Hasmik Jasmine Samvelyan1,2,3, Carmen Huesa4, Lin Cui5, Colin Farquharson5, Katherine Ann Staines1,2. 1. School of Pharmacy and Biomolecular Sciences, University of Brighton, Brighton, UK. 2. Centre for Stress and Age-Related Disease, University of Brighton, Brighton, UK. 3. The Faculty of Health, Education, Medicine and Social Care, School of Medicine, Anglia Ruskin University, Chelmsford, UK. 4. Institute of Infection, Immunity & Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow, UK. 5. The Roslin Institute, The University of Edinburgh, Edinburgh, UK.
Abstract
AIMS: Osteoarthritis (OA) is the most prevalent systemic musculoskeletal disorder, characterized by articular cartilage degeneration and subchondral bone (SCB) sclerosis. Here, we sought to examine the contribution of accelerated growth to OA development using a murine model of excessive longitudinal growth. Suppressor of cytokine signalling 2 (SOCS2) is a negative regulator of growth hormone (GH) signalling, thus mice deficient in SOCS2 (Socs2 -/-) display accelerated bone growth. METHODS: We examined vulnerability of Socs2 -/- mice to OA following surgical induction of disease (destabilization of the medial meniscus (DMM)), and with ageing, by histology and micro-CT. RESULTS: We observed a significant increase in mean number (wild-type (WT) DMM: 532 (SD 56); WT sham: 495 (SD 45); knockout (KO) DMM: 169 (SD 49); KO sham: 187 (SD 56); p < 0.001) and density (WT DMM: 2.2 (SD 0.9); WT sham: 1.2 (SD 0.5); KO DMM: 13.0 (SD 0.5); KO sham: 14.4 (SD 0.7)) of growth plate bridges in Socs2 -/- in comparison with WT. Histological examination of WT and Socs2 -/- knees revealed articular cartilage damage with DMM in comparison to sham. Articular cartilage lesion severity scores (mean and maximum) were similar in WT and Socs2 -/- mice with either DMM, or with ageing. Micro-CT analysis revealed significant decreases in SCB thickness, epiphyseal trabecular number, and thickness in the medial compartment of Socs2 -/-, in comparison with WT (p < 0.001). DMM had no effect on the SCB thickness in comparison with sham in either genotype. CONCLUSION: Together, these data suggest that enhanced GH signalling through SOCS2 deletion accelerates growth plate fusion, however this has no effect on OA vulnerability in this model. Cite this article: Bone Joint Res 2022;11(3):162-170.
AIMS: Osteoarthritis (OA) is the most prevalent systemic musculoskeletal disorder, characterized by articular cartilage degeneration and subchondral bone (SCB) sclerosis. Here, we sought to examine the contribution of accelerated growth to OA development using a murine model of excessive longitudinal growth. Suppressor of cytokine signalling 2 (SOCS2) is a negative regulator of growth hormone (GH) signalling, thus mice deficient in SOCS2 (Socs2 -/-) display accelerated bone growth. METHODS: We examined vulnerability of Socs2 -/- mice to OA following surgical induction of disease (destabilization of the medial meniscus (DMM)), and with ageing, by histology and micro-CT. RESULTS: We observed a significant increase in mean number (wild-type (WT) DMM: 532 (SD 56); WT sham: 495 (SD 45); knockout (KO) DMM: 169 (SD 49); KO sham: 187 (SD 56); p < 0.001) and density (WT DMM: 2.2 (SD 0.9); WT sham: 1.2 (SD 0.5); KO DMM: 13.0 (SD 0.5); KO sham: 14.4 (SD 0.7)) of growth plate bridges in Socs2 -/- in comparison with WT. Histological examination of WT and Socs2 -/- knees revealed articular cartilage damage with DMM in comparison to sham. Articular cartilage lesion severity scores (mean and maximum) were similar in WT and Socs2 -/- mice with either DMM, or with ageing. Micro-CT analysis revealed significant decreases in SCB thickness, epiphyseal trabecular number, and thickness in the medial compartment of Socs2 -/-, in comparison with WT (p < 0.001). DMM had no effect on the SCB thickness in comparison with sham in either genotype. CONCLUSION: Together, these data suggest that enhanced GH signalling through SOCS2 deletion accelerates growth plate fusion, however this has no effect on OA vulnerability in this model. Cite this article: Bone Joint Res 2022;11(3):162-170.
