Literature DB >> 35274046

lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells.

Zhiping Liu1, Kaibing Hu1, Xiang Wang1, Youqian Zhang1, Weiping Wang1, Yindi Wu2.   

Abstract

Gastric cancer (GC) is one of the most common malignancies in digestive system. Accumulating evidence reveals the critical role of long noncoding RNAs (lncRNAs) in GC development. The study aimed to explore the functions and mechanism of lncRNA actin alpha 2, smooth muscle antisense RNA 1 (ACTA2-AS1) in GC. Reverse transcription-quantitative polymerase chain reaction analyses and subcellular fractionation assays showed that ACTA2-AS1 was lowly expressed in GC cells and was mainly distributed in the cytoplasm. Overexpressed ACTA2-AS1 inhibited GC cell viability, proliferation, migration, invasion, and epithelial-mesenchymal transition process, as suggested by cell counting kit-8 assays, colony formation assays, wound healing assays, Transwell assays and Western blot analyses. Mechanistically, ACTA2-AS1 served as a competing endogenous RNA (ceRNA) to bind with miR-378a-3p and thereby, antagonized the inhibitory effect of miR-378a-3p on the expression of messenger RNA phosphatidylinositol specific phospholipase C X domain containing 2 (PLCXD2). The binding capacity between miR-378a-3p and ACTA2-AS1 (or PLCXD2) was detected by RNA pulldown assays, luciferase reporter assays and RNA immunoprecipitation assays. Moreover, PLCXD2 knockdown rescued the inhibitory effect of ACTA2-AS1 overexpression on malignant behaviors of GC cells. Overall, ACTA2-AS1 inhibits malignant phenotypes of GC cells by acting as a ceRNA to target miR-378a-3p/PLCXD2 axis.
© 2022 Zhiping Liu et al., published by De Gruyter.

Entities:  

Keywords:  ACTA2-AS1; PLCXD2; ceRNA; gastric cancer; miR-378a-3p

Year:  2022        PMID: 35274046      PMCID: PMC8854910          DOI: 10.1515/med-2021-0406

Source DB:  PubMed          Journal:  Open Med (Wars)


Introduction

Gastric cancer (GC) is the third most common cause of cancer death worldwide [1,2]. As a highly heterogenous disease at molecular and phenotypical levels, GC is the fifth most common cancer worldwide and the estimated new cases of GC is over one million each year [1]. Infection with Helicobacter pylori is the main risk factor for GC [3,4]. In recent decades, with the development of new chemotherapy drugs and tumor immunotherapy, clinical treatments for GC patients have been continuously improved [5,6]. In addition, targeted therapies have become heated due to advancement in microarrays and next generation sequencing [7]. However, developing targeted drugs for GC still has a long way to go due to molecular complexity [8]. Therefore, understanding the functions and mechanisms of dysregulated molecules in GC is of great significance. Long noncoding RNAs (lncRNAs) are transcripts with over 200 nucleotides in length that lack the capacity to encode protein [9,10]. Previous studies show that many lncRNAs participate in biological processes of various types of cancer including GC [11,12]. For example, lncRNA HOX transcript antisense RNA (HOTAIR) facilitates the metastasis of GC by sponging miR-1277-5p and increasing the expression of collagen type V alpha 1 chain (COL5A1) [13]. lncRNA small nucleolar RNA host gene 11 (SNHG11) promotes GC cell stemness and epithelial-to-mesenchymal transition (EMT) process by activating the Wnt/β-Catenin pathway [14]. According to bioinformatics analysis, lncRNA actin alpha 2, smooth muscle antisense RNA 1 (ACTA2-AS1) is lowly expressed in tissue samples of stomach adenocarcinoma (STAD). In previous studies, ACTA2-AS1 acts as an oncogene in cervical cancer and ovarian cancer, while serving as antioncogene in liver cancer and lung adenocarcinoma [15,16,17,18]. However, the functions and mechanism of ACTA2-AS1 in GC have not been reported. Mechanistically, lncRNAs can serve as competing endogenous RNAs (ceRNAs) to regulate gene expression at the post transcriptional level [19]. Specifically, lncRNAs bind with microRNAs (miRNAs) to antagonize the suppressive effect of miRNAs on the expression of messenger RNAs (mRNAs) [20]. The lncRNA-miRNA-mRNA network is frequently reported in GC. For example, lncRNA plasmacytoma variant translocation 1 functions as a ceRNA for miR-30a to increase the expression of Snail, thereby promoting GC migration [21]. LINC01436 facilitates malignant phenotypes of GC cells by binding with miR-513a-5p as a ceRNA to upregulate the expression of acclimation of photosynthesis to environment [22]. The ceRNA role of ACTA2-AS1 has been verified in other cancer types. For example, ACTA2-AS1 serves as the ceRNA of miR-143-3p to upregulate the expression of SMAD family member 3, contributing to the development of cervical cancer [15]. ACTA2-AS1 inhibits malignant characters of colon adenocarcinoma cells via the miR-4428/B-cell lymphoma 2 like 11 (BCL2L11) axis [23]. Hence, we hypothesized that ACTA2-AS1 might play an antioncogenic role in the development of GC by acting as a ceRNA. In conclusion, the biological significance and potential regulatory mechanism of ACTA2-AS1 in GC were investigated in the study. We hypothesized that ACTA2-AS1 might play an antioncogenic role in GC and function as a ceRNA. The study may provide novel theoretical targets for GC diagnosis and treatment.

