisks (**p < 0.01 in one-way analysis of variance [ANOVA] and Tukey’s test). The data are presented as the means ± SEM with n values indicating the number of examined mice.TRPM7-mediated Ca2+ entry activates CaMKII in growth plate chondrocytes toward bone outgrowth (Qian et al., 2019), and cellular CaMKII activity can be estimated by immunochemically quantifying its autophosphorylated form. In immunocytochemical analysis, CNP-pretreated growth plate chondrocytes were more decorated with the antibody against phospho-CaMKII than nontreated control cells (Figure 6A). This CNP-facilitated decoration was abolished by the cotreatment of the CaMKII inhibitor KN93 (30 μM). This observation was further confirmed by Western blot analysis; CNP treatments increased the phospho-CaMKII population without affecting total CaMKII content in the cell lysates prepared from growth plates (Figure 6B). Therefore, CaMKII is likely activated downstream of enhanced TRPM7-mediated Ca2+ entry in CNP-treated growth plate chondrocytes.
Figure 6.
CaMKII activation in C-type natriuretic peptide (CNP)-treated round chondrocytes.
(A) Immunohistochemical staining against phospho-CaMKII (p-CaMKII) in round chondrocytes. Wild-type bone slices were pretreated with or without CNP and the CaMKII inhibitor KN93, and then subjected to immunostaining with antibody to p-CaMKII. DAPI (4′,6-diamidino-2-phenylindole) was used for nuclear staining. Lower panels show high-magnification views of white-dotted regions in upper panels (scale bars, 10 μm). (B) Immunoblot analysis of total CaMKII and p-CaMKII in growth plate cartilage. Growth plate lysates were prepared from wild-type bone slices pretreated with or without CNP, and subjected to immunoblot analysis with antibodies against total CaMKII and p-CaMKII (upper panel). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also analyzed as a loading control. The immunoreactivities observed were densitometrically quantified and are summarized (lower graph). A significant difference between CNP- and vehicle pretreatments is marked with an asterisk (*p < 0.05 in one-way analysis of variance [ANOVA] and Tukey’s test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
CaMKII activation in C-type natriuretic peptide (CNP)-treated round chondrocytes.
(A) Immunohistochemical staining against phospho-CaMKII (p-CaMKII) in round chondrocytes. Wild-type bone slices were pretreated with or without CNP and the CaMKII inhibitor KN93, and then subjected to immunostaining with antibody to p-CaMKII. DAPI (4′,6-diamidino-2-phenylindole) was used for nuclear staining. Lower panels show high-magnification views of white-dotted regions in upper panels (scale bars, 10 μm). (B) Immunoblot analysis of total CaMKII and p-CaMKII in growth plate cartilage. Growth plate lysates were prepared from wild-type bone slices pretreated with or without CNP, and subjected to immunoblot analysis with antibodies against total CaMKII and p-CaMKII (upper panel). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also analyzed as a loading control. The immunoreactivities observed were densitometrically quantified and are summarized (lower graph). A significant difference between CNP- and vehicle pretreatments is marked with an asterisk (*p < 0.05 in one-way analysis of variance [ANOVA] and Tukey’s test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
Pharmacologically activated BK channels facilitate bone outgrowth
Based on the present data from in vitro experiments, the novel CNP signaling route, represented as the NPR2-PKG-BK channel–TRPM7 channel–CaMKII axis, can be proposed in growth plate chondrocytes. We attempted to examine the proposed signaling axis in metatarsal bone culture, a widely used ex vivo model system for analyzing bone growth and endochondral ossification (Houston et al., 2016). CNP treatments expanded columnar chondrocytic zones without affecting cell densities to extend cultured wild-type metatarsal bones (Figure 7—figure supplement 1). The extension seemed to be mainly caused by enlarged extracellular matrix area, although CNP significantly dilated columnar cell sizes. In chondrocyte-specific Trpm7-knockout mice (Trpm7fl/fl, Col11a2-Cre+/−), Cre recombinase is expressed under the control of the collagen type XI gene enhancer and promoter, and thus inactivates the floxed Trpm7 alleles in cartilage cells (Qian et al., 2019). The bone rudiments prepared from control embryos (Trpm7fl/fl, Col11a2-Cre−/−) regularly elongated during ex vivo culture, and their outgrowth was significantly stimulated by the supplementation with CNP (30 nM) into the culture medium (Figure 7A). The histological observation of the growth plate regions demonstrated that the CNP treatment extended the columnar chondrocyte zone. In contrast, the mutant rudiments prepared from the chondrocyte-specific Trpm7-knockout embryos were reduced in initial size and did not respond to the CNP supplementation (Figure 7B). Therefore, CNP-facilitated bone outgrowth seems to require TRPM7 channels expressed in growth plate chondrocytes.
Figure 7—figure supplement 1.
Histological analysis of metatarsal bones treated with C-type natriuretic peptide (CNP).
Metatarsal bones isolated from wild-type embryos were precultured in normal medium for 6 days, and then cultured in medium supplemented with or without CNP (30 nM) for 3 days. Longitudinal sections of cultured bones on day 3 after the CNP treatment are shown in upper left panels (scale bar, 0.3 mm), and high-magnification views of the round (R), columnar (C), and hypertrophic (H) chondrocyte zones in upper right panels (scale bar, 30 μm). MD, mid-diaphysis. Longitudinal bone outgrowth during the CNP-supplemented period was statistically analyzed in each group to present in the lower left graph. Histological observations are summarized in the lower right graphs; the zonal sizes, cellular (Cell) and extracellular matrix (ECM) areas within the columnar cell zone, cell sizes, and cell numbers were statistically analyzed. Data represent means ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses in the keys. Significant differences between the groups are marked with asterisks (*p < 0.05, **p < 0.01 in t-test).
Figure 7.
Contribution of TRPM7 channel to C-type natriuretic peptide (CNP)-facilitated bone outgrowth.
Loss of CNP-facilitated outgrowth in Trpm7-deficient bones. Metatarsal rudiments isolated from control (Trpm7fl/fl, Col11a2-Cre−/−) embryos (A) and chondrocyte-specific Trpm7-knockout (Trpm7fl/fl, Col11a2-Cre+/−) embryos (B) were precultured in normal medium for 6 days, and then cultured in medium supplemented with or without CNP for 3 days. Representative images of cultured metatarsals are shown (upper left panels; scale bar, 0.3 mm), and longitudinal bone outgrowth during the CNP-supplemented period was statistically analyzed in each genotype group (upper right graphs). Growth plate images in longitudinal sections of 3-day cultured bones with or without CNP treatments are presented in lower left panels (scale bar, 0.3 mm), and their high-magnification views in the round (R), columnar (C), and hypertrophic (H) chondrocyte zones are shown in lower right panels (scale bar, 30 μm). MD, mid-diaphysis. Summary of graphical representations of zonal sizes containing round, columnar, and hypertrophic chondrocytes and number of cells in each zone is shown in lower right graphs. Significant CNP-supplemented effects are marked with asterisks (*p < 0.05 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
Metatarsal bones isolated from wild-type embryos were precultured in normal medium for 6 days, and then cultured in medium supplemented with or without CNP (30 nM) for 3 days. Longitudinal sections of cultured bones on day 3 after the CNP treatment are shown in upper left panels (scale bar, 0.3 mm), and high-magnification views of the round (R), columnar (C), and hypertrophic (H) chondrocyte zones in upper right panels (scale bar, 30 μm). MD, mid-diaphysis. Longitudinal bone outgrowth during the CNP-supplemented period was statistically analyzed in each group to present in the lower left graph. Histological observations are summarized in the lower right graphs; the zonal sizes, cellular (Cell) and extracellular matrix (ECM) areas within the columnar cell zone, cell sizes, and cell numbers were statistically analyzed. Data represent means ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses in the keys. Significant differences between the groups are marked with asterisks (*p < 0.05, **p < 0.01 in t-test).