Entities:
Keywords:
Bone; Cartilage; Growth hormone; Growth plate; Osteoarthritis; Osteoarthritis (OA); SOCS2; Subchondral bone; articular cartilage damage; articular cartilage lesions; bone growth; cytokine; destabilization of the medial meniscus (DMM); growth plates; micro-CT scans; murine model
The reversion of chondrocyte behaviour to an earlier developmental-like phenotype in osteoarthritis (OA) has been defined, however the precise contribution of accelerated growth to OA development remains unclear.Here, we used a murine model of excessive longitudinal growth (suppressor of cytokine signalling 2 (SOCS2) deletion – a suppressor of growth hormone signalling) and examined their vulnerability to surgical and ageing-related OA development.We observed a significant increase in number and density of growth plate bridges in Socs2 knockout mice in comparison to wild-type (WT), thus indicating accelerated growth plate fusion in this model.Histological examination of Socs2 knockout and WT knee joints revealed similar articular cartilage lesion severity and osteophyte formation scores, and therefore no effect of accelerated growth in this model on articular cartilage damage.This study reported, for the first time, accelerated growth plate fusion in Socs2 knockout mice in which an excessive growth phenotype is observed.A limitation of this study is the complexity of the GH/insulin-like growth factor 1 (IGF-1) signalling pathway in OA, thus highlighting the need for a better understanding of its role in disease pathology.
Introduction
Osteoarthritis (OA) is the most prevalent systemic musculoskeletal disorder, characterized by degeneration of joint articular cartilage, osteophyte formation, subchondral bone plate thickening, synovial proliferation, and inflammation. OA has a multifactorial aetiology including ageing, trauma, obesity, and heredity. Further, a complex interplay of major molecules and signalling pathways play indispensable roles in OA development.
Despite this, effective disease-modifying treatments are currently limited.Endochondral ossification is an essential process for longitudinal bone growth. It requires hypertrophic differentiation of chondrocytes, characterized by secretion of type X collagen (COL10A1), matrix metalloproteinase-13 (MMP-13), and vascular endothelial growth factor (VEGF), followed by the subsequent degradation and conversion of the growth plate cartilage matrix into highly vascularized bone tissue.
With sexual maturation, the human growth plate undergoes progressive narrowing as bony bridges form and span its width, establishing continuity between the cancellous bone of the epiphysis and metaphysis.
These growth plate bridging events ultimately lead to complete growth plate closure and cessation of human growth.
OA is widely accepted to involve the reversion of chondrocyte behaviour to an earlier developmental-like phenotype, which could drive the disease process. Indeed, re-expression of the type IIA procollagen, a spliced variant of the type II collagen gene (COL2A1) normally expressed in chondroprogenitor cells, in adult osteoarthritic articular chondrocytes indicates reversion of these cells to early developmental-like phenotype.Consistent with this, Staines et al
have previously shown the abnormal deployment of a transient chondrocyte phenotype in the joints of a STR/ort mouse, a murine model for spontaneous OA.
Staines et al
further revealed accelerated long bone growth, a wider zone of growth plate proliferative chondrocytes, and widespread COL10A1 and MMP-13 expression beyond the expected hypertrophic zone distribution in these mice, which may underpin their OA onset. However, the precise contribution of accelerated growth to OA development remains unclear.Suppressor of cytokine signalling 2 (SOCS2), one of the members of the suppressor of cytokine signalling family glycoproteins, is implicated in cancer and disorders of immune system and central nervous system.
SOCS2 has been shown as a primary intracellular suppressor of the growth hormone (GH) signalling pathway, thus mice deficient in SOCS2 (Socs2
-/-) display an excessive growth phenotype.
Here, we use this mouse model of accelerated bone growth to understand the association between aberrant growth dynamics and OA development. To achieve this, we examined the vulnerability of Socs2
-/- mice to OA following surgical induction of disease (destabilization of the medial meniscus (DMM)), and with ageing, by histology and micro CT.
Methods
Animals
Socs2 mice on a C57/BL6 genetic background were generated as previously described.