Materials and methods

Bioinformatics analysis

ACTA2-AS1 expression in STAD tissue samples and normal samples was analyzed by GEPIA (http://gepia.cancer-pku.cn/) and starBase v3.0 (http://starbase.sysu.edu.cn/index.php) [24,25]. MiRNAs that have binding site with ACTA2-AS1 were predicted using the starBase with the screening condition of cross-linking and immunoprecipitation (CLIP)-Data ≥ 1 and pan-Cancer ≥ 4, and three miRNAs (miR-378c, miR-378a-3p, and miR-378d) were selected. Target genes of miR-378a-3p were searched using miRDB (http://mirdb.org/) with the criterion of target score ≥ 90, and nine target genes (PLCXD2, NR2C2, KIAA1522, PHC3, ZNF124, ELAC1, KCNIP2, VPS53, and JADE3) were selected for the study [26]. Phosphatidylinositol specific phospholipase C X domain containing 2 (PLCXD2) expression in STAD tissues (n = 408) and normal tissues (n = 211) was analyzed by GEPIA.

Cell culture

Human gastric epithelial cell line (GES-1) and three GC cell lines (SGC7901, AGS, and MKN-45) were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). The three GC cell lines were identified for this study according to previous studies [27,28,29,30]. Cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco, Gaithersburg, MD, USA) with 10% fetal bovine serum (Gibco), 100 U/mL penicillin, and 100 µg/mL streptomycin (Invitrogen, Carlsbad, CA, USA) in a humidified atmosphere with 5% CO2 at 37°C [31].

Cell transfection

Short hairpin RNAs (shRNAs) against ACTA2-AS1 (sh-ACTA2-AS1#1/2) and PLCXD2 (sh-PLCXD2#1/2), shRNA negative control (sh-NC), miR-378a-3p inhibitor, and miRNA inhibitor control (NC inhibitor) were purchased from GenePharma (Shanghai, China). The full length of ACTA2-AS1 was inserted into pcDNA3.1 vector to overexpress ACTA2-AS1 expression, with empty pcDNA3.1 vector as the negative control. Cell transfection was conducted using Lipofectamine 2,000 (Invitrogen) according to the manufacturer’s recommendations. The concentration of shRNAs was 40 nM, that of pcDNA3.1 vectors was 10 nM, and that of miR-378a-3p inhibitor or NC inhibitor was 50 nM. In brief, cells were cultured in 24-well plates until 70–90% monolayer was formed. Then, plasmid DNA-lipid complexes were prepared and incubated at room temperature for 5 min. Next the complexes were supplemented to cells [32]. The efficiency was examined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) after 48 h [27].

RT-qPCR

RT-qPCR was performed based on the previous study [33]. TRIzol reagent (Invitrogen) was used to extract total RNA from GC cells. Then, total RNA was reverse transcribed into complementary DNA (cDNA) using PrimeScriptTM RT reagent kit (RRO36A, Takara, Dalian, China) and gDNA Eraser (Takara). RT-qPCR was performed using SYBR Premix Ex Taq kits (Takara) on ABI7500 quantitative PCR machine (Thermo Fisher, Waltham, MA, USA). PCR was performed at 95°C for 30 s, followed by 45 cycles of 95°C for 5 s and 60°C for 30 s [34]. The 2−ΔΔCt method was utilized to calculate gene expression [35]. GAPDH was used as an endogenous control for expression levels of ACTA2-AS1 and candidate mRNAs, and the expression of candidate miRNAs was normalized to U6 snRNA. Sequences of all primers used for RT-qPCR are provided in Table 1.
Table 1

Sequences of primers used for RT-qPCR

GeneSequence (5′→3′)
ACTA2-AS1 forwardGCTCTATGTCTTCCTGCCT
ACTA2-AS1 reverseAAAGCATTTCTGTTGTAGCCC
miR-378a-3p forwardACTGGACTTGGAGTCAGAAGGC
miR-378a-3p reverseCTCTACAGCTATATTGCCAGCCAC
PLCXD2 forwardAGACTGTTTCTTCAACTGAGAG
PLCXD2 reverseTCATGTGAGCCTTTGAGAG
miR-378c forwardACTGGACTTGGAGTCAGAAGAGTG
miR-378c reverseCTCTACAGCTATATTGCCAGCCAC
miR-378d forwardACTGGACTTGGAGTCAGAAA
miR-378d reverseCTCTACAGCTATATTGCCAGCC
NR2C2 forwardGAATGAGCTCTTCACCCTC
NR2C2 reverseGAAAGTTTATCTTCCTGGATGC
KIAA1522 forwardCATCCTACGTGGCTGAGAG
KIAA1522 reverseTTTCTGTGAGTCTTTGCGC
PHC3 forwardCCTTTGTTAGAGCAAGTGGA
PHC3 reverseATGTGAGGGATCTGATGGAG
ZNF124 forwardATGGGTTTCTACTCTAATGAGG
ZNF124 reverseCAGCCTCTTAGTAGCTGTG
ELAC1 forwardCAACTTAAAGCAGAATTCCCTC
ELAC1 reverseCAAGGTCTTTAAGTTTCTGTGC
KCNIP2 forwardCTCAAGGAGACTCCAGCAC
KCNIP2 reverseGAACTCCAGGAAACAGGCT
VPS53 forwardGTTCACTCTGGAGGAGCTC
VPS53 reverseTTCTTCTAGCTGCTGGGTG
JADE3 forwardCTTTACTTCTGGCTCAATGTATAGG
JADE3 reverseGTCCTTCCGGAATACCTCAG
GAPDH forwardTCATTTCCTGGTATGACAACGA
GAPDH reverseGTCTTACTCCTTGGAGGCC
U6 forwardCTTTGGCAGCACATATACCA
U6 reverseCTCATTCAGAGGCCATGCT
Sequences of primers used for RT-qPCR