(A) The schematic diagram representing the NPR2-PKG-BK channel–TRPM7 channel–CaMKII axis proposed as an essential CNP signaling cascade in growth plate chondrocytes. Previous studies proposed that the RAF–MEK–ERK axis is also involved in growth plate CNP signaling (Krejci et al., 2005). (B) The schematic diagram representing the nitric oxide (NO- and atrial natriuretic peptide) (ANP)/brain natriuretic peptide (BNP)-induced relaxation signaling in vascular smooth muscle.
Contribution of TRPM7 channel to C-type natriuretic peptide (CNP)-facilitated bone outgrowth.
Loss of CNP-facilitated outgrowth in Trpm7-deficient bones. Metatarsal rudiments isolated from control (Trpm7fl/fl, Col11a2-Cre−/−) embryos (A) and chondrocyte-specific Trpm7-knockout (Trpm7fl/fl, Col11a2-Cre+/−) embryos (B) were precultured in normal medium for 6 days, and then cultured in medium supplemented with or without CNP for 3 days. Representative images of cultured metatarsals are shown (upper left panels; scale bar, 0.3 mm), and longitudinal bone outgrowth during the CNP-supplemented period was statistically analyzed in each genotype group (upper right graphs). Growth plate images in longitudinal sections of 3-day cultured bones with or without CNP treatments are presented in lower left panels (scale bar, 0.3 mm), and their high-magnification views in the round (R), columnar (C), and hypertrophic (H) chondrocyte zones are shown in lower right panels (scale bar, 30 μm). MD, mid-diaphysis. Summary of graphical representations of zonal sizes containing round, columnar, and hypertrophic chondrocytes and number of cells in each zone is shown in lower right graphs. Significant CNP-supplemented effects are marked with asterisks (*p < 0.05 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
Histological analysis of metatarsal bones treated with C-type natriuretic peptide (CNP).
Metatarsal bones isolated from wild-type embryos were precultured in normal medium for 6 days, and then cultured in medium supplemented with or without CNP (30 nM) for 3 days. Longitudinal sections of cultured bones on day 3 after the CNP treatment are shown in upper left panels (scale bar, 0.3 mm), and high-magnification views of the round (R), columnar (C), and hypertrophic (H) chondrocyte zones in upper right panels (scale bar, 30 μm). MD, mid-diaphysis. Longitudinal bone outgrowth during the CNP-supplemented period was statistically analyzed in each group to present in the lower left graph. Histological observations are summarized in the lower right graphs; the zonal sizes, cellular (Cell) and extracellular matrix (ECM) areas within the columnar cell zone, cell sizes, and cell numbers were statistically analyzed. Data represent means ± standard error of the mean (SEM), and the numbers of mice examined are shown in parentheses in the keys. Significant differences between the groups are marked with asterisks (*p < 0.05, **p < 0.01 in t-test).
Proposed C-type natriuretic peptide (CNP)-evoked signaling in growth plate chondrocytes.
(A) The schematic diagram representing the NPR2-PKG-BK channel–TRPM7 channel–CaMKII axis proposed as an essential CNP signaling cascade in growth plate chondrocytes. Previous studies proposed that the RAF–MEK–ERK axis is also involved in growth plate CNP signaling (Krejci et al., 2005). (B) The schematic diagram representing the nitric oxide (NO- and atrial natriuretic peptide) (ANP)/brain natriuretic peptide (BNP)-induced relaxation signaling in vascular smooth muscle.In our proposed signaling axis, activated BK channels exert an essential role by converting the chemical signal into the electrical signal. We finally examined the effect of the BK channel activator NS1619 on bone outgrowth (Figure 8A). NS1619 supplementation (30 μM) significantly stimulated the outgrowth of wild-type bone rudiments. In contrast, under the same culture conditions, no stimulation was detected in the mutant rudiments from the chondrocyte-specific Trpm7-deficient embryos (Figure 8B). The observations seem to support our conclusion that CNP activates BK channels and thus facilitates TRPM7-mediated Ca2+ influx in growth plate chondrocytes for stimulating bone outgrowth.
Figure 8.
Facilitated bone outgrowth by BK channel activator.
Stimulated bone outgrowth by the BK channel activator NS1619. Metatarsal rudiments isolated from wild-type (A) and the chondrocyte-specific Trpm7-knockout embryos (B) were precultured in normal medium for 5 days, and then cultured in medium supplemented with or without NS1619 for 4 days. Representative images of cultured metatarsals are shown (left panels; scale bar, 0.3 mm), and longitudinal bone outgrowth during the NS1619-supplemented period was statistically analyzed in each genotype group (right graphs). A significant NS1619-supplemented effect is marked with asterisks (*p < 0.05 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
Facilitated bone outgrowth by BK channel activator.
Stimulated bone outgrowth by the BK channel activator NS1619. Metatarsal rudiments isolated from wild-type (A) and the chondrocyte-specific Trpm7-knockout embryos (B) were precultured in normal medium for 5 days, and then cultured in medium supplemented with or without NS1619 for 4 days. Representative images of cultured metatarsals are shown (left panels; scale bar, 0.3 mm), and longitudinal bone outgrowth during the NS1619-supplemented period was statistically analyzed in each genotype group (right graphs). A significant NS1619-supplemented effect is marked with asterisks (*p < 0.05 in t-test). The data are presented as the means ± standard error of the mean (SEM) with n values indicating the number of examined mice.
Discussion
We reported that in growth plate chondrocytes, PLC and BK channels maintain autonomic TRPM7-mediated Ca2+ fluctuations, which potentiate chondrogenesis and bone growth by activating CaMKII (Qian et al., 2019). Based on the present data, together with the previous reports, we proposed a new CNP signaling axis in growth plate chondrocytes (Figure 7—figure supplement 2A). CNP-induced NPR2 activation elevates cellular cGMP content and thus activates PKG, leading to the phosphorylation of BK channels. The resulting BK channel activation induces cellular hyperpolarization to facilitate TRPM7-mediated Ca2+ entry by enhancing the Ca2+-driving force, leading to CaMKII activation. Therefore, it is likely that CaMKII activity is physiologically regulated by BK channels as a key player of the CNP signaling cascade. In a recent genetic study, several patients carrying loss-of-function mutations in the KCNMA1 gene encoding BK channel α subunit were characterized by a novel syndromic growth deficiency associated with severe developmental delay, cardiac malformation, bone dysplasia, and dysmorphic features (Liang et al., 2019). In the KCNMA1-mutated disorder, CNP signaling likely fails to facilitate TRPM7-mediated Ca2+ fluctuations in growth plate chondrocytes and resulting insufficient Ca2+ entry may lead to systemic bone dysplasia associated with stunted growth plate cartilage. On the other hand, the origin of CNP may still be ambiguous in the signaling scheme. Transgenic mice overexpressing CNP in a chondrocyte-specific manner develop a prominent skeletal overgrowth phenotype, suggesting autocrine CNP signaling in developing bones (Yasoda et al., 2004). However, several genechip data in public databases indicate that prepro-CNP mRNA is abundantly expressed in the placenta among embryonic tissues (e.g., see the records under accession number GSE28277 in NCBI database). Therefore, it may be important to further examine which cell type primarily produces CNP to facilitate bone growth during embryonic development.
