Molecular screening for tick-borne bacteria and hematozoa in Ixodes cf. boliviensis and Ixodes tapirus (Ixodida: Ixodidae) from western highlands of Panama.

The first molecular screening for Rickettsia, Anaplasma, Ehrlichia, Borrelia, Babesia and Hepatozoon was carried out in questing Ixodes cf. boliviensis and Ixodes tapirus from Talamanca Mountains, Panama, using specific primers, sequencing and phylogeny. Phylogenetic analyses for the microorganisms in Ixodes cf. boliviensis confirmed the presence of Rickettsia sp. strain IbR/CRC endosymbiont (26/27 ticks), three genotypes of the Borrelia burgdorferi (sensu lato) complex (4/27 ticks), Babesia odocoilei (1/27 ticks), and Hepatozoon sp. (2/27 ticks), tentatively designated Hepatozoon sp. strain Chiriquensis. Phylogenetic analyses for the microorganisms in I. tapirus revealed an undescribed Rickettsia sp., tentatively designated Rickettsia sp. strain Itapirus LQ (6/6 ticks), and Anaplasma phagocytophilum (2/6 ticks). To the best of our knowledge, this is the first report of B. burgdorferi (s.l.) complex, A. phagocytophilum, B. odocoilei, and Hepatozoon sp. in Ixodes ticks from Central America, and also the first detection of Rickettsia spp. in Ixodes species in Panama. In light of the importance of these findings, further studies are needed focusing on the role of I. tapirus and I. cf. boliviensis as vectors, and the vertebrates acting as reservoirs.

Introduction

Ixodes (Ixodida: Ixodidae) is the most diverse genus of ticks, comprising nearly 260 species worldwide (Guglielmone et al., 2019; Saracho-Bottero et al., 2021). Of these, nearly 70 species have been reported parasitizing humans (Guglielmone & Robbins, 2018). From a public health standpoint, Ixodes spp. are considered among the most important arthropods, particularly in the Northern Hemisphere, because of their implications as vectors of Lyme disease (B. burgdorferi (s.l.) complex), granulocytic anaplasmosis (A. phagocytophilum), and to a lesser extend of babesiosis and viral diseases (CDC, 2018). In the Neotropics, where nearly 47 Ixodes species occur (Guglielmone et al., 2019; Saracho-Bottero et al., 2021), parasitism in humans is rare. Indeed, only I. boliviensis, Ixodes pararicinus and Ixodes tropicalis have been reported feeding on humans in this region (Guglielmone & Robbins, 2018; Quintero et al., 2020).

In recent decades, a diverse group of microorganisms have been detected from Ixodes spp. of South America. These finding include the spotted fever group rickettsia (SFGR) “Candidatus Rickettsia andeanae” in I. boliviensis (see Blair et al., 2004), Rickettsia spp. endosymbionts in I. pararicinus, Ixodes fuscipes and Ixodes cf. affinis (Sebastian et al., 2020), and the basal group rickettsia Rickettsia bellii in Ixodes loricatus and I. tropicalis (see Melis et al., 2020; Quintero et al., 2020). In addition, different genotypes of B. burgdorferi (s.l.) complex were reported from I. fuscipes (reported as Ixodes aragaoi), Ixodes auritulus, Ixodes longiscutatus, Ixodes neuquenensis, Ixodes paranaensis, I. pararicinus, Ixodes sigelos group, and Ixodes stilesi (see Barbieri et al., 2013; Ivanova et al., 2014; Sebastian et al., 2016; DallʼAgnol et al., 2017; Saracho-Bottero et al., 2017; Verdugo et al., 2017; Flores et al., 2018; Cicuttin et al., 2019; Muñoz-Leal et al., 2019, 2020; Carvalho et al., 2020). Further, “Candidatus Neoehrlichia chilensis” and hemoparasites of the genus Hepatozoon were found in Ixodes sp. and I. sigelos group, respectively (Muñoz-Leal et al., 2019). Although these Ixodes spp. are not of public health importance (Guglielmone & Robbins, 2018), recognizing tick species that harbor DNA of possible pathogenic microorganisms constitutes a foundational step to understand putative vector roles.