Subcellular fractionation assay

The cytoplasmic and nuclear fraction of ACTA2-AS1 or PLCXD2 were extracted from GC cells using the NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher) and the RNeasy Midi Kit (Qiagen, Valencia, CA, USA). In brief, cells were incubated with lysis solution for 10 min on ice and then were centrifuged at 12,000g for 3 min. Cytoplasmic RNA was collected from the supernatant, while nuclear RNA was extracted from nuclear pellet. RT-qPCR analysis was applied to examine extracted RNAs. GAPDH was regarded as a cytoplasmic control, while U6 was a nuclear control. The assay was conducted according to the previous study [36].

Cell counting kit-8 (CCK-8) assay

According to the previous study [37], SGC7901 and AGS cells were seeded into 96-well plates (1 × 104 cells/well) in 100 μL of culture medium. At the time point of 0, 24, 48, and 72 h, 10 μL of CCK-8 solution (Dojindo, Tokyo, Japan) was added to each well of the plates for additional 4 h of incubation at 37°C. A microplate reader (Thermo Fisher) was utilized to detect the value of optical density at 450 nm.

Colony formation assay

SGC7901 and AGS cells were plated to 6-well plates (1 × 103 cells/well) and cultured for 14 days at 37°C. For every 2 days, the medium was changed. Next cell colonies were fixed with 4% paraformaldehyde and stained with 0.2% crystal violet (Beyotime, Shanghai, China) for 30 min. Finally, colonies (>50 cells/colony) was counted and imaged by a gel documentation system (Bio-Rad, Shanghai, China). The assay was conducted based on the previous report [37].

Wound healing assay

The assay was performed to determine the migratory capacity of GC cells according to the study [38]. SGC7901 and AGS cells were seeded into 6-well plates (3 × 105 cells/well) until 90% confluence. Next cell monolayers were disrupted by generating a linear wound using a sterile 10 μL of micropipette tip. Then, cells were cultured in plates and imaged at 0 and 24 h. The wound closure rate was calculated according to the formula: (Scratch area of 0 h – Scratch area of N h)/(Scratch area of 0 h) × 100% in the previous study [38].

Transwell assay

For Transwell invasion assay, 24-well Transwell chambers (8 μm pore size, BD Biosciences, Shanghai, China) were used. Cells (3 × 105) were suspended in serum-free medium in the upper chamber coated with Matrigel (Millipore, Bedford, MA, USA). The lower chamber was supplemented with 700 μL of DMEM and 10% fetal bovine serum. After 24 h of incubation, cells were fixed with 4% paraformaldehyde and stained with 1% crystal violet. An inverted microscope (Nikon, Tokyo, Japan) was utilized to count the invaded cells. The assay was performed according to the previous study [38].

Western blot analysis

Total protein was extracted from cells using RIPA lysis buffer (Thermo Fisher) according to the manufacturer’s recommendations, and protein concentration was examined by a bicinchoninic acid Assay Kit (Thermo Fisher). Each protein sample (15 μg) was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to polyvinylidene fluoride membranes (Millipore). Next the membranes were blocked with 5% fat-free milk for 1 h at room temperature and then were incubated with primary antibodies at 4°C overnight. Then, the membranes were incubated with HRP-conjugated IgG secondary antibody (ab97051; 1:20,000) for 1 h at room temperature, followed by three times washing using Tris-buffered saline with 0.1% Tween-20 (10 min each). Finally, specific bands were visualized using the PierceTM electrochemiluminescence Western Blotting Substrate Kit (Thermo Fisher) and analyzed by ImageJ software (National Institutes of Health, Bethesda, MA, USA). Primary antibodies were anti-E-cadherin (ab133597; 1:2,000; abcam, Cambridge, MA, USA); anti-N-cadherin (ab76011; 1:10,000; abcam), anti-PLCXD2 (PA5-76231; 1:1,000; Thermo Fisher), and anti-GAPDH (ab8245; 1:2,000; abcam). GAPDH was regarded as a loading control. Western blot analysis was performed based on the previous study [37,39].

RNA pulldown assay

The biotinylated miR-378a-3p Wt/Mut (bio-miR-378a-3p Wt/Mut) and the negative control (bio-NC) were purchased from GenePharma (Shanghai, China) and were transfected into SGC7901 and AGS cells. After 24 h of transfection, the cells were lysed and collected. After incubation with Streptavidin agarose beads (Invitrogen) for 10 min, RT-qPCR was applied to determine the enrichment of ACTA2-AS1. The assay was performed according to previous studies [40].

Luciferase reporter assay

The binding site between ACTA2-AS1 and miR-378a-3p was searched at the starBase, and that between miR-378a-3p and PLCXD2 was searched from miRDB website. Wild type (Wt) or mutant (Mut) sequence of miR-378a-3p was subcloned into pmirGLO vectors (Promega, Madison, WI, USA) to construct miR-378a-3p-Wt or miR-378a-3p-Mut reporters. Similarly, the Wt or Mut sequence of PLCXD2 3′-untranslated region (3′-UTR) was subcloned into pmirGLO vectors to establish PLCXD2-Wt/Mut. A Phusion Site-Directed Mutagenesis Kit (Thermo Fisher Scientific) was used to mutate the predicted binding site. miR-378a-3p-Wt/Mut was cotransfected with sh-ACTA2-AS1#1 or sh-NC into SGC7901 and AGS cells, while PLCXD2-Wt/Mut was cotransfected with miR-378a-3p inhibitor, sh-ACTA2-AS1#1, or NC inhibitor into GC cells using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols. After 48 h of transfection, luciferase activities were determined using the Dual-Luciferase Kit (Promega) [36].