Figure 7—figure supplement 2.
Proposed C-type natriuretic peptide (CNP)-evoked signaling in growth plate chondrocytes.
(A) The schematic diagram representing the NPR2-PKG-BK channel–TRPM7 channel–CaMKII axis proposed as an essential CNP signaling cascade in growth plate chondrocytes. Previous studies proposed that the RAF–MEK–ERK axis is also involved in growth plate CNP signaling (Krejci et al., 2005). (B) The schematic diagram representing the nitric oxide (NO- and atrial natriuretic peptide) (ANP)/brain natriuretic peptide (BNP)-induced relaxation signaling in vascular smooth muscle.
In our proposed CNP-signaling cascade, CaMKII is finally activated by TRPM7-mediated Ca2+ influx in both round and columnar chondrocytes. However, it is still unclear how activated CaMKII contributes to bone outgrowth. Our obeservations in cultured metatarsal bones suggest that CNP expanded the columnar chondrocyte zone by stimulating the cell growth and enlarging the extracellular matrix area toward bone extension (Figure 7). The observations are roughly consistent with the previous studies using cultured tibias treated with CNP (Yasoda et al., 1998; Miyazawa et al., 2002). Therefore, activated CaMKII by TRPM7-mediated Ca2+ influx probably phosphorylates key proteins controlling cell growth and extracellular matrix production in columner chondrocytes.From a physiological point of view, it is interesting to note that the proposed CNP signaling axis has clear overlap with the nitric oxide (NO) and ANP/BNP signaling cascades for vascular relaxation (Martel et al., 2010; Zois et al., 2014; Kubacka et al., 2018). In blood vessels, NO is produced by endothelial cells in response to various stimuli including shear stress and acetylcholine, and activates soluble guanylate cyclase in neighboring vascular smooth muscle cells. ANP and BNP are released from the heart in response to pathological stresses, such as atrial distension and pressure overload, and are delivered to activate the receptor guanylate cyclase NPR1 in vascular muscle. In either case, the resulting cGMP elevation followed by PKG activation induces BK channel-mediated hyperpolarization and thus inhibits L-type Ca2+ channel gating, leading to vascular dilation due to decreased Ca2+ entry into vascular muscle. Therefore, activated BK channels inhibit the voltage-dependent Ca2+ influx in vascular muscle cells regarded as excitable cells (Figure 7—figure supplement 2B). In contrast, activated BK channels reversely stimulate TRPM7-mediated Ca2+ entry in growth plate chondrocytes classified as nonexcitable cells, because the channel activity is voltage independently maintained by the intrinsic PI turnover rate.CNP is an effective therapeutic reagent for achondroplasia and divergent short statures (Yasoda et al., 2004; Ueda et al., 2016; Yamashita et al., 2020), and the phase III clinical trial of CNP therapy is completed successfully (Nakao et al., 1996). The proteins contributing to the CNP signaling axis may be new pharmaceutical targets for developing medications; in addition to NPR2, BK, and TRPM7 channels are reasonably considered promising targets. Moreover, phosphodiesterase subtypes might be useful targets, although the subtypes responsible for cGMP hydrolysis remain to be identified in growth plate chondrocytes. Chemical compounds specifically targeting the signaling axis defined in this study would be useful drugs for not only clinical treatment of developmental disorders but also artificially modifying body sizes in farm and pet animals.
Materials and methods
Reagents, primers, and mice
Reagents and antibodies used in this study, and synthetic primers used for RT-PCR analysis and mouse genotyping are listed in Key Resourses Table. C57BL mice were used as wild-type mice in this study. Chondrocyte-specific Trpm7-knockout mice with C57BL genetic background were generated by crossing Trpm7fl/fl mice (Qian et al., 2019) with transgenic mice carrying Col11a2-Cre, originally designated as 11Enh-Cre (Iwai et al., 2008) Using primer sets for detecting Col11a2-Cre transgene and Trpm7 alleles, we previously reported that Trpm7 is specifically inactivated in cartilage tissues from the Trpm7flfl, Col11a2-Cre+/− mice (Qian et al., 2019). Chondrocyte-specific Npr2-knockout mice with C57BL background were generated as previously described (Nakao et al., 2015), and we designed primers for detecting the Col2a1-Cre transgene and the floxed Npr2 gene in this study (Figure 1—figure supplement 1).
Bone slice preparations
Femoral bones were isolated from E17.5 mice and immersed in a physiological salt solution (PSS): (in mM) 150 NaCl, 4 KCl, 1 MgCl2, 2 CaCl2, 5.6 glucose, and 5 2-[4-(2-Hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES, pH 7.4). Longitudinal bone slices (~40 µm thickness) were prepared using a vibrating microslicer (DTK-1000N, Dosaka EM Co., Japan) as previously described (Qian et al., 2019).
Ca2+ imaging
Fura-2 Ca2+ imaging of bone slices was performed as previously described (Qian et al., 2019). Briefly, bone slices placed on glass-bottom dishes (Matsunami, Japan) were incubated in PSS containing 15 μM Fura-2AM for 1 hr at 37°C. Fluorescence microscopy distinguished round, columnar, and hypertrophic chondrocytes with characteristic morphological features in the bone slices loaded with Fura-2. For ratiometric imaging, excitation light of 340 and 380 nm was alternately delivered, and emission light of >510 nm was detected by a cooled EM-CCD camera (Model C9100-13; Hamamatsu Photonics, Japan) mounted on an upright fluorescence microscope (DM6 FS, Leica) using a ×40 water-immersion objective (HCX APO L, Leica). In typical measurements, ~30 round chondrocytes were randomly examined in each slice preparation to select the Ca2+ fluctuation-positive cells generating spontaneous events (>0.025 in Fura-2 ratio) using commercial software (Leica Application Suite X), and recording traces from the positive cells were then analyzed using Fiji/ImageJ software (US. NIH) for examining Ca2+ fluctuation amplitude and frequency. Imaging experiments were performed at room temperature (23–25°C) and PSS was used as the normal bathing solution. For the pretreatments of CNP, ANP, and 8-pCPT-cGMP, bone slices were immersed in PSS with the indicated compound for 1 hr at room temperature after Fura-2 loading.
Membrane potential monitoring
Bone slices were perfused with the PSS containing 200 nM oxonol VI at room temperature and analyzed as previously described (Yamazaki et al., 2011). To prepare the calibration plot showing the relationship between the fluorescence intensity and membrane potential, saline solutions containing 20, 40, 60, or 100 mM KCl were used as bathing solutions. Fluorescence images with excitation at 559 nm and emission at >606 nm were captured at a sampling rate of ~7.0 s using a confocal laser scanning microscope (FV1000; Olympus).