In Central America, of the 18 reported species of Ixodes, the only information on associated microorganisms corresponds to SFGR in I. boliviensis, Ixodes minor and Ixodes affinis (Troyo et al., 2014; Ogrzewalska et al., 2015; Lopes et al., 2016; Polsomboon et al., 2017; Bermúdez et al., 2021). Similar to South America, Ixodes spp. in Central America are not a public health concern (Guglielmone & Robbins, 2018). Nevertheless, serological evidence indicates exposure to Lyme disease in people and dogs from Costa Rica (Villalobos-Zúñiga & Somogyi, 2012; Montenegro et al., 2017), but this infection has not been confirmed.

Eleven species of Ixodes occur in Panama (Bermúdez et al., 2018) and there are limited data about their microorganisms (Bermúdez et al., 2021). In this study, we performed genetic screening for detection of Rickettsiales (Rickettsia and Anaplasma), B. burgdorferi (s.l.) complex, and tick-borne hematozoa (Babesia and Hepatozoon) in two species of Ixodes collected on vegetation in the Talamanca Mountains in Panama.

Materials and methods

Sites of collection, tick collection and identification

During September 2019, prospections were performed in the Chiriqui Province, within the Las Nubes station (Volcán Baru National Park, VBNP) and in Los Quetzales trail (La Amistad International Park, LAIP), at an elevation of 2,300 and 2,500 m, respectively (Fig. 1). Both sites belong to the Talamanca mountain range, which represents the highest mountains of the country, with elevations above 3,000 m, and are among the most important hot spots of diversity in Central America, and are also close to one of the main agricultural production areas in Panama. According to the Köppen-Geiger climatic classification (Kottek et al., 2006), this region corresponds to tropical wet climate (Am), but due to the high elevation, subtropical temperatures (0–20 °C), and high humidity prevails (Anonymous, 2007, 2012).

Fig. 1

A General view of Panama with Volcan Baru National Park and La Amistad International Park (black rectangle). BIxodes cf. boliviensis, female. CIxodes tapirus, female. DIxodes cf. boliviensis, male. EIxodes tapirus, male

Free-living ticks were collected using white cloth dragging and by visual search over the vegetation and preserved in 80% ethanol. The ticks were identified using a taxonomical key (Bermúdez et al., 2018).

DNA extraction and analysis

Individual ticks were bisected longitudinally using sterile scalpels and washed with distilled water to remove ethanol. DNA was extracted using the commercial kit GeneJET Genomic DNA Purification Kit (Thermo Scientific, Lithuania) following the manufacturerʼs instructions.

To compare with other Neotropical Ixodes spp., ticks were analyzed via PCR amplification of a ∼460-bp fragment of the tick mitochondrial 16S rRNA gene (Mangold et al., 1998). The identity and distances for these sequences were calculated using the Sequence Identity and Similarity calculator (Anonymous, 2021).

Extracted DNA was tested by a battery of PCR protocols targeting Rickettsia, family Anaplasmataceae, Borrelia, Babesia and Hepatozoon, using specific primers and published protocols for each agent (Table 1). In all PCR assays, distilled water was used as a negative control, and Rickettsia parkeri strain Toledo, Ehrlichia canis isolate P1091, Borrelia anserina PL and Babesia bovis Paysandú were included as positive controls. Five microliters of PCR amplicons were separated by electrophoresis in a 1.5% agarose gel, stained with GoodView TM Nucleic Acid Stain (Beijing SBS Genetech Co., LTd, China), and examined under UV transillumination. Amplicons were purified using GeneJET PCR purification kit (Thermo Fisher Scientific, Lithuania).