For genotyping, tail-biopsied DNA was analyzed by polymerase chain reaction (PCR) for Socs2 wild-type (WT) (Forward: TGTTTGACTGAGCTCGCGC, Reverse: CAACTTTAGTGTCTTGGATCT) or the neocassette (Socs2 ; Forward: ACCCTGCACACTCTCGTTTTG, Reverse: CCTCGACTAAACACATGTAAAGC). Mice were kept in polypropylene cages, with light/dark 12-hour cycles, at 21°C (± 2°C), and fed ad libitum with maintenance diet (Special Diet Services, UK). Ageing studies were completed in 12- to 13-month-old Socs2 (n = 6) and C57/BL6 WT (n = 6) male mice (Charles River, UK). Analyses were conducted blindly to minimize the effects of subjective bias. All experimental protocols were approved by the local ethics committee, and the animals were maintained in accordance with UK Home Office guidelines for the care and use of laboratory animals. Animal studies were conducted in line with the ARRIVE guidelines.
Destabilization of the medial meniscus
Eight-week-old Socs2 and C57/BL6 WT male mice (Charles River) were randomally allocated into 1) surgically induced DMM under isoflurane-induced anaesthesia (n = 6/genotype) or 2) sham operated (n = 6/genotype) groups. Following transection of the medial meniscotibial ligament to destabilize the medial meniscus, the left knee joint capsule and skin were closed and anaesthesia reversed. Sham‐operated joints were used as controls. After eight weeks, knee joints were dissected, fixed in 4% paraformaldehyde for 24 hours at 4°C, and then stored in 70% ethanol.
Micro-CT analysis
Scans of the right knee joint were performed with an 1172 X-Ray microtomograph (SkyScan, Belgium) to evaluate the subchondral bone. High-resolution scans with voxel size of 5 µm were acquired (50 kV, 200µA, 0.5 mm aluminium filter, 0.6° rotation angle). The projection images were reconstructed using NRecon software version 1.6.9.4 (SkyScan). Each dataset was rotated in DataViewer (SkyScan) to ensure similar orientation and alignment for analysis. Regions of interest (ROIs) were hand-drawn of the subchondral trabecular bone in the medial and lateral compartments of the femur and tibia. Subchondral bone ROIs were subsequently selected for each compartment. Analysis of subchondral bone plate thickness and the epiphyseal trabecular bone was achieved using 3D algorithms in CTAn (SkyScan) to provide: subchondral bone plate thickness (SCB Th., mm); subchondral bone plate bone volume/tissue volume (SCB BV/TV, %); epiphyseal trabecular bone volume/tissue volume (Tb. BV/TV, %); trabecular number (Tb. N., mm-1); trabecular thickness (Tb. Th., mm); and trabecular separation (Tb. Sp., mm).
Growth plate bridging analysis
Growth plate bridging analysis was conducted using a 3D micro-CT quantification method as previously described.
Briefly, micro-CT scans of the tibiae were segmented using a region-growing algorithm within the Avizo (V8.0, Thermo Fisher Scientific, USA) software. The central points of all bony bridges were identified (Supplementary Figure a) and projected on the tibial joint surface. The distribution of the areal number density of bridges (N, the number of bridges per 256 µm × 256 µm window) was then calculated and superimposed on the tibial joint surface (each bridge has a colour that represents the areal number density at the bridge location).
Histological analysis
Murine left knee joints were decalcified in 10% ethylenediaminetetraacetic acid (EDTA) for approximately four weeks at 4°C, wax-embedded and 6 μm coronal sections cut. For assessment of OA severity, multiple sections (> 5/slide) from 120 μm intervals across the whole joint were stained with Toluidine blue (0.4% in 0.1 M acetate buffer, pH 4). The total width of the growth plate, as well as the proliferating and hypertrophic zones, were measured at ten different points along the length of the growth plate based on established cell morphology.
This was conducted in 6 μm coronal sections from the middle region of the knee joint in a similar location of three individual animals per experimental group, using a light microscope and ImageJ (National Institutes of Health, USA) software. Articular cartilage damage was assessed in the medial tibia using the well-established Osteoarthritis Research Society International (OARSI) grading scale, with scores averaged.
Osteophytes were also scored where 0 = none; 1 = formation of cartilage-like tissue; 2 = increase in cartilaginous matrix; 3 = endochondral ossification.
Scoring was conducted blindly by two observers (HJS and KAS).