Immunochemical analysis of CaMKII
Bone slices were pretreated with or without CNP were subjected to immunochemical assessments as previously described (Li et al., 2011). Briefly, for immunohistochemical analysis, bone slices were fixed in 4% paraformaldehyde and treated with 1% hyaluronidase to enhance immunodetection (Ahrens and Dudley, 2011; Mouser et al., 2016). After blocking with fetal bovine serum-containing solution, bone slices were reacted with primary and Alexa 488-conjugated secondary antibodies and observed with a confocal microscope (FV1000; Olympus). For immunoblot analysis, bone slices were lysed in the buffer containing 4% sodium deoxycholate, 20 mM Tris–HCl (pH 8.8) and a phosphatase inhibitor cocktail (100 mM NaF, 10 mM Na3PO4, 1 mM Na2VO3, and 20 mM β-glycerophosphate). The resulting lysate proteins were electrophoresed on sodium dodecyl sulfate–polyacrylamide gels and electroblotted onto nylon membranes for immunodetection using primary and Horseradish peroxidase (HRP)-conjugated secondary antibodies. Antigen proteins were visualized using a chemiluminescence reagent and image analyzer (Amersham Imager 600, Cytiva). The immunoreactivities yielded were quantitatively analyzed by means of Fiji/ImageJ software.
Metatarsal organ culture
Metatarsal bone rudiments were cultured as previously described (Houston et al., 2016). Briefly, the three central metatarsal rudiments were dissected from E15.5 mice and cultured in αMEM containing 5 μg/ml ascorbic acid, 1 mM β-glycerophosphate pentahydrate, 100 units/ml penicillin, 100 μg/ml streptomycin and 0.2% bovine serum albumin (fatty acid free). The explants were analyzed under a photomicroscope (BZ-X710, Keyence, Japan) for size measurements using Fiji/ImageJ software.
Histological analysis
For histological analysis, cultured bones were fixed in 4% paraformaldehyde, embedded in Super Cryoembedding Medium (Section-lab, Japan), and frozen in liquid nitrogen. Serial cryosections (6 μm in thickness) were prepared from the fixed specimens and stained with hematoxylin and eosin. In the sectional images, round, columnar, and hypertrophic chondrocytes were distinguished by their characteristic morphological features. Microscopic images were quantitatively analyzed using Fiji/ImageJ software.
Gene expression analysis
Quantitative RT-PCR analysis was performed as previously described (Zhao et al., 2016). From femoral epiphyses, the terminal region containing round chondrocytes and the adjacent region enriched with columnar and hypertrophic chondrocytes were separated under stereo-microscope. Femoral and humeral speciemens were subjected to total RNA preparation using a commercial reagent (Isogen) for cDNA synthesis using a commercial kit (ReverTra ACE qPCR-RT kit). The resulting cDNAs were examined by real-time PCR (LightCycler 480 II, Roche), and the cycle threshold was determined from the amplification curve as an index for relative mRNA content in each reaction.
Quantification and statistical analysis
All data obtained are presented as the means ± standard error of the mean with n values indicating the number of examined mice. Student t-test and analysis of variance were used for two-group and multiple group comparisons, respectively (Prism 7, GraphPad Software Inc): p < 0.05 was considered to be statistically significant.With the new additional data and descriptions, the paper in its current state is well organized and data presented add a new information on the role of C-type natriuretic peptide and how it facilitates autonomic Ca2+ entry in chondrocytes and modulates bone growth.Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Decision letter after peer review:Thank you for submitting your article "C-type natriuretic peptide facilitates autonomic ca2+ entry in growth plate chondrocytes for stimulating bone growth" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, including Fayez Safadi as Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Mone Zaidi as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Nazir M Khan (Reviewer #2).The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:1) The authors needs to clarify the definition of "round" chondrocytes. Does this mean differentiating/hypertrophic chondrocytes. If this is the case, then I would replace the term"round" by differentiating or hypertrophic chondrocytes.2) It would be helpful in the authors include a definitive evidence on the state of the chondrocytes assessed in the study. On other word, please provide a staining or expression of markers for chondrocytes differentiated state, e.g. Sox-9, Collagen X, expression.3) Data presented on ex vivo bone growth would be strongly supported if histological images are provided (staining of H/E) to define at what stage of chondrocyte differentiation is pharmacological treatment alters chondrocytes differentiation and function.4) It would be very helpful in the authors corellate the role of C-type natriuretic peptide in endothelial cells and bone growth and how the role C-type natriuretic peptide might contribute to endochondral ossification.5) Does the role of C-type natriuretic peptide regulate intramembranous bone formation, i.e. does C-type natriuretic peptide regulate osteoblast differentiation/function at a similar fashion as chondrocytes. Please discuss this in the "Discussion section"6) How does Trpm7 modulate the CNP mediated bone growth? What effect Trpm7 have on on osteogenesis or osteoclastogenesis?Essential revisions:1) The authors needs to clarify the definition of "round" chondrocytes. Does this mean differentiating/hypertrophic chondrocytes. If this is the case, then I would replace the term"round" by differentiating or hypertrophic chondrocytes.As described in many original and review articles [for example, 1, 2], growth plate chondrocytes are morphologically classified into three distinct types; round, columnar, and hypertrophic chondrocytes. We followed the established nomenclature, and “round chondrocyte” is a common word in developmental bone biology. As shown in our previous report, fluorescence microscopic observations can clearly distinguish round, columnar, and hypertrophic chondrocytes in longitudinal bone slices loaded with the ca2+ indicators (Qian N., et al., Sci Signal., 12:eaaw4847, 2019). By using the slice preparations, we have previously demonstrated that both round and columnar chondrocytes generate spontaneous TRPM7-mediated ca2+ fluctuations that promote self-maturation and growth plate development [3]. We have briefly explained cells assessed in the Method section of the revised manuscript (line 309-311 and line 361-364).2) It would be helpful in the authors include a definitive evidence on the state of the chondrocytes assessed in the study. On other word, please provide a staining or expression of markers for chondrocytes differentiated state, e.g. Sox-9, Collagen X, expression.In response to the comment, we examined the expression of several chondrocyte marker genes, including Sox9, Col10a1 and Runx2. Previous studies [4-6] indicate that Col10a1 is exclusively expressed in hypertrophic chondrocytes, whereas Sox9 expression is mainly observed in both round and columnar chondrocytes. We isolated the terminal region containing round chondrocytes and the adjacent region that is enriched with columnar and hypertrophic chondrocytes from femoral epiphyses. Both the preparations were subjected to total RNA preparations for quantitative real-time PCR analysis. In consistent with the previous reports, Col10a1 expression was densely observed in the columnar and hypertrophic preparations, whereas Sox9 expression was similar between both the preparations (Author response image 1). The new data obtained are now included in Figure 1—figure supplement 2 in the revised manuscript.
Author response image 1.
Total RNAs were prepared from growth plate sections packed with round chondrocytes or enriched with columnar and hypertrophic chondrocytes from wild-type mice and subjected to quantitative RT-PCR analysis.
The data represent the mean ± SEM, and the numbers of mice examined are shown in parentheses. Significant differences between the growth plate sections are marked with asterisks (*p<0.05 and **p<0.01 in t-test).
Total RNAs were prepared from growth plate sections packed with round chondrocytes or enriched with columnar and hypertrophic chondrocytes from wild-type mice and subjected to quantitative RT-PCR analysis.