Table 1

List of the PCR primers used in the present study

Targeted microorganism	Gene	Primer name	Sequence	Length (bp)	Reference
Tick (mitochondrial)	16S rRNA	16S ​+ ​1	CCGGTCTGAACTCAGATCAAG	460	Mangold et al. (1998)
		16S-1	GCTCAATGATTTTTTAAATTGCTG
Rickettsia sp.	gltA	CS-78	GCAAGTATCGGTGAGGATGTAAT	401	Labruna et al. (2004)
		CS323	GCTTCCTTAAAATTCAATAAATCAGGAT
Rickettsia sp.	gltA	CS-239	GCTCTTCTCATCCTATGGCTATTAT	834	Labruna et al. (2004)
		CS-1069	CAGGGTCTTCGTGCATTTCTT
Rickettsia spotted fever group	ompA	Rr190.70p	ATGGCGAATATTTCTCCAAAA	532	Roux et al. (1996)
		Rr190.602n	AGTGCAGCATTCGCTCCCCCT
		ompB-OF	GTAACCGGAAGTAATCGTTTCGTAA	511
Rickettsia sp.	ompB	ompB-O	GCTTTATAACCAGCTAAACCACC		Choi et al. (2005)
		ompB SFG IF	GTTTAATACGTGCTGCTAACCAA	420
		ompB SFG IR	GGTTTGGCCCATATACCATAAG
Anaplasmataceae	16S rRNA	EHR16SD	AGAGTTTGATCCTGGCTCAG	1500	Inokuma et al. (2001)
		EHR16SR	ACGGCTACCTTGTTACGACTT
Ehrlichia spp.	Dsb	Dsb-330	GATGATGTTTGAAGATATSAAACAAAT	409	Doyle et al. (2005)
		Dsb-720	CTATTTTACTTCTTAAAGTTGATAWATC
		Dsb-380	ATTTTTAGRGATTTTCCAATACTTGG
Ehrlichia spp.	groEl	HS1a	AITGGGCTGGTAITGAAAT	1297	Lotric-Furlan et al. (1998)
		HS6a	CCICCIGGIACIAIACCTTC
		HS43	ATWGCWAARGAAGCATAGTC
		HSVR	CTCAACAGCAGCTCTAGTAGC
Borrelia spp.	16S rRNA	LoneTop	CTGGCAGTGCGTCTTAAGCA	869	Cyr et al. (2005)
		Tec1a/p	TCTTGCGAGCATACTCCCCAG
Borrelia spp.	flab	Fla LL	ACATATTCAGATGCAGACAGAGGT	665	Barbour et al. (1996)
		Fla RL	GCAATCATAGCCATTGCAGATTGT
		FlaRS	CTTTGATCACTTTCATTCTAATAGC
		FlaLS	AACAGCTGAAGAGCTTGGAAT
Borrelia spp.	Flab	Fla LS	AACAGCTGAAGAGCTTGGAATG	354	Barbour et al. (1996)
		Fla RS	CTTTGATCACTTATCATTCTAATAGC
Piroplasmid	18S rRNA	BAB 143-167	CCGTGCTAATTGTAGGGCTAATACA	551	Soares et al. (2017)
		BAB 694-667	GCTTGAAACACTCTARTTTTCTCAAAG

Analyses of sequences and phylogenies

Amplicons of expected size were purified and Sanger sequenced (Macrogen, Korea). Sequences were assembled and trimmed using Geneious software (Kearse et al., 2012). Consensus sequences were submitted to BLASTn analyses to compare with sequences available on GenBank. An alignment of the newly generated sequences and GenBank-retrieved homologues was built for each microorganism group with MAFFT (Katoh et al., 2002). Bayesian analyses were performed in MrBayes v3.1.2 (Huelsenbeck & Ronquist, 2001) employing four independent Markov chains, 1,000,000 metropolis-coupled MCMC generations and sampling trees every 100th generation. The first 25% of the trees were discarded as “burn-in”, and the remaining trees were used to calculate the Bayesian posterior probability.

