| Literature DB >> 35284839 |
Miriam A Lynn1, Feargal J Ryan1,2, Yee C Tee1, Saoirse C Benson1,2, David J Lynn1,2.
Abstract
We present this protocol using a mouse model to assess the impact of early-life antibiotic exposure on mammalian lifespan and the composition of the gut microbiota over time. We describe longitudinal fecal sampling and health monitoring following early-life antibiotic exposure. We detail DNA extraction and 16S rRNA gene sequencing to longitudinally profile the composition of the fecal microbiota. Finally, we discuss how to address potential confounders such as the stochastic recolonization of the gut microbiota following antibiotic exposure. For complete details on the use and execution of this protocol, please refer to Lynn et al. (2021).Entities:
Keywords: Immunology; Metabolism; Microbiology; Model Organisms; Molecular Biology; Sequencing
Mesh:
Substances:
Year: 2022 PMID: 35284839 PMCID: PMC8904607 DOI: 10.1016/j.xpro.2022.101220
Source DB: PubMed Journal: STAR Protoc ISSN: 2666-1667
Figure 1Schematic of sterile antibiotic drinking preparation
Preparation of the 16S rRNA gene qRT-PCR to assess bacterial load
| Component | Volume |
|---|---|
| SYBR™ Green PCR Master Mix | 5 μL |
| 2 μM of 16S rRNA gene forward primer | 1 μL |
| 2 μM of 16S rRNA gene reverse primer | 1 μL |
| DNA template | 3 μL |
The PCR cycling conditions for each 16S rRNA gene qRT-PCR assay
| PCR cycling conditions | |||
|---|---|---|---|
| Steps | Temperature | Time | Cycles |
| Initial denaturation | 95°C | 10 min | 1 |
| Denaturation | 95°C | 15 s | 35–40 cycles |
| Annealing & extension | 60°C | 60 s | |
| Final extension | 72°C | 10 min | |
| Hold | 4°C | forever | 1 |
Figure 2Antibiotic treatment (ABX) results in significantly reduced bacterial load in antibiotics exposed dams
Bacterial load as determined by copies of the 16S rRNA genes in fecal samples collected from antibiotic treated (ABX) and untreated dams (NO ABX) at day 21 post-birth. Data are represented as mean ± SEM. A Mann Whitney test was used to assess statistical significance, where ∗∗∗p < 0.001.
Figure 3Antibiotic treatment (ABX) results in significantly reduced bacterial in antibiotics pups
Bacterial load as determined by copies of the 16S rRNA genes in fecal samples collected from antibiotic treated (ABX) and untreated dams (NO ABX) at day 21 post-birth. Data are represented as mean ± SEM. A Mann Whitney test utilized to assess statistical significance, where ∗∗∗∗p < 0.0001.
Figure 4Composition of the fecal microbiota in antibiotic exposed and unexposed mice throughout life
The composition of microbiota in unexposed mice (no ABX, n=20) and mice exposed to antibiotics in early life (n=20) was profiled using 16S rRNA gene sequencing of DNA extracted from pooled fecal samples collected at specific intervals from 1 week post-antibiotic exposure (week 4 of age) to week 102 of life. Two distinct microbiota community types were evident: post-antibiotic exposure (PAM I and PAM II, n=10/group). Note: Reprinted from “The composition of the gut microbiota following early life antibiotic exposure affects host health and longevity in later life,” by (Lynn et al., 2021). Reprinted with permission.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Ampicillin sodium salt | Merck | Cat#A0166 |
| Neomycin trisulfate salt hydrate | Merck | Cat#N1876 |
| LB broth base | Invitrogen | Cat#12780-052 |
| Agar bacteriological | Oxoid | Cat#LP0011 |
| 1× PBS | Merck | Cat#D8537 |
| DH5α competent cells | Thermo Fisher Scientific | Cat#18265017 |
| Mouse fecal samples | ( | N/A |
| Qubit™ ds DNA BR kit | Invitrogen | Cat#Q32850 |
| SYBR™ Green PCR Master Mix | ABI via Thermo Fisher Scientific | Cat# 4309155 |
| DNeasy Powerlyzer Powersoil kit | QIAGEN | Cat#12855-50 |
| 16S rRNA gene sequence data | SRA Bioproject | PRJNA645716 |
| C57BL/6J | The Jackson Laboratory | Cat#000664 |
| 16S f 5«-TCCTACGGGAGGCAGCAGT-3« | ( | N/A |
| 16S r 5«GGACTACCAGGGTATCTAATCCTGTT-3« | ( | N/A |
| 515F 5′TCGTCGGCAGCGTCAGATGTGTATAAGA | Illumina | N/A |
| 806R 5′GTCTCGTGGGCTCGGAGATGTGTATAAG | Illumina | N/A |
| QuantStudio 7 Real-Time PCR System Software | Applied BioSystem | version 1.7.1 |
| GraphPad Prism 7.01 | GraphPad Software Inc | version 7.01 |
| QIIME2 | ( | version 2019.10 |
| DADA2 | ( | version 1.8 |
| FastTree | ( | version 2 |
| GreenGenes | ( | version 13.8 |
| PICRUSt2 | ( | version 2.3 |
| PhyloSeq | ( | version 1.3 |
| R | R Core Team | version 3.6.3 |
| ggplot2 | ( | version 3.3 |
| R code for analysis and plots | ( | |
| QuantStudio 7 Real-Time PCR | Applied BioSystem | Cat# 4485701 |
| Precellys® 24 Tissue Homogenizer | Bertin Instruments | Cat#P000669-PR240-A |
| Qubit Fluorometer | Invitrogen | Version 3.0 |
| Millex-GP Syringe Filter Unit, 0.22 μm | Merck | Cat# SLGP033RS |
| MiSeq system | Illumina | Cat# SY-410-1003 |
| Nextera XT Index Kit v2 | Illumina | Cat# FC-131-1001 |