The data represent the mean ± SEM, and the numbers of mice examined are shown in parentheses. Significant differences between the growth plate sections are marked with asterisks (*p<0.05 and **p<0.01 in t-test).We also analyzed Col10a1 and Sox9 expression in chondrocyte-specific Npr2-knockout humeral bones. The clarified profiles for the marker genes were largely similar between chondrocyte-specific Npr2-knockout and control bones, suggesting that the Npr2 deficiency does not affect fundamental chondrocytic differentiation in growth plates. The new data obtained are now included in Figure 1—figure supplement 1D in the revised manuscript.3) Data presented on ex vivo bone growth would be strongly supported if histological images are provided (staining of H/E) to define at what stage of chondrocyte differentiation is pharmacological treatment alters chondrocytes differentiation and function.In response to the comment, we histologically analyzed cultured CNP-treated bones from the chondrocyte-specific Trpm7-knockout (Trpm7fl/fl, 11Enh-Cre+/−) and control (Trpm7fl/fl, 11Enh-Cre−/−) mice. The new data obtained clearly indicate that CNP treatments extend the columnar chondrocytic zones in control bones but not in chondrocyte-specific Trpm7-knockout bones (Figure 7 in the revised manuscript). We further analyzed in detail CNP-treated metatarsal bones from wild-type mice. CNP-treatments consistently expanded the columnar chondrocytic zones but did not affect the cell densities (Figure 7—figure supplement 1 in the revised manuscript). The expansion seemed to be mainly caused by enlarged extracellular matrix area, although CNP significantly dilated the cell size in columnar and hypertrophic chondrocytes. The observations suggest that CNP promotes cell growth and extracellular matrix production but has no obvious effects on cell proliferation. These results are described in the Results and Discussion sections of the revised manuscript (line 211-214, line 219-220 and line 255-262).4) It would be very helpful in the authors corellate the role of C-type natriuretic peptide in endothelial cells and bone growth and how the role C-type natriuretic peptide might contribute to endochondral ossification.Accumulating evidence so-far indicates that CNP functions as autocrine and paracrine factors in several tissues, and is a paracrine vasodilator in blood vessels [7]. Indeed, endothelium-specific Nppc-knockout mice exhibit elevated blood pressure due to the deficiency of CNP-induced vasodilation signaling (Nppc, the gene symbol of CNP). However, endothelium-specific Nppc-knockout mice maintain normal skeletal development [8], indicating that CNP derived from endothelial cells does not correlate with bone growth.As in our reply to the comment (3), CNP-induced effects became clear in growth plates. To further analyze the effects of CNP on osteoblasts and osteoclasts in developing bones, we performed histochemical analysis as described below (see our reply to the comment 5).5) Does the role of C-type natriuretic peptide regulate intramembranous bone formation, i.e. does C-type natriuretic peptide regulate osteoblast differentiation/function at a similar fashion as chondrocytes. Please discuss this in the "Discussion section"In our Kossa-staining analysis of chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/−) and control (Npr2fl/fl, Col2a1-Cre−/−) mice, femoral bones from the E17.5 knockout mice exhibited insufficient mineralization (Author response image 2). In the chondrocyte-specific Npr2-knockout bones, the impaired ossification may be indirectly caused by impaired growth plate development. Alternatively, it might be possible that the poor mineralization underlies hyperactivation of osteoclasts and/or hypoactivation of osteoblasts due to non-specific expression of Cre recombinase in the chondrocyte-specific Npr2-knockout bones. Although NPR2 expression has not been reported in osteoclasts and osteoblasts, a recent study implies that CNP may directly stimulate osteogenic differentiation in primary cultured osteoblast progenitors [9]. On the other hand, previous in vivo study using Nppc-knockout and transgenic mice demonstrates that CNP generally induces the overgrowth of long-bones formed through endochondral ossification, but that CNP does not affect skull bone formed through intramembranous ossification [10], suggesting that CNP has no effect on osteoblastgenesis. Therefore, CNP-induced effects on osteoblasts and osteoclasts have not yet been clarified.
Author response image 2.
Impaired bone mineralization in the chondrocyte-specific Npr2-knockout embryos.
Kossa-stained mid-cross sections of femoral bones from the chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/-) and control (Npr2fl/fl, Col2a1-Cre-/-) E17.5 embryos. Scale bar, 0.3 mm. Both the cross-sectional area and Kossa-positive area were determined from digitalized images, and the Kossa-positive fraction in the cross-sectional area (Kossa-stained ratio) was calculated (graphs). n values represent the numbers of mice examined and are shown in parentheses. Significant differences between the groups are marked with asterisks (*p< 0.05, **p<0.01 in t-test).
Impaired bone mineralization in the chondrocyte-specific Npr2-knockout embryos.
Kossa-stained mid-cross sections of femoral bones from the chondrocyte-specific Npr2-knockout (Npr2fl/fl, Col2a1-Cre+/-) and control (Npr2fl/fl, Col2a1-Cre-/-) E17.5 embryos. Scale bar, 0.3 mm. Both the cross-sectional area and Kossa-positive area were determined from digitalized images, and the Kossa-positive fraction in the cross-sectional area (Kossa-stained ratio) was calculated (graphs). n values represent the numbers of mice examined and are shown in parentheses. Significant differences between the groups are marked with asterisks (*p< 0.05, **p<0.01 in t-test).In our previous study, we examined primary cultured osteoblasts and osteoclasts in ca2+ imaging, but could not detect spontaneous ca2+ fluctuations [11]. Therefore, it is unlikely that the CNP-NPR2-BK channel-TRPM7 channel axis is functioning in both the cell types. To clarify CNP-induced effects on osteoblasts and osteoclasts, it is needed to produce specific model animals; for example, osteoblast-specific Npr2-knockout mice using the Col1a1-Cre transgene and osteoclast-specific Npr2-knockout mice using the Lyz2-Cre transgene. Although we are willing to analyze CNP effects on osteoblast/clast in the future project, we cannot unfortunately make meaningful discussion on osteoblasts at the present and regret so much about it.6) How does Trpm7 modulate the CNP mediated bone growth? What effect Trpm7 have on on osteogenesis or osteoclastogenesis?We previously reported that TRPM7 channels mediate intermissive ca2+ influx in both round and columnar chondrocytes, leading to activation of ca2+/calmodulin-dependent protein kinase II (CaMKII) for promoting bone outgrowth [3]. Our preset study demonstrates that CNP-facilitated bone outgrowth essentially requires the activation of TRPM7-mediated ca2+ influx. In response to the comment, we analyzed femoral bones from chondrocyte-specific Trpm7-knockout mice by conventional activity staining for alkaline phosphatase (ALP, osteoblast marker) and tartrate-resistant acid phosphatase (TRAP, osteoclast maker). The mutant and control bones exhibited similar regional ALP and TRAP-staining densities and distributions (Author response image 3). Although Trpm7 expression and function are unknown in osteoblasts and osteoclasts at the present, Trpm7 expression in growth plate chondrocytes seems to have no obvious effects on osteoblastgenesis and osteoclastogenesis.
Author response image 3.
Histological analysis in femoral bone of chondrocyte-specific Trpm7-knockout mice.
Histological analysis of osteoblasts (ALP staining, A) and osteoclasts (TRAP staining, B) in longitudinal sections of femurs from the chondrocyte-specific Trpm7-knockout (Trpm7fl/fl, 11Enh-Cre+/-) and control (Trpm7fl/fl, 11Enh-Cre-/-) E15.5 embryos. Higher-magnification views are also shown in the lower panels. Scale bar, 0.3 mm.
Histological analysis in femoral bone of chondrocyte-specific Trpm7-knockout mice.