RNA immunoprecipitation (RIP) assay

RIP assay was performed using the Magna RIPTM RNA kit (Millipore) according to the previous study [41]. Cells were lysed in lysis buffer containing protease inhibitor cocktail and RNase inhibitor. Cells were incubated with RIP buffer containing magnetic beads coated with Ago2 antibody for 2 h at 4°C (Millipore). The antibody IgG was used as a negative control. After incubation, the coprecipitated RNA was eluted from beads and subjected to RT-qPCR analysis.

Xenograft mouse model and in vivo experiments

Ten BALB/c male mice (4 weeks old) were purchased from Vital River (Beijing, China). Mice were divided into two groups (pcDNA3.1 group and pcDNA3.1/ACTA2-AS1 group) at random (n = 5/group). These mice were anesthetized with pentobarbital sodium (25 mg/kg; intraperitoneal injection). pcDNA3.1 or pcDNA3.1/ACTA2-AS1 was stably transfected into SGC7901 cells. Then, mice were subcutaneously injected with SGC7901 cells at a density of 1 × 106 cells. Tumor volume was calculated every 5 days according to the formula: (length × width2)/2. Thirty days after implantation, mice were euthanized by cervical dislocation and then tumors were harvested for analysis. In vivo experiments were conducted according to previous studies [42,43]. All experiments were approved by Animal Care Committee of Hefei First People’s Group Hospital (Anhui, China) (Approval number: 2021–003).

Statistical analysis

The SPSS 20.0 Software (Chicago, IL, USA) was utilized to analyze data [44]. Experimental data are shown as the mean value ± standard deviation. Each experiment was repeated at least three times. Student’s t test was used to evaluate difference between two groups. One-way analysis of variance and Tukey’s post hoc test were used to compare differences among multiple groups. The value of p < 0.05 was defined as statistically significant. Ethical statement: All animal experiments in the study were conducted based on the principal of Animal Care Committee of Hefei First People’s Group Hospital to minimize the suffering of these animals.

Results

ACTA2-AS1 is lowly expressed in GC cells and is mainly distributed in cytoplasm

According to bioinformatics analysis from GEPIA and the starBase, ACTA2-AS1 expression is downregulated in STAD tissues compared with that in normal tissues (Figure 1a). RT-qPCR was performed to detect the expression of ACTA2-AS1 in GC cell lines (SGC7901, AGS, and MKN-45) and human normal gastric epithelium cell line (GES-1). Compared with ACTA2-AS1 expression in the control GES-1 cell line, ACTA2-AS1 was significantly downregulated in GC cell lines, especially in SGC7901 and AGS cells (Figure 1b). Therefore, SGC7901 and AGS cells were used for the following experiments. Subcellular fractionation assays and RT-qPCR suggested that ACTA2-AS1 was mainly distributed in the cytoplasm of GC cells (Figure 1c).
Figure 1

ACTA2-AS1 is lowly expressed in GC cells and is mainly distributed in cytoplasm. (a) ACTA2-AS1 expression in STAD tissues and normal tissues was analyzed by GEPIA and starBase websites. (b) ACTA2-AS1 expression in human gastric epithelial cell lines and GC cell lines was examined by RT-qPCR. (c) Subcellular fractionation assays and RT-qPCR were performed to determine the distribution of ACTA2-AS1 in GC cells. ***p < 0.001.

ACTA2-AS1 is lowly expressed in GC cells and is mainly distributed in cytoplasm. (a) ACTA2-AS1 expression in STAD tissues and normal tissues was analyzed by GEPIA and starBase websites. (b) ACTA2-AS1 expression in human gastric epithelial cell lines and GC cell lines was examined by RT-qPCR. (c) Subcellular fractionation assays and RT-qPCR were performed to determine the distribution of ACTA2-AS1 in GC cells. ***p < 0.001.

ACTA2-AS1 overexpression inhibits GC cell proliferation, migration, invasion, and EMT process

After the transfection of pcDNA3.1/ACTA2-AS1 into SGC7901 and AGS cells, ACTA2-AS1 expression was successfully increased (Figure 2a). Next the effects of overexpressed ACTA2-AS1 on GC cell viability, proliferation, migration, invasion, and EMT process were explored. CCK-8 assays showed that ACTA2-AS1 overexpression significantly decreased the viability of GC cells (Figure 2b). Consistently, the number of cell colonies was decreased due to ACTA2-AS1 overexpression, suggesting that ACTA2-AS1 suppressed GC cell proliferation (Figure 2c). As shown by wound healing assays, the wound closure rate was greatly decreased compared with the control group, implying that ACTA2-AS1 overexpression reduced the migratory capacity of GC cells (Figure 2d and e). The number of invaded cells was reduced due to pcDNA3.1/ACTA2-AS1 transfection as shown by Transwell assays (Figure 2f and g). Western blot analyses were performed to examine protein levels of EMT markers (E-cadherin and N-cadherin) in GC cells. ACTA2-AS1 overexpression upregulated E-cadherin protein level and downregulated N-cadherin level, indicating that ACTA2-AS1 overexpression inhibited the EMT process (Figure 2h).
Figure 2

ACTA2-AS1 overexpression inhibits GC cell proliferation, migration, invasion, and EMT process. (a) The overexpression efficiency of pcDNA3.1/ACTA2-AS1 in SGC7901 and AGS cells was detected by RT-qPCR. (b) CCK-8 assays were performed to examine the effect of ACTA2-AS1 overexpression on GC cell viability. (c) Colony formation assay was applied to detect the proliferative capacity of GC cells after transfection of pcDNA3.1 or pcDNA3.1/ACTA2-AS1. (d–g) Cell migration and invasion were, respectively, determined by wound healing assays and Transwell assays. (h) Protein levels of EMT markers were examined by Western blot analyses. **p < 0.01 and ***p < 0.001.