Statistical analysis
All analyses were performed with GraphPad Prism software 6.0 f version (GraphPad, USA). The results were presented as the mean and standard error of the mean (SEM). Normal distribution of data was assessed using the Shapiro-Wilk normality test. For the growth plate bridging and micro-CT analysis, one- or two-way analysis of variance (ANOVA) with Bonferroni adjustments for multiple comparisons were used, and independent-samples t-test was used for ageing studies. For articular cartilage damage, the Kruskal-Wallis one-way ANOVA was used for DMM studies, and the Mann-Whitney U test for ageing studies. The significance was set at p < 0.05.
In accordance with the known effects of increased GH signalling on the skeleton, we observed a significant increase in Socs2
-/- body weight in comparison to WT controls in ageing (Socs2-/- 51.9 g (SD 1.4); WT 32.0 g (SD 0.5); p = 0.000; independent-samples t-test), and throughout the eight-week DMM experiment (Table I; p < 0.001; independent-samples repeated measures t-test). We also observed widened growth plates in our Socs2
-/- mice, in comparison to WT in the DMM experiment, specifically in the proliferative zone of chondrocytes, as in accordance with previous studies at a younger age (Figures 1a and 1b).
However, no differences were observed in aged animals (Figures 1b and 1f).
Table I.
Weights of wild type and Socs2-/- (knockout) mice during eight-week post-destabilization of the medial meniscus experimental timeline.
Variable
Mean weight, g (SD)
Week
0
1
2
3
4
5
6
7
8
WT sham
23.2 (0.4)
22.2 (1.0)
24.0 (0.4)
25.6 (0.5)
26.4 (0.7)
27.0 (0.7)
27.6 (0.8)
28.2 (0.8)
29.0 (0.7)
WT DMM
22.4 (0.3)
21.8 (0.3)
23.0 (0.3)
24.0 (0.4)
24.5 (0.3)
24.9 (0.3)
25.6 (0.4)
25.7 (0.3)
26.5 (0.3)
KO sham
32.3 (1.2)
33.6 (0.9)
34.8 (1.1)
35.0 (1.0)
36.4 (1.1)
38.1 (1.3)
38.7 (0.9)
39.0 (0.9)
40.4 (0.9)
KO DMM
31.3 (0.8)
33.0 (0.7)
33.7 (0.7)
34.9 (1.0)
35.8 (1.0)
39.8 (0.6)
38.3 (1.1)
38.9 (1.1)
40.3 (1.0)
DMM, destabilization of the medial meniscus; KO, knockout; SD, standard deviation; WT, wild type.
Fig. 1
Socs2-deficient mice exhibit widened growth plates. Histological images of toluidine blue stained growth plates in a) wild type (WT) and Socs2-/- (knockout (KO)) destabilization of medial meniscus (DMM) and sham mice, and b) aged WT and KO mice (10×). Reduced staining in the KO growth plates suggests reduced proteoglycans in these animals. Quantification of c) proliferative zone, d) hypertrophic zone, and e) total growth plate width in WT and KO DMM and sham mice. f) Quantification of total growth plate width in aged WT and KO mice. Data are presented as mean and standard error of the mean. One-way analysis of variance was used for DMM/sham animals and an independent-samples t-test for aged animals. *p < 0.05 ***p < 0.001.
We next sought to examine growth plate fusion in these mice. We observed a significant increase in the number of growth plate bridges in Socs2
-/- mice in comparison to WT mice at both ages examined (Figure 2 and Supplementary Figure a). Specifically, we saw a significant increase in growth plate bridge number (Figure 2) (WT DMM: 532 (SD 56); WT sham: 495 (SD 45); knockout (KO) DMM: 169 (SD 49); KO sham: 187 (SD 56); p < 0.001, two-way ANOVA) and density (Figures 2a and 2c) (WT DMM: 2.2 (SD 0.9); WT sham: 1.2 (SD 0.5); KO DMM: 13.0 (SD 0.5); KO sham: 14.4 (SD 0.7); p < 0.001, two-way ANOVA) in Socs2
-/- sham and DMM tibiae (16 weeks of age), in comparison to WT sham and DMM tibiae . Further, we saw no significant differences between growth plate bridges in the medial and lateral condyles in WT animals, however in Socs2
-/- there is a significant reduction in growth plate bridge number and density in the lateral condyle, regardless of OA development (p < 0.001, two-way ANOVA (Figures 2b and 2c)). No differences in growth plate bridges were observed with OA development in either genotype. Concurrent with this, in aged mice (around one year), a significant increase in growth plate bridge number (Figures 2d and 2e) and density (Figures 2d and 2f) was observed in Socs2
-/- mice in comparison to WT mice (WT: 585 (SD 70); KO: 1,659 (SD 91); densities – WT: 8.6 (SD 2.2); KO: 21.3 (SD 1.4); p < 0.001, two-way ANOVA).