Histological analysis of osteoblasts (ALP staining, A) and osteoclasts (TRAP staining, B) in longitudinal sections of femurs from the chondrocyte-specific Trpm7-knockout (Trpm7fl/fl, 11Enh-Cre+/-) and control (Trpm7fl/fl, 11Enh-Cre-/-) E15.5 embryos. Higher-magnification views are also shown in the lower panels. Scale bar, 0.3 mm.References1. Hallett, S.A., Ono, W., and Ono, N. (2019). Growth Plate Chondrocytes: Skeletal Development, Growth and Beyond. International Journal of Molecular Sciences 20, 6009.2. Jochmann, K., Bachvarova, V., and Vortkamp, A. (2014). Heparan sulfate as a regulator of endochondral ossification and osteochondroma development. Matrix Biology 34, 55-63.3. Qian, N., Ichimura, A., Takei, D., Sakaguchi, R., Kitani, A., Nagaoka, R., Tomizawa, M., Miyazaki, Y., Miyachi, H., Numata, T., et al. (2019). TRPM7 channels mediate spontaneous ca2+ fluctuations in growth plate chondrocytes that promote bone development Sci Signal. 12, eaaw4847.4. Hino, K., Saito, A., Kido, M., Kanemoto, S., Asada, R., Takai, T., Cui, M., Cui, X., and Imaizumi, K. (2014). Master Regulator for Chondrogenesis, Sox9, Regulates Transcriptional Activation of the Endoplasmic Reticulum Stress Transducer BBF2H7/CREB3L2 in Chondrocytes. Journal of Biological Chemistry 289, 13810-13820.5. Kato, K., Bhattaram, P., Penzo‐Méndez, A., Gadi, A., and Lefebvre, V. (2015). SOXC Transcription Factors Induce Cartilage Growth Plate Formation in Mouse Embryos by Promoting Noncanonical WNT Signaling. Journal of Bone and Mineral Research 30, 1560-1571.6. Leung, V.Y.L., Gao, B., Leung, K.K.H., Melhado, I.G., Wynn, S.L., Au, T.Y.K., Dung, N.W.F., Lau, J.Y.B., Mak, A.C.Y., Chan, D., et al. (2011). SOX9 Governs Differentiation Stage-Specific Gene Expression in Growth Plate Chondrocytes via Direct Concomitant Transactivation and Repression. PLoS Genetics 7, e1002356.7. Moyes, A.J., and Hobbs, A.J. (2019). C-Type Natriuretic Peptide: A Multifaceted Paracrine Regulator in the Heart and Vasculature. International Journal of Molecular Sciences 20, 2281.8. Nakao, K., Kuwahara, K., Nishikimi, T., Nakagawa, Y., Kinoshita, H., Minami, T., Kuwabara, Y., Yamada, C., Yamada, Y., Tokudome, T., et al. (2017). Endothelium-Derived C-Type Natriuretic Peptide Contributes to Blood Pressure Regulation by Maintaining Endothelial Integrity. Hypertension 69, 286-296.9. Watanabe-Takano, H., Ochi, H., Chiba, A., Matsuo, A., Kanai, Y., Fukuhara, S., Ito, N., Sako, K., Miyazaki, T., Tainaka, K., et al. (2021). Mechanical load regulates bone growth via periosteal Osteocrin. Cell Reports 36, 109380.10. Nakao, K., Okubo, Y., Yasoda, A., Koyama, N., Osawa, K., Isobe, Y., Kondo, E., Fujii, T., Miura, M., Nakao, K., et al. (2012). The Effects of C-type Natriuretic Peptide on Craniofacial Skeletogenesis. Journal of Dental Research 92, 58-64.11. Chengzhu, Z., Ichimura, A., Qian, N., Iida, T., Yamazaki, D., Noma, N., Asagiri, M., Yamamoto, K., Komazaki, S., Sato, C., et al. (2016). Mice lacking the intracellular cation channel TRIC-B have compromised collagen production and impaired bone mineralization. Sci Signal. 9, ra49.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Strain, strain background (Mus musculus)
Mouse: C57BL/6J
The Jackson Laboratory
Jax: 000664
Strain, strain background (Mus musculus)
Trpm7fl/fl, Col11a2-Cre mice
Qian et al., 2019
N/A
Strain, strain background (Mus musculus)
Npr2fl/fl, Col2a1-Cre mice
Nakao et al., 2015
N/A
Antibody
Anti-phospho-CaMKII (Thr 286) (Rabbit monoclonal)
Cell Signaling Technology
Cat#12716; RRID: AB_2713889
IF (1:200)WB (1:1000)
Antibody
Anti-CaMKII (Rabbit monoclonal)
Abcam
Cat#EP1829Y; RRID: AB_868641
WB (1:1000)
Antibody
Anti-GAPDH (Rabbit polyclonal)
Sigma-Aldrich
Cat#G9545; RRID: AB_796208
WB (1:10,000)
Antibody
Anti-rabbit IgG-HRP (Mouse monoclonal)
Santa Cruz
Cat#sc-2357; RRID: AB_628497
1:2000
Antibody
Anti-rabbit Alexa Flour 488 (Goat polyclonal)
Invitrogen
Cat#A-11008; RRID: AB_143165
1:50
Sequence-based reagent
Mouse Npr1_F
This paper
PCR primers
AACAAGGAGAACAGCAGCAAC
Sequence-based reagent
Mouse Npr1_R
This paper
PCR primers
TATCAAATGCCTCAGCCTGGA
Sequence-based reagent
Mouse Npr2_F
This paper
PCR primers
GGCCCCATCCCTGATGAAC
Sequence-based reagent
Mouse Npr2_R
This paper
PCR primers
CCTGGTACCCCCTTCCTGTA
Sequence-based reagent
Mouse Npr3_F
This paper
PCR primers
GGTATGGGGACTTCTCTGTG
Sequence-based reagent
Mouse Npr3_R
This paper
PCR primers
TCTGGTCTCATCTAGTCTCA
Sequence-based reagent
FlFor
This paper
PCR primers
GTAACCTGGGTAGACTAGTTGTTGG
Sequence-based reagent
DelFor
This paper
PCR primers
TGTTATTTTGTGAGATGACG
Sequence-based reagent
Rev
This paper
PCR primers
ATGGTGGAGGAGGTCTTTAATTCC
Sequence-based reagent
Col2a1-Cre_F
This paper
PCR primers
CGTTGTGAGTTGGATAGTTG
Sequence-based reagent
Col2a1-Cre_R
This paper
PCR primers
CATTGCTGTCACTTGGTCGT
Sequence-based reagent
Mouse Prkg1_F
This paper
PCR primers
ATGGACTTTTTGTGGGACTC
Sequence-based reagent
Mouse Prkg1_R
This paper
PCR primers
GGTTTTCATTGGATCTGGGC
Sequence-based reagent
Mouse Prkg2_F
This paper
PCR primers
TTGCGGAAGAAAATGATGTCG
Sequence-based reagent