ACTA2-AS1 overexpression inhibits GC cell proliferation, migration, invasion, and EMT process. (a) The overexpression efficiency of pcDNA3.1/ACTA2-AS1 in SGC7901 and AGS cells was detected by RT-qPCR. (b) CCK-8 assays were performed to examine the effect of ACTA2-AS1 overexpression on GC cell viability. (c) Colony formation assay was applied to detect the proliferative capacity of GC cells after transfection of pcDNA3.1 or pcDNA3.1/ACTA2-AS1. (d–g) Cell migration and invasion were, respectively, determined by wound healing assays and Transwell assays. (h) Protein levels of EMT markers were examined by Western blot analyses. **p < 0.01 and ***p < 0.001.

ACTA2-AS1 interacts with miR-378a-3p in GC cells

RT-qPCR was performed to examine the knockdown efficiency of sh-ACTA2-AS1#1/2 in SGC7901 and AGS cells, and sh-ACTA2-AS1#1 was identified for subsequent experiments due to its better knockdown efficiency (Figure 3a). Three candidate miRNAs (miR-378c, miR-378a-3p, and miR-378d) that have binding site with ACTA2-AS1 were predicted with the starBase. Next the expression levels of these candidate miRNAs in GC cells transfected with sh-ACTA2-AS1#1 or sh-NC were detected by RT-qPCR. Compared with the expression of miR-378c and miR-378d in sh-ACTA2-AS1#1 group, miR-378a-3p expression was markedly increased due to ACTA2-AS1 knockdown (Figure 3b). Thus, miR-378a-3p was selected for further study. RT-qPCR revealed that miR-378a-3p expression was upregulated in GC cells compared with that in the control GES-1 cells (Figure 3c). Subsequently, the binding ability between ACTA2-AS1 and miR-378a-3p was explored by RNA pulldown assays and luciferase reporter assays. RNA pulldown assays showed that ACTA2-AS1 was abundantly enriched in the bio-miR-378a-3p Wt group, while no significant changes in enrichment were examined in the bio-miR-378a-3p Mut group (Figure 3d). The possible binding site between ACTA2-AS1 and miR-378a-3p was predicted using the starBase website, and the sequence of miR-378a-3p was mutated (Figure 3e). Luciferase reporter assays revealed that the luciferase activity of miR-378a-3p-Wt was significantly elevated in GC cells transfected with sh-ACTA2-AS1#1, and that of miR-378a-3p-Mut reporters was not significantly affected by ACTA2-AS1 knockdown (Figure 3f).
Figure 3

ACTA2-AS1 interacts with miR-378a-3p in GC cells. (a) Knockdown efficiency of sh-ACTA2-AS1#1/2 was detected by RT-qPCR, and sh-ACTA2-AS1#1 was used for the following experiments due to its better knockdown efficiency. (b) RT-qPCR was utilized to examine the expression of candidate miRNAs in GC cells transfected with sh-ACTA2-AS1#1 or sh-NC. (c) The expression of miR-378a-3p in GC cells and normal gastric epithelial cells was detected by RT-qPCR. (d) RNA pulldown assays were performed to determine the interaction between ACTA2-AS1 and miR-378a-3p in cells. (e) The possible binding site between ACTA2-AS1 and miR-378a-3p was predicted from the starBase website. (f) The binding capacity between ACTA2-AS1 and miR-378a-3p was further tested by luciferase reporter assays. ***p < 0.001.

ACTA2-AS1 interacts with miR-378a-3p in GC cells. (a) Knockdown efficiency of sh-ACTA2-AS1#1/2 was detected by RT-qPCR, and sh-ACTA2-AS1#1 was used for the following experiments due to its better knockdown efficiency. (b) RT-qPCR was utilized to examine the expression of candidate miRNAs in GC cells transfected with sh-ACTA2-AS1#1 or sh-NC. (c) The expression of miR-378a-3p in GC cells and normal gastric epithelial cells was detected by RT-qPCR. (d) RNA pulldown assays were performed to determine the interaction between ACTA2-AS1 and miR-378a-3p in cells. (e) The possible binding site between ACTA2-AS1 and miR-378a-3p was predicted from the starBase website. (f) The binding capacity between ACTA2-AS1 and miR-378a-3p was further tested by luciferase reporter assays. ***p < 0.001.