Results

We collected 55 adults of Ixodes spp., morphologically identified as I. boliviensis (10 males and 32 females) and I. tapirus (3 males and 10 females). For molecular identification of ticks, DNA was extracted from 2 females and 2 males of I. boliviensis and 2 females of I. tapirus. Ixodes boliviensis collected in Panama showed 92% identity with I. boliviensis collected in Ecuador, South America (GenBank: KM077437) (Table 2). Since I. boliviensis corresponds to a taxon described in South America, this difference may indicate two different tick species; therefore, here we name the specimens from Panama provisionally as Ixodes cf. boliviensis. Our study also provides the first DNA sequences of I. tapirus. The newly generated 16S rDNA sequences for the two tick species are available on GenBank under the accession numbers MW717930 and MW717931 (I. tapirus females), MW717933 and MW717934 (I. cf. boliviensis female and male from VBNP), and MW717934 and MW717935 (I. cf. boliviensis female and male from LAIP). Voucher materials (15 I. cf. boliviensis and 6 I. tapirus) were deposited in the Ectoparasites Collection of the “Dr. Eustorgio Méndez” Zoological Collection of the Gorgas Memorial Institute for Health Studies, under the accession numbers CoZEM-ICGES IX096-098.

Table 2

Percent identity of 16S rDNA sequences of Ixodes cf. boliviensis and other Ixodes spp. available on GenBank

		1	2	3	4	5	6
1	Ixodes cf. boliviensis (IbH1)	–
2	Ixodes cf. boliviensis (IbM4)	99.02	–
3	Ixodes cf. boliviensis (IbH25)	99.26	99.51	–
4	Ixodes cf. boliviensis (IbM32)	99.26	99.51	100	–
5	Ixodes sp. II MO-2013 (KF702351)	98.78	99.02	99.51	99.51	–
6	Ixodes boliviensis (KM077437)	93.17	92.43	92.68	92.68	93.17	–

A total of 33 ticks were screened for Rickettsia, Anaplasma, Ehrlichia, Borrelia, Babesia and Hepatozoon, corresponding to 27 I. cf. boliviensis (20 females and 7 males) and 6 females of I. tapirus. Of these, 26 I. cf. boliviensis yielded amplicons for at least one of the species of bacteria or hematozoa, and all I. tapirus yielded amplicons for Rickettsiales (Table 3).

Table 3

Microorganisms detected in Ixodes cf. boliviensis and Ixodes tapirus from highlands of western Panama

Microorganism	LAIP		VBNP
	Ixodes cf. boliviensis		Ixodes cf. boliviensis		Ixodes tapirus
	♀ (n = 17)	♂ (n = 6)	♀ (n = 3)	♂ (n = 1)	♀ (n = 6)
	n (%)	n (%)	n (%)	n (%)	n (%)
Rickettsia sp. strain IbR/CRC	15 (88.2)	5 (83.3)	1 (33.3)	0	0
Rickettsia sp. strain Itapirus LQ	0	0	0	0	6 (100)
Anaplasma phagocytophilum	0	0	0	0	2 (33.3)
Borrelia sp. strain Talamanca A	2 (11.0)	0	0	0	0
Borrelia sp. strain Talamanca B	1 (5.8)	0	0	0	0
Borrelia sp. strain Talamanca C	1 (5.8)	0	0	0	0
Babesia odocoilei	0	1 (16.7)	1 (33.3)	0	0
Hepatozoon sp. strain Chiriquensis	2 (11.8)	0	0	0	0

Abbreviations: LAIP, La Amistad National Park, Las Nubes Station; VBNP, Volcán Barú National Park, Los Quetzales trail.

DNA of Rickettsia spp. was detected in 96% of I. cf. boliviensis and 100% of I. tapirus analyzed (Table 3). Both I. cf. boliviensis (17 females and 6 males) and I. tapirus (6 females) yielded sequences of the gltA gene which showed 99.0–99.8% similarity with Rickettsia IRS3 (GenBank: AF140706.1). Partial ompA gene sequences were generated from 19 females and 6 males of I. cf. boliviensis and all I. tapirus; these showed 98.7–99.5% similarity to Rickettsia sp. IbR-CRC2 (GenBank: KJ507218). Partial ompB gene sequences were generated from 18 females and 6 males of I. cf. boliviensis and from all I. tapirus; these showed 98.6–99.2% similarity to uncultured Rickettsia sp. clone C23 (GenBank: MF170623). The phylogenetic analyses grouped the newly generated sequences into two clades within Rickettsia endosymbionts of Ixodes spp. of the New World (Fig. 2). While the gltA and ompA genotypes detected in I. cf. boliviensis shared a clade with Rickettsia sp. strain IbR/CRC albeit with low support, the genotypes detected in I. tapirus represented a different sister lineage (Fig. 2B). Tentatively the genotype found in I. tapirus is designated as Rickettsia strain Itapirus LQ, after the species of tick and the name of the trail (Los Quetzales).