Mouse Prkg2_R
This paper
PCR primers
GAATGGGGAGGTTGAGGAGAA
Sequence-based reagent
Mouse Kcnma_F
Liu et al., 2021
PCR primers
AATGCACTTCGAGGAGGCTA
Sequence-based reagent
Mouse Kcnma_R
Liu et al., 2021
PCR primers
CTCAGCCGGTAAATTCCAAA
Sequence-based reagent
Mouse Kcnmb1_F
This paper
PCR primers
ACAACTGTGCTGCCCCTCTA
Sequence-based reagent
Mouse Kcnmb1_R
This paper
PCR primers
CACTGTTGGTTTTGATCCCG
Sequence-based reagent
Mouse Kcnmb2_F
This paper
PCR primers
TCAGGAGACACCAACACTTC
Sequence-based reagent
Mouse Kcnmb2_R
This paper
PCR primers
AGTTAGTTTCACCATAGCAA
Sequence-based reagent
Mouse Kcnmb3_F
This paper
PCR primers
GTGGATGACGGGCTGGACTT
Sequence-based reagent
Mouse Kcnmb3_R
This paper
PCR primers
GCACTTGGGGTTGGTCCTGA
Sequence-based reagent
Mouse Kcnmb4_F
This paper
PCR primers
CTCCTGACCAACCCCAAGT
Sequence-based reagent
Mouse Kcnmb4_R
This paper
PCR primers
TAAAATAGCAAGTGAATGGC
Sequence-based reagent
Mouse Kcnn1_F
Liu et al., 2021
PCR primers
TCAAAAATGCTGCTGCAAAC
Sequence-based reagent
Mouse Kcnn1_R
Liu et al., 2021
PCR primers
TCGTTCACCTTCCCTTGTTC
Sequence-based reagent
Mouse Kcnn2_F
Liu et al., 2021
PCR primers
GATCTGGCAAAGACCCAGAA
Sequence-based reagent
Mouse Kcnn2_R
Liu et al., 2021
PCR primers
GAAGTCCCTTTGCTGCTGTC
Sequence-based reagent
Mouse Kcnn3_F
Liu et al., 2021
PCR primers
ACTTCAACACCCGATTCGTC
Sequence-based reagent
Mouse Kcnn3_R
Liu et al., 2021
PCR primers
GGAAAGGAACGTGATGGAGA
Sequence-based reagent
Mouse Kcnn4_F
Liu et al., 2021
PCR primers
GGCACCTCACAGACACACTG
Sequence-based reagent
Mouse Kcnn4_R
Liu et al., 2021
PCR primers
TTTCTCCGCCTTGTTGAACT
Sequence-based reagent
Mouse Plcb1_F
Yamazaki et al., 2011
PCR primers
CCCAAGTTGCGTGAACTTCT
Sequence-based reagent
Mouse Plcb1_R
Yamazaki et al., 2011
PCR primers
GTTGCCAAGCTGAAAACCTC
Sequence-based reagent
Mouse Plcb2_F
Yamazaki et al., 2011
PCR primers
ACATCCAGGAAGTGGTCCAG
Sequence-based reagent
Mouse Plcb2_R
Yamazaki et al., 2011
PCR primers
CGCACCGACTCCTTTACTTC
Sequence-based reagent
Mouse Plcb3_F
Yamazaki et al., 2011
PCR primers
CAGGCCAGCACAGAGACATA
Sequence-based reagent
Mouse Plcb3_R
Yamazaki et al., 2011
PCR primers
AGGATGCTGGCAATCAAATC
Sequence-based reagent
Mouse Plcg1_F
This paper
PCR primers
AACGCTTTGAGGACTGGAGA
Sequence-based reagent
Mouse Plcg1_R
This paper
PCR primers
CTCCTCAATCTCTCGCAAGG
Sequence-based reagent
Mouse Plcg2_F
This paper
PCR primers
AACCCCAACCCACACGAGTC
Sequence-based reagent
Mouse Plcg2_R
This paper
PCR primers
AATGTTTCACCTTGCCCCTG
Sequence-based reagent
Mouse Trpm7_F
Qian et al., 2019
PCR primers
ATTGCTTAGTTTTGGTGTTC
Sequence-based reagent
Mouse Trpm7_R
Qian et al., 2019
PCR primers
GATTGTCGGGAGAGTGGAGT
Sequence-based reagent
Mouse Camk2a_F
This paper
PCR primers
CACCACCATTGAGGACGAAG
Sequence-based reagent
Mouse Camk2a_R
This paper
PCR primers
GGTTCAAAGGCTGTCATTCC
Sequence-based reagent
Mouse Camk2b_F
This paper
PCR primers
AAGCAGATGGAGTCAAGCC
Sequence-based reagent
Mouse Camk2b_R
This paper
PCR primers
TGCTGTCGGAAGATTCCAGG
Sequence-based reagent
Mouse Camk2d_F
This paper
PCR primers
GATAAACAACAAAGCCAACG
Sequence-based reagent
Mouse Camk2d_R
This paper
PCR primers
GTAAGCCTCAAAGTCCCCAT
Sequence-based reagent
Mouse Camk2g_F
This paper
PCR primers
CAAGAACAGCAAGCCTATCC
Sequence-based reagent
Mouse Camk2g_R
This paper
PCR primers
CCTCTGACTGACTGGTGCGA
Sequence-based reagent
Mouse Pde2a_F
This paper
PCR primers
ATCTTTGACCACTTCTCTCG
Sequence-based reagent
Mouse Pde2a_R
This paper
PCR primers
CATAACCCACTTCAGCCATC
Sequence-based reagent
Mouse Pde3a_F
This paper
PCR primers
AACTATACCTGCTCGGACTC
Sequence-based reagent
Mouse Pde3a_R
This paper
PCR primers
TTCGTGCGGCTTTATGCTGG
Sequence-based reagent
Mouse Pde3b_F
This paper
PCR primers
ATTCCAAAGCAGAGGTCATC
Sequence-based reagent
Mouse Pde3b_R
This paper
PCR primers
GTTAGAGAGCCAGCAGACAC
Sequence-based reagent
Mouse Pde5a_F
This paper
PCR primers
GACCCTTGCGTTGCTCATTG
Sequence-based reagent
Mouse Pde5a_R
This paper
PCR primers
TGATGGAGTGACAGTACAGC
Sequence-based reagent
Mouse Pde6a_F
This paper
PCR primers
AACCCACCCGCTGACCACTG
Sequence-based reagent
Mouse Pde6a_R
This paper
PCR primers
CTCTTCCTTCTTGTTGACGA
Sequence-based reagent
Mouse Pde6b_F
This paper
PCR primers
TCCGGGCCTATCTAAACTGC
Sequence-based reagent
Mouse Pde6b_R
This paper
PCR primers
AGAAGACAATTTCCCGGCCAT
Sequence-based reagent
Mouse Pde6c_F
This paper
PCR primers
TTGCTCAGGAAATGGTTATG
Sequence-based reagent
Mouse Pde6c_R
This paper
PCR primers
GAAACAGAACTCGTACAGGT
Sequence-based reagent
Mouse Pde6d_F
This paper
PCR primers
CCCAAGAAAATCCTCAAGTG
Sequence-based reagent
Mouse Pde6d_R
This paper
PCR primers
ACAAAGCCAAACTCGAAGAA
Sequence-based reagent
Mouse Pde6g_F
This paper
PCR primers
AAGGGTGAGATTCGGTCAGC
Sequence-based reagent
Mouse Pde6g_R
This paper
PCR primers
TCATCCCCAAACCCTTGCAC
Sequence-based reagent
Mouse Pde6h_F
This paper
PCR primers
GGCAGACTCGACAGTTCAAGA
Sequence-based reagent
Mouse Pde6h_R
This paper
PCR primers
CTCCAGATGGCTGAACGCT
Sequence-based reagent
Mouse Pde10a_F
This paper
PCR primers
CATCCGCAAAGCCATCATCG
Sequence-based reagent
Mouse Pde10a_R
This paper
PCR primers
TCTCATCACCCTCAGCCCAG
