| Literature DB >> 35284239 |
Saeed Samarghandian1, Fahimeh Ghasemi2,3, Hamed Aramjoo4, Fariborz Samini5,6, Michael Aschner7, Babak Roshanravan8, Tahereh Farkhondeh4,9.
Abstract
The study investigated the effect of buprenorphine (BUP) on oxidative indices and gene expression of apoptotic molecules in the hippocampus of neonates during the fetal stage. BUP (1 or 0.5 mg/kg) was subcutaneously administrated to pregnant rat dams. After parturition, the pups were maintained to the end of breastfeeding period, then hippocampi were assessed for oxidative stress indices [glutathione (GSH), thiobarbituric acid reactive substances (TBARS), superoxide dismutase (SOD), total antioxidant capacity (TAC)] and mRNA expression of apoptotic markers (Bax, Bcl2 and caspase 3). Our data indicated that BUP (0.5 mg/kg) administration during gestation significantly increased GSH and TAC concentrations in the hippocampus of pups versus control group (p < 0.05). BUP (0.5 and 1 mg/kg) administration significantly elevated the expression levels of Bcl2 in the hippocampus of neonates compared with controls. BUP injection (0.5 and 1 mg/kg) to pregnant rats markedly reduced the expression levels of caspase 3 in the hippocampus of neonates in BUP 0.5 group (p < 0.01) and BUP 1 group (p < 0.05) versus the controls. Our study indicated that BUP may potentiate antioxidant system and inhibit apoptosis and oxidative stress in the hippocampus of neonates received this drug during the fetal stage.Entities:
Keywords: Apoptosis; Brain; Buprenorphine; Oxidative stress; Pup; Rat
Year: 2022 PMID: 35284239 PMCID: PMC8908041 DOI: 10.1016/j.toxrep.2022.03.002
Source DB: PubMed Journal: Toxicol Rep ISSN: 2214-7500
Oxidative stress parameters in hippocampus of the control and buprenorphine-exposed pups during the fetal stage.
| Groups | SOD | MDA | GSH | TAC |
|---|---|---|---|---|
| 7.85 ± 1.08 | 16.06 ± 1.56 | 18.55 ± 0.71 | 6.08 ± 1.29 | |
| 8.23 ± 1.70 | 12.12 ± 0.80 | 23.89 ± 1.55 | ||
| * | 10.23 ± 1.08 | |||
| * | ||||
| 6.93 ± 0.97 | 15.23 ± 1.96 | 20.74 ± 1.03 | 6.90 ± 1.16 | |
| F = 0.26 | ||||
| P Value = 0.77 | F = 1.86 | |||
| P Value = 0.19 | F = 5.28 | |||
| P Value = 0.018 | F = 4.89 | |||
| P Value = 0.03 |
Fig. 1Bax and Bcl2 mRNA expressions in neonatal rat hippocampus.
Abbreviations: C: control, BUP 0.5: Buprenorphine 05 mg/kg, BUP 1: Buprenorphine 1 mg/kg.
Significant difference between the data of the C group vs other control groups: * *; p < 0.01.
Fig. 2Caspase 3 mRNA expressions in neonatal rat hippocampus.
Abbreviations: C: control, BUP 0.5: Buprenorphine 05 mg/kg, BUP 1: Buprenorphine 1 mg/kg.
Significant difference between the data of the C group vs other control groups: * ; p < 0.05, * *; p < 0.01.
| Total RNA | 0.1 ng–5 μl |
|---|---|
| Random hexamer | 1 μl |
| nuclease-free H2O | variable |
| Total Volume | μl |
| 5x first strand buffer | 4 μl |
|---|---|
| dNTPs (10 mM each) | 1 μl |
| 0.5 μl | |
| M-MLV)200 U/μl) | 1 μl |
| Sequence | Gene |
|---|---|
| F: AGGGCTGCTTTTAACTCTGG | GAPDH |
| F:TGCTTCAGGGTTTCATCCA | Bax |
| F:GATAACGGAGGCTGGGTAGG | Bcl2 |
| F:GTTTGAGCCTGAGCAGAGACAT | Caspase 3 |