Fig. 2

Bayesian phylogenetic trees for Rickettsia spp. based on the gltA (A) and ompA (B) genes. Bayesian posterior probabilities are shown at the nodes (only values > 0.95 are shown). Rickettsia sibirica and Rickettsia parkeri were used as the outgroup. The newly generated sequences are indicated in bold

DNA of A. phagocytophilum was detected in two I. tapirus females. The sequences generated for both 16S rRNA and groEl genes were identical for each gene and showed a similarity to A. phagocytophilum reported on GenBank (98.6% for 16S rDNA (AY527213, KP276588) and 100% for groEl (KM215261, EU246959)). Phylogenetic analyses for both genes confirmed the similarity among A. phagocytophilum detected in the two I. tapirus females, which formed a separate clade within other isolates of A. phagocytophilum reported from vertebrates and ticks (Fig. 3).

Fig. 3

Bayesian phylogenetic trees for Anaplasma phagocytophilum based on the 16S rDNA (A) and groEl (B) genes. Bayesian posterior probabilities are shown at the nodes (only values > 0.95 are shown). Ehrlichia ruminantium was used as the outgroup. The newly generated sequences are indicated in bold

DNA of Borrelia spp. was amplified in four I. cf. boliviensis females from LAIP using the flaB gene primers but not with Borrelia genus-specific primers for the 16S rRNA gene. BLASTn searches revealed a similarity of 97–99% of the newly generated sequences with Borrelia carolinensis isolate BR1972-11 (GenBank: MK604312), and three sequences showed 98% similarity with Borrelia lanei isolate BR1945-11 (GenBank: MK604329). The phylogenetic analysis showed that three genotypes grouped within the B. burgdorferi (s.l.) complex (Fig. 4). Tentatively these genotypes are designated as Borrelia sp. strain Talamanca A, B and C, after the mountainous region where they were detected (Table 3). Borrelia sp. Talamanca A formed a closely related monophyletic group with B. burgdorferi (s.s.).

Fig. 4

Bayesian phylogenetic trees for Borrelia spp. based on the flaB gene. Bayesian posterior probabilities are shown at the nodes (only values > 0.95 are shown). Borrelia turcica and Borrelia tachyglossi were used as the outgroup. The newly generated sequences are indicated in bold

Finally, in three I. cf. boliviensis we obtained two identical sequences of the 18S rRNA gene, which were compatible with Hepatozoon sp. We tentatively designated these as Hepatozoon sp. strain Chiriquensis, after the province of Chiriqui. In the phylogenetic analysis, these sequences were grouped with sequences obtained from ticks or mustelids (Fig. 5); however, the support for this relationship was low. DNA of B. odocoilei was detected in one I. cf. boliviensis; the sequence showed 98% similarity to B. odocoilei (GenBank: MF357057.1). The phylogenetic analysis showed that this sequence clusters within the well-supported B. odocoilei clade (Fig. 6).