Sequence-based reagent
Mouse Lpar1_F
This paper
PCR primers
GCTTGGTGCCTTTATTGTCT
Sequence-based reagent
Mouse Lpar1_R
This paper
PCR primers
GGTAGGAGTAGATGATGGGG
Sequence-based reagent
Mouse Lpar2_F
This paper
PCR primers
AGTGTGCTGGTATTGCTGAC
Sequence-based reagent
Mouse Lpar2_R
This paper
PCR primers
TTTGATGGAGAGCCTGGCAG
Sequence-based reagent
Mouse Lpar3_F
This paper
PCR primers
ACTTTCCCTTCTACTACCTG
Sequence-based reagent
Mouse Lpar3_R
This paper
PCR primers
GTCTTTCCACAGCAATAACC
Sequence-based reagent
Mouse Lpar4_F
This paper
PCR primers
CCTCAGTGGTGGTATTTCAG
Sequence-based reagent
Mouse Lpar4_R
This paper
PCR primers
CACAGAAGAACAAGAAACAT
Sequence-based reagent
Mouse Lpar5_F
This paper
PCR primers
AACACGACTTCTACCAACAG
Sequence-based reagent
Mouse Lpar5_R
This paper
PCR primers
AAGACCCAGAGAGCCAGAGC
Sequence-based reagent
Mouse Lpar6_F
This paper
PCR primers
TACTTTGCCATTTCGGATTT
Sequence-based reagent
Mouse Lpar6_R
This paper
PCR primers
GCACTTCCTCCCATCACTGT
Sequence-based reagent
Mouse Atp2a1_F
Liu et al., 2021
PCR primers
CAAAACAGGGACCCTCACCA
Sequence-based reagent
Mouse Atp2a1_R
Liu et al., 2021
PCR primers
GCCAGTGATGGAGAACTCGT
Sequence-based reagent
Mouse Atp2a2_F
Liu et al., 2021
PCR primers
AAACCAGATGTCCGTGTGCA
Sequence-based reagent
Mouse Atp2a2_R
Liu et al., 2021
PCR primers
TGATGGCACTTCACTGGCTT
Sequence-based reagent
Mouse Atp2a3_F
Liu et al., 2021
PCR primers
CCTCGGTCATCTGCTCTGAC
Sequence-based reagent
Mouse Atp2a3_R
Liu et al., 2021
PCR primers
CGTGGTACCCGAAATGGTGA
Sequence-based reagent
Mouse Pln_F
This paper
PCR primers
TACCTCACTCGCTCGGCTAT
Sequence-based reagent
Mouse Pln_R
This paper
PCR primers
TGACGGAGTGCTCGGCTTTA
Sequence-based reagent
Mouse Sox9_F
Qian et al., 2019
PCR primers
AGGAAGCTGGCAGACCAGTA
Sequence-based reagent
Mouse Sox9_R
Qian et al., 2019
PCR primers
CGTTCTTCACCGACTTCCTC
Sequence-based reagent
Mouse Sox5_F
Qian et al., 2019
PCR primers
CTCGCTGGAAAGCTATGACC
Sequence-based reagent
Mouse Sox5_R
Qian et al., 2019
PCR primers
GATGGGGATCTGTGCTTGTT
Sequence-based reagent
Mouse Sox6_F
Qian et al., 2019
PCR primers
GGATTGGGGAGTACAAGCAA
Sequence-based reagent
Mouse Sox6_R
Qian et al., 2019
PCR primers
CATCTGAGGTGATGGTGTGG
Sequence-based reagent
Mouse Runx2_F
Qian et al., 2019
PCR primers
GCCGGGAATGATGAGAACTA
Sequence-based reagent
Mouse Runx2_R
Qian et al., 2019
PCR primers
GGACCGTCCACTGTCACTTT
Sequence-based reagent
Mouse Pthlh_F
Qian et al., 2019
PCR primers
CTCCCAACACCAAAAACCAC
Sequence-based reagent
Mouse Pthlh_R
Qian et al., 2019
PCR primers
GCTTGCCTTTCTTCTTCTTC
Sequence-based reagent
Mouse Acan_F
Qian et al., 2019
PCR primers
CCTCACCATCCCCTGCTACT
Sequence-based reagent
Mouse Acan_R
Qian et al., 2019
PCR primers
ACTTGATTCTTGGGGTGAGG
Sequence-based reagent
Mouse Col10a1_F
Qian et al., 2019
PCR primers
CAAGCCAGGCTATGGAAGTC
Sequence-based reagent
Mouse Col10a1_R
Qian et al., 2019
PCR primers
AGCTGGGCCAATATCTCCTT
Sequence-based reagent
Mouse Col2a1_F
Qian et al., 2019
PCR primers
CACACTGGTAAGTGGGGCAAGACCG
Sequence-based reagent
Mouse Col2a1_R
Qian et al., 2019
PCR primers
GGATTGTGTTGTTTCAGGGTTCGGG
Sequence-based reagent
Mouse 18 S_F
Qian et al., 2019
PCR primers
AGACAAATCGCTCCACCAAC
Sequence-based reagent
Mouse 18 S_R
Qian et al., 2019
PCR primers
CTCAACACGGGAAACCTCAC
Sequence-based reagent
Mouse Actb_F
Qian et al., 2019
PCR primers
CATCCGTAAAGACCTCTATGCCAAC
Sequence-based reagent
Mouse Actb_R
Qian et al., 2019
PCR primers
ATGGAGCCACCGATCCACA
Sequence-based reagent
Mouse Gapdh_F
Qian et al., 2019
PCR primers
TGTGTCCGTCGTGGATCTGA
Sequence-based reagent
Mouse Gapdh_R
Qian et al., 2019
PCR primers
TTGCTGTTGAAGTCGCAGGAG
Peptide, recombinant protein
ANP (Human, 1–28)
Peptide Institute
Cat#4135
Peptide, recombinant protein
CNP-22 (Human)
Peptide Institute
Cat#4229
Commercial assay or kit
Amersham ECL Prime Western Blotting Detection Reagent
Authors: Lina Liang; Xia Li; Sébastien Moutton; Samantha A Schrier Vergano; Benjamin Cogné; Anne Saint-Martin; Anna C E Hurst; Yushuang Hu; Olaf Bodamer; Julien Thevenon; Christina Y Hung; Bertrand Isidor; Bénédicte Gerard; Adelaide Rega; Sophie Nambot; Daphné Lehalle; Yannis Duffourd; Christel Thauvin-Robinet; Laurence Faivre; Stéphane Bézieau; Leon S Dure; Daniel C Helbling; David Bick; Chengqi Xu; Qiuyun Chen; Grazia M S Mancini; Antonio Vitobello; Qing Kenneth Wang Journal: Hum Mol Genet Date: 2019-09-01 Impact factor: 6.150
Authors: Ancy D Nalli; Divya P Kumar; Othman Al-Shboul; Sunila Mahavadi; John F Kuemmerle; John R Grider; Karnam S Murthy Journal: Cell Biochem Biophys Date: 2014-11 Impact factor: 2.194
Authors: Courtney M Mazur; Christian D Castro Andrade; Nicha Tokavanich; Tadatoshi Sato; Michael Bruce; Daniel J Brooks; Mary L Bouxsein; Jialiang S Wang; Marc N Wein Journal: iScience Date: 2022-08-27
Figure 1.
Figure 1—figure supplement 1.
Figure 1—figure supplement 2.
Figure 2.
Figure 3.
Figure 3—figure supplement 1.
Figure 3—figure supplement 2.
Figure 4.
Figure 5.
Figure 6.
Figure 7—figure supplement 1.
Figure 7.
Figure 8.
Figure 7—figure supplement 2.
Author response image 1.
Author response image 2.
Author response image 3.