ACTA2-AS1 upregulates PLCXD2 expression by binding with miR-378a-3p

RT-qPCR revealed that miR-378a-3p expression was successfully silenced by miR-378a-3p inhibitor in SGC7901 and AGS cells (Figure 4a). Downstream target genes of miR-378a-3p were predicted using miRDB. Among the target genes (PLCXD2, NR2C2, KIAA1522, PHC3, ZNF124, ELAC1, KCNIP2, VPS53, and JADE3), only PLCXD2 exhibited high expression in GC cells with transfection of miR-378a-3p inhibitor (Figure 4b). Thus, PLCXD2 was identified for the following experiments. The analysis from GEPIA website revealed that PLCXD2 expression was downregulated in STAD tissues (n = 408) compared with that in normal tissues (n = 211) (Figure 4c). As suggested by subcellular fractionation assays and RT-qPCR, PLCXD2 was primarily localized in cytoplasm of SGC7901 and AGS cells (Figure 4d). RT-qPCR and Western blot analyses indicated that both mRNA and protein levels of PLCXD2 were upregulated by ACTA2-AS1 overexpression (Figure 4e). Additionally, PLCXD2 protein level was increased due to miR-378a-3p inhibition, as quantified by Western blot (Figure 4f). Afterwards, the relationship among ACTA2-AS1, miR-378a-3p, and PLCXD2 was explored by luciferase reporter assays and RIP assays. The potential binding site between miR-378a-3p and PLCXD2 was predicted from the miRDB website, and the mutant sequence of PLCXD2 was provided (Figure 4g). The luciferase activity of PLCXD2-Wt was significantly increased by miR-378a-3p inhibition and the increase was offset by ACTA2-AS1 depletion in GC cells according to luciferase reporter assays (Figure 4h). RIP assays showed that ACTA2-AS1, miR-378a-3p, and PLCXD2 were all significantly enriched in the anti-Ago2 group, indicating the coexistence of ACTA2-AS1, miR-378a-3p, and PLCXD2 in RNA-induced silence complexes (Figure 4i and j).
Figure 4

ACTA2-AS1 upregulates PLCXD2 expression by binding with miR-378a-3p. (a) Knockdown efficiency of miR-378a-3p inhibitor in SGC7901 and AGS cells was examined using RT-qPCR. (b) Nine mRNAs containing binding site with miR-378a-3p were predicted with miRDB. RT-qPCR was employed to detect the effect of miR-378a-3p inhibition on the expression of these candidate mRNAs. (c) The expression of PLCXD2 in STAD tissues (n = 408) and normal tissues (n = 211) was analyzed by GEPIA. (d) Subcellular fractionation assays were performed to detect the primary localization of PLCXD2. (e) The impacts of ACTA2-AS1 overexpression on mRNA and protein levels of PLCXD2 were measured by RT-qPCR and Western blot. (f) Western blot was conducted to detect protein level of PLCXD2 in GC cells transfected with miR-378a-3p inhibitor or NC inhibitor. (g) The binding site between miR-378a-3p and PLCXD2 was predicted from miRDB website. (h–j) Luciferase reporter assays and RIP assays were applied to explore the relationship among ACTA2-AS1, miR-378a-3p, and PLCXD2. ***p < 0.001.

ACTA2-AS1 upregulates PLCXD2 expression by binding with miR-378a-3p. (a) Knockdown efficiency of miR-378a-3p inhibitor in SGC7901 and AGS cells was examined using RT-qPCR. (b) Nine mRNAs containing binding site with miR-378a-3p were predicted with miRDB. RT-qPCR was employed to detect the effect of miR-378a-3p inhibition on the expression of these candidate mRNAs. (c) The expression of PLCXD2 in STAD tissues (n = 408) and normal tissues (n = 211) was analyzed by GEPIA. (d) Subcellular fractionation assays were performed to detect the primary localization of PLCXD2. (e) The impacts of ACTA2-AS1 overexpression on mRNA and protein levels of PLCXD2 were measured by RT-qPCR and Western blot. (f) Western blot was conducted to detect protein level of PLCXD2 in GC cells transfected with miR-378a-3p inhibitor or NC inhibitor. (g) The binding site between miR-378a-3p and PLCXD2 was predicted from miRDB website. (h–j) Luciferase reporter assays and RIP assays were applied to explore the relationship among ACTA2-AS1, miR-378a-3p, and PLCXD2. ***p < 0.001.

PLCXD2 knockdown reverses the inhibitory effect of ACTA2-AS1 overexpression on GC cellular behaviors

PLCXD2 expression was markedly reduced in SGC7901 and AGS cells with transfection of sh-PLCXD2#1/2 (Figure 5a). We identified sh-PLXCD2#1 for the following experiments due to its better knockdown efficiency. CCK-8 and colony formation assays elucidated that PLCXD2 knockdown countervailed the inhibitory effect of ACTA2-AS1 overexpression on GC cell viability and proliferation (Figure 5b and c). As shown by wound healing assays and Transwell assays, cell migration and invasion were inhibited by overexpressed ACTA2-AS1 and the inhibitory effect was partially reversed by PLCXD2 depletion (Figure 5d and g). Moreover, the increase in E-cadherin protein level and the decrease in N-cadherin level induced by ACTA2-AS1 overexpression were partially reversed by PLCXD2 deficiency (Figure 5h).
Figure 5

PLCXD2 knockdown reverses the inhibitory effect of ACTA2-AS1 overexpression on GC cellular behaviors. (a) The knockdown efficiency of sh-PLCXD2#1/2 in GC cells was examined by RT-qPCR, and sh-PLCXD2#1 was selected for the following rescue assays. (b and c) CCK-8 assays and colony formation assays were conducted to detect the viability and proliferation of GC cells transfected with pcDNA3.1/ACTA2-AS1 or cotransfected with pcDNA3.1/ACTA2-AS1 and sh-PLCXD2#1. (d–g) Wound healing assays and Transwell assays were utilized to detect the migration and invasion of GC cells with the above transfection. (h) Protein levels of EMT markers (E-cadherin and N-cadherin) in GC cells were determined by Western blot analyses. *p < 0.05, **p < 0.01, and ***p < 0.001.