Fig. 5

Bayesian phylogenetic tree for Hepatozoon spp. based on the 18S rRNA gene. Bayesian posterior probabilities are shown at the nodes (only values > 0.95 are shown). Adelina grylli was used as the outgroup. The newly generated sequence is indicated in bold

Fig. 6

Bayesian phylogenetic trees for Babesia based on the 18S rRNA gene. Bayesian posterior probabilities are shown at the nodes (only values > 0.95 are shown). Theileria parva was used as the outgroup. The newly generated sequence is indicated in bold

Discussion

Ixodes cf. boliviensis and I. tapirus have been reported in highlands of Panama since the middle of the 20th century (Fairchild et al., 1966); however, little is known about these species. Both species are common to collect in trails of VBNP and LAIP, and crawl actively in the underbrush vegetation, possibly due to the behavior of their hosts. In Panama, I. cf. boliviensis feeds mainly on wild and domestic carnivores, but also other mammals and humans are included as sporadic hosts (Fairchild et al., 1966; Bermúdez et al., 2018). Since I. cf. boliviensis could be a species different from I. boliviensis, this fact is relevant for public health, because the only reports of I. boliviensis parasitizing humans have been registered in Mexico and Central America, but not in South America (Guglielmone & Robbins, 2018). Regarding I. tapirus, to our knowledge, tapirs (Tapirus pinchaque and Tapirus bairdii) are the only hosts of this species (Fairchild et al., 1966; Apanaskevich et al., 2017).

To the best of our knowledge, this is the first study to molecularly detect multiple microorganisms in questing I. cf. boliviensis and I. tapirus. Despite the small numbers of ticks analyzed, it is interesting to note the wide variety of microorganisms found in both species. Since these findings were in adults in questing phases, the presence of these microorganisms must be a result of transstadial transmission.

Rickettsia sp. strain IbR/CRC was initially found in I. boliviensis from Costa Rica (Troyo et al., 2014), therefore our finding was to be expected, considering that Talamanca Mountains extend to Costa Rica and represent similar environments. Our phylogenetic analysis showed that Rickettsia strain Itapirus LQ differs from Rickettsia sp. strain IbR/CRC; therefore, the degree of nucleotide dissimilarity (0.1–0.2% for gltA and 0.2–0.4% for ompA) allows these to be considered as two different endosymbionts, and not a genetic variety. Regarding the ompB gene, the use of a highly conserved fragment prevented the separation of these Rickettsia genotypes. Considering Fournier et al. (2003) and Fournier and Raoult (2009) about the differences in the homologous sequences of gltA, ompA and ompB genes, and the present phylogenetic analysis, both rickettsiae represent endosymbionts of the genus Rickettsia not yet described.

Rickettsia endosymbionts can be transmitted vertically and show a high prevalence in tick populations (Socolovschi et al., 2009; Kurtti et al., 2015), a fact that explains our findings in I. cf. boliviensis (96%) and I. tapirus (100%). Other Rickettsia endosymbionts from Central American Ixodes spp. include Rickettsia sp. strain Barva in I. minor from Costa Rica (Ogrzewalska et al., 2015) and Rickettsia spp. in I. affinis from Belize and Panama (Lopes et al., 2016; Polsomboon et al., 2017; Bermúdez et al., 2021). Springer et al. (2018) reported Rickettsia monacensis in I. boliviensis from Costa Rica based on multi-locus typing of seven loci; however, our phylogenetic analyses showed that Rickettsia sp. IbR/CRC strain from Costa Rica and Panama share, albeit with low support, the same clade with other Rickettsia endosymbionts reported in Ixodes spp. of Central and South America. This clade is separate from R. monacensis; therefore, because this pathogen is reported from Ixodes ricinus complex in Europe, its records from Ixodes spp. in Central America must be considered with caution.

This is the first report of A. phagocytophilum in I. tapirus. Phylogenetic results demonstrated various genotypes of A. phagocytophilum around the world, which have been detected in Ixodes spp. or from different groups of mammals (Brouqui & Matzumoto, 2007). This pathogen affects domestic mammals such as horses, ruminants and carnivores, and also causes human granulocytic anaplasmosis, a disease reported in some countries of Europe and in the USA (Grzeszczuk et al., 2007).

In the Neotropics, information of Anaplasma spp. includes reports in mammals and ticks from Mexico (Ojeda-Chi et al., 2019) and South America (Santos et al., 2013; Félix et al., 2020). In Ecuador, genotypes closely related to A. phagocytophilum were reported in Amblyomma multipunctum collected from T. pinchaque and vegetation (Pesquera et al., 2015). The finding of Anaplasma spp. in A. multipunctum and I. tapirus may represent a potential ticks-tapirs relationship to investigate. Since A. phagocytophilum is a pathogen of medical and veterinary importance, its relevance in Panama should be considered.