Fig. 2
Socs2-deficient mice exhibit accelerated growth plate fusion mechanisms. a) Location and areal densities of bridges across the growth plate projected on the medial (M) and lateral (L) tibial joint surface in wild type (WT) and Socs2-/- (knockout (KO)) destabilization of medial meniscus (DMM) and sham-operated joints. b) Number of growth plate (GP) bridges. c) Areal density of bridges defined as the number of bridges per 256 mm × 256 mm window. d) Location and areal densities of bridges across the growth plate projected on the medial (M) and lateral (L) tibial joint surface in aged WT and Socs2-/- (KO) mice. e) Number of GP bridges. f) Areal density (d) of bridges, defined as the number of bridges per 256 mm × 256 mm window. Data are presented as mean and standard error of the mean, and showing individual animals. Two-way analysis of variance with Bonferroni adjustments for multiple comparisons was used within each joint compartment. *p < 0.05; **p < 0.01; ***p < 0.001.
Weights of wild type and Socs2-/- (knockout) mice during eight-week post-destabilization of the medial meniscus experimental timeline.DMM, destabilization of the medial meniscus; KO, knockout; SD, standard deviation; WT, wild type.Socs2-deficient mice exhibit widened growth plates. Histological images of toluidine blue stained growth plates in a) wild type (WT) and Socs2-/- (knockout (KO)) destabilization of medial meniscus (DMM) and sham mice, and b) aged WT and KO mice (10×). Reduced staining in the KO growth plates suggests reduced proteoglycans in these animals. Quantification of c) proliferative zone, d) hypertrophic zone, and e) total growth plate width in WT and KO DMM and sham mice. f) Quantification of total growth plate width in aged WT and KO mice. Data are presented as mean and standard error of the mean. One-way analysis of variance was used for DMM/sham animals and an independent-samples t-test for aged animals. *p < 0.05 ***p < 0.001.Socs2-deficient mice exhibit accelerated growth plate fusion mechanisms. a) Location and areal densities of bridges across the growth plate projected on the medial (M) and lateral (L) tibial joint surface in wild type (WT) and Socs2-/- (knockout (KO)) destabilization of medial meniscus (DMM) and sham-operated joints. b) Number of growth plate (GP) bridges. c) Areal density of bridges defined as the number of bridges per 256 mm × 256 mm window. d) Location and areal densities of bridges across the growth plate projected on the medial (M) and lateral (L) tibial joint surface in aged WT and Socs2-/- (KO) mice. e) Number of GP bridges. f) Areal density (d) of bridges, defined as the number of bridges per 256 mm × 256 mm window. Data are presented as mean and standard error of the mean, and showing individual animals. Two-way analysis of variance with Bonferroni adjustments for multiple comparisons was used within each joint compartment. *p < 0.05; **p < 0.01; ***p < 0.001.
Socs2 deletion does not exacerbate the development of OA in a DMM model
Assessment of cartilage damage in the medial tibia of WT mice revealed an increased articular cartilage OARSI score with DMM in comparison to sham (p < 0.050, Kruskal-Wallis one-way ANOVA; Figures 3a, 3c, and 3d). However, no significant differences in the articular cartilage mean and maximum OARSI severity scores were observed between WT and Socs2
-/- mice in the medial tibia (no significant difference (Figures 3c and 3d)). Similar results were observed in the lateral tibia (data not shown). Similarly, while osteophytes were observed in both WT and Socs2
-/- DMM mice, there was no difference between genotypes (Figure 3b). Micro-CT analysis of the subchondral bone plate revealed a significantly thinner subchondral bone plate in the medial compartment of Socs2
-/- knee joints, in comparison to WT knee joints (Figure 4a; SCB Th. WT: 0.15 mm (SD 0.003); KO: 0.11 mm (SD 0.003); p < 0.001, two-way ANOVA). DMM had no effect on the subchondral bone plate thickness in comparison to sham in either WT or Socs2-/- knee joints (Figure 4a). Similarly, no differences were observed in the subchondral bone % BV/TV between genotypes or OA interventions (Figure 4b). Micro-CT analysis of the epiphyseal trabecular bone also revealed no effect of DMM on % BV