PLCXD2 knockdown reverses the inhibitory effect of ACTA2-AS1 overexpression on GC cellular behaviors. (a) The knockdown efficiency of sh-PLCXD2#1/2 in GC cells was examined by RT-qPCR, and sh-PLCXD2#1 was selected for the following rescue assays. (b and c) CCK-8 assays and colony formation assays were conducted to detect the viability and proliferation of GC cells transfected with pcDNA3.1/ACTA2-AS1 or cotransfected with pcDNA3.1/ACTA2-AS1 and sh-PLCXD2#1. (d–g) Wound healing assays and Transwell assays were utilized to detect the migration and invasion of GC cells with the above transfection. (h) Protein levels of EMT markers (E-cadherin and N-cadherin) in GC cells were determined by Western blot analyses. *p < 0.05, **p < 0.01, and ***p < 0.001.

ACTA2-AS1 inhibits xenograft tumor growth in vivo

After the establishment of xenograft mice model, tumor volume was calculated every 5 days. The results revealed that ACTA2-AS1 overexpression decreased tumor volume (Figure 6a). Tumors were weighed after mice were euthanized. We found that tumor weight in pcDNA3.1/ACTA2-AS1 group was decreased compared with that in the control group (Figure 6b). RT-qPCR was performed to examine the expression of ACTA2-AS1, miR-378a-3p, and PLCXD2 in tumor tissues. We found that ACTA2-AS1 and PLCXD2 expression levels were upregulated, while miR-378a-3p was downregulated in the pcDNA3.1/ACTA2-AS1 group (Figure 6c). The results were consistent with those of in vitro assays. Western blot analysis was conducted to quantify protein levels of EMT markers in tumor cells. E-cadherin protein level was increased and N-cadherin protein level was markedly reduced due to ACTA2-AS1 overexpression (Figure 6d). The results suggested that overexpressed ACTA2-AS1 inhibits the EMT process, which were consistent with the results of in vitro experiments.
Figure 6

ACTA2-AS1 inhibits xenograft tumor growth in vivo. (a) After implantation of transfected cells, tumor volume was measured every 5 days. (b) After the mice were euthanized 30 days after implantation, tumors were weighed. (c) RT-qPCR was conducted to examine expression levels of ACTA2-AS1, miR-378a-3p, and PLCXD2 in tumor tissues. (d) Protein levels of EMT markers (E-cadherin and N-cadherin) in tumor cells were detected by Western blot analyses. *p < 0.05 and **p < 0.01.

ACTA2-AS1 inhibits xenograft tumor growth in vivo. (a) After implantation of transfected cells, tumor volume was measured every 5 days. (b) After the mice were euthanized 30 days after implantation, tumors were weighed. (c) RT-qPCR was conducted to examine expression levels of ACTA2-AS1, miR-378a-3p, and PLCXD2 in tumor tissues. (d) Protein levels of EMT markers (E-cadherin and N-cadherin) in tumor cells were detected by Western blot analyses. *p < 0.05 and **p < 0.01.

Discussion

GC is one of the leading causes of cancer death worldwide [45]. lncRNAs are key regulators involved in biological processes, such as cancer cell proliferation, metastasis, EMT, and stemness [46,47,48]. We herein explored the role of ACTA2-AS1 in GC development. Previously, ACTA2-AS1 has been demonstrated to be implicated in the development of liver, lung, cervical, ovarian, breast, and colon cancers [15,16,17,18,23,49]. For example, ACTA2-AS1 inhibits the progression of colon adenocarcinoma by acting as a ceRNA and targeting miR-4428/BCL2L11 axis [23]. However, ACTA2-AS1 functions as a tumor promoter in ovarian cancer [16]. In our study, ACTA2-AS1 expression was significantly downregulated in GC cells. ACTA2-AS1 overexpression suppressed malignant behaviors of GC cells, including cell viability, proliferation, migration, invasion, and EMT process. Additionally, ACTA2-AS1 overexpression inhibited xenograft tumor growth in vivo. Moreover, ACTA2-AS1 was primarily localized in the cytoplasm of GC cells, suggesting that ACTA2-AS1 functions post-transcriptionally. Mechanistically, lncRNAs can serve as ceRNAs against miRNAs and upregulate the expression of their target genes at the post-transcriptional level [20,50]. We hypothesized that ACTA2-AS1 might function as a ceRNA to suppress cellular behaviors in GC. To verify the ceRNA hypothesis of ACTA2-AS1, we explored downstream miRNAs of ACTA2-AS1 in GC. miRNAs are short noncoding RNA molecules including 21–25 nucleotides [51]. MiRNAs can suppress the expression of target genes by binding with 3′-UTR of mRNAs to accelerate mRNA degradation or inhibit mRNA translation [52]. As ceRNAs, lncRNAs upregulate the expression of mRNAs by binding with miRNAs [50]. The post-transcriptional regulation of miRNAs in cancer has been widely reported [53,54,55]. In the current study, ACTA2-AS1 is bound with miR-378a-3p in GC. Previously, miR-378a-3p was reported to promote ovarian cancer progression by targeting protein disulfide-isomerase A4 (PDIA4) [56]. lncRNA ACTA2 antisense RNA 1 (ZXF1) suppresses the progression of endometrial carcinoma by interacting with miR-378a-3p to upregulate the expression of protocadherin alpha-3 [57]. We herein found that miR-378a-3p was highly expressed in GC cells. ACTA2-AS1 directly interacted with miR-378a-3p, and miR-378a-3p expression was negatively correlated with ACTA2-AS1 expression in GC cells. Moreover, mRNA PLCXD2 was validated as a target gene of miR-378a-3p in GC. PLCXD2 was reported to be correlated with altered risk of esophageal squamous cell carcinoma in Han Chinese population [58]. In the current exploration, PLCXD2 expression is relatively low in GC cells. miR-378a-3p binds with PLCXD2 3′-UTR and inhibits mRNA and protein levels of PLCXD2. ACTA2-AS1 upregulates PLCXD2 expression and protein levels by binding with miR-378a-3p. Moreover, rescue assays elucidated that PLCXD2 knockdown partially rescued the suppressive effect of ACTA2-AS1 overexpression on malignant characters of GC cells, suggesting that ACTA2-AS1 inhibits malignant phenotypes of GC cells by upregulating PLCXD2. In conclusion, ACTA2-AS1 inhibits GC cell viability, proliferation, migration, invasion, and EMT process and suppresses xenograft tumor growth by binding with miR-378a-3p to upregulate PLCXD2. The study might provide promising insight into the role of ACTA2-AS1 in GC development. More experiments will be carried out in the future to explore other potential molecules involved in the network mediated by ACTA2-AS1.
  58 in total