Our findings of three genotypes of the B. burgdorferi (s.l.) complex in I. cf. boliviensis, indicate that the Talamanca strain A is a sister group of B. burgdorferi (s.s.), while strains Talamanca B and C represent different lineages. Considering the diversity of this complex in South American Ixodes spp., our results indicate that B. burgdorferi (s.l.) complex may be widely distributed in Talamanca Mountains. Since B. burgdorferi (s.l.) complex includes more than 20 species of pathogens and endosymbionts (Carvalho et al., 2020), our findings do not necessarily indicate a risk to public health, even though Ixodes cf. boliviensis is a synanthropic and anthropophilic tick in the highlands of Panama (Bermúdez et al., 2016, 2018).

Babesia odocoilei is a parasite of deer in North America and has been related to Ixodes scapularis (see Milnes et al., 2019). Criado-Fornelio et al. (2003) pointed out that B. odocoilei belongs to the “true” Babesia group, along with Babesia canis, Babesia gibsoni and Babesia divergens, and Vannier and Krausse (2009) indicated that Babesia venatorum is a species closely related to B. odocoilei.

According to Smith (1996), the genus Hepatozoon includes more than 300 species. Reports for Hepatozoon spp. from Panama include Hepatozoon muris and Hepatozoon procyonis, diagnosed by microscopy of blood samples from rats and raccoons, respectively (Schneider, 1968), and an undescribed Hepatozoon sp. from a blood sample form the pit viper Bothrops asper (see Quintero et al., 2021). Phylogenetic analyzes indicate that the Hepatozoon strain Chiriquensis detected here represents a putative new species.

Conclusions

In comparison to other genera of the family Ixodidae, such as Amblyomma or Rhipicephalus, there are few studies of Ixodes spp. from Panama and Central America (Bermúdez et al., 2016; Bermúdez & Troyo, 2018). Our results present novel data for different microorganisms associated with two species of Ixodes, showing the importance that these ticks may have in enzootic cycles for pathogens such as A. phagocytophilum, but also in the maintenance of species whose pathogenic potential remains unknown, such as Rickettsia spp. strains IbR/CRC and Rickettsia sp. strain Itapirus LQ, Borrelia sp. strains Talamanca, B. odocoilei, and Hepatozoon sp. strain Chiriquensis. Therefore, further studies are necessary to demonstrate the ecology of these microorganisms in the Talamanca Mountains range.

Funding

This project was financed by the Programa de Desarrollo de las Ciencias Básicas (PEDEClBA), .

CRediT author statement

SEBC and JMV conceived the study. SEBC, LD, NK and JMV collected ticks in the field. SEBC and LD identified ticks. MLF, JMV and SEBC performed the laboratory work and molecular analyses. SM-L and JMV performed phylogenetic analyses. SEBC and JMV drafted the manuscript. All authors contributed to reviewing the manuscript, and read and approved the final version.

Data availability

Partial gene sequences generated in this study are deposited in the GenBank database: Rickettsia sp. strain IbR/CRC (gltA: MW699688-MW699694; ompA: MW699697-MW699700, MW731468, MW731469; ompB: MW699702, MW699703, MW699706-MW699709); Rickettsia sp. strain Itapirus LQ (gltA: MW699694, MW699695; ompA: MW699696, MW699701; ompB: MW699704, MW699705); A. phagocytophilum (16S rDNA: MW677507, MW677508; groEl: MW699686, MW699687); B. burgdorferi (s.l.) complex Talamanca A (MW699712, MW699713); B. burgdorferi (s.l.) complex Talamanca B (MW699714); B. burgdorferi (s.l.) complex Talamanca C (MW699711); B. odocoilei (MW724527); and Hepatozoon sp. strain Chiriquensis (MW724528).

Declaration of competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.