1.  CeNETs analysis reveals the prognostic value of a signature integration from five lncRNAs in breast cancer.

Authors:  Ke Wang; Caihua Liao; Qiong Zhong; Haiyan Dong; Tiancheng Zhang; Rongzhong Jin
Journal:  J Cell Biochem       Date:  2019-03-30       Impact factor: 4.429

2.  A novel 4D cell culture mimicking stomach peristalsis altered gastric cancer spheroids growth and malignance.

Authors:  Juzhi Zhao; Ruiqi Wang; Jinyu Zhang; Yufang Zhao; Shupei Qiao; Thomas Crouzier; Hongji Yan; Weiming Tian
Journal:  Biofabrication       Date:  2021-04-26       Impact factor: 9.954

Review 3.  Membrane-lipid associated lncRNA: A new regulator in cancer signaling.

Authors:  Yanxiu Ma; Junmei Zhang; Lixia Wen; Aifu Lin
Journal:  Cancer Lett       Date:  2018-01-09       Impact factor: 8.679

4.  A large shRNA library approach identifies lncRNA Ntep as an essential regulator of cell proliferation.

Authors:  Julia Beermann; Dominique Kirste; Katharina Iwanov; Dongchao Lu; Felix Kleemiß; Regalla Kumarswamy; Katharina Schimmel; Christian Bär; Thomas Thum
Journal:  Cell Death Differ       Date:  2017-11-03       Impact factor: 15.828

5.  Molecular heterogeneity in the novel fusion gene APIP-FGFR2: Diversity of genomic breakpoints in gastric cancer with high-level amplifications at 11p13 and 10q26.

Authors:  Takashi Okuda; Tomohiko Taki; Kazuhiro Nishida; Yoshiaki Chinen; Hisao Nagoshi; Chouhei Sakakura; Masafumi Taniwaki
Journal:  Oncol Lett       Date:  2016-11-15       Impact factor: 2.967

6.  GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses.

Authors:  Zefang Tang; Chenwei Li; Boxi Kang; Ge Gao; Cheng Li; Zemin Zhang
Journal:  Nucleic Acids Res       Date:  2017-07-03       Impact factor: 16.971

Review 7.  LncRNA DDX11-AS1: a novel oncogene in human cancer.

Authors:  Yubin Feng; Maomao Wu; Shuang Hu; Xiaoqing Peng; Feihu Chen
Journal:  Hum Cell       Date:  2020-08-09       Impact factor: 4.174

8.  Non-parametric tests on SPSS to compare two or more means on matched samples.

Authors:  A Bezzaouha; A Bouamra; A Ammimer; A Ben Abdelaziz
Journal:  Tunis Med       Date:  2020-12

9.  METTL14 promotes tumorigenesis by regulating lncRNA OIP5-AS1/miR-98/ADAMTS8 signaling in papillary thyroid cancer.

Authors:  Xiaoping Zhang; Dan Li; Chengyou Jia; Haidong Cai; Zhongwei Lv; Bo Wu
Journal:  Cell Death Dis       Date:  2021-06-15       Impact factor: 8.469

Review 10.  Long non-coding RNAs in gastric cancer: New emerging biological functions and therapeutic implications.

Authors:  Huidan Tan; Shouyue Zhang; Jin Zhang; Lingjuan Zhu; Yanmei Chen; Hongmei Yang; Yi Chen; Yang An; Bo Liu
Journal:  Theranostics       Date:  2020-07-11       Impact factor: 11.556

View more
  2 in total

1.  lncRNA ACTA2-AS1 predicts malignancy and poor prognosis of triple-negative breast cancer and regulates tumor progression via modulating miR-532-5p.

Authors:  Yi Peng; Xiaoxi Huang; Hongmei Wang
Journal:  BMC Mol Cell Biol       Date:  2022-07-27

2.  Identification of the KCNQ1OT1/ miR-378a-3p/ RBMS1 Axis as a Novel Prognostic Biomarker Associated With Immune Cell Infiltration in Gastric Cancer.

Authors:  Ting Yue; Jingjing Li; Manguang Liang; Jiaman Yang; Zhiwen Ou; Shuchen Wang; Wuhua Ma; Dehui Fan
Journal:  Front Genet       Date:  2022-07-14       Impact factor: 4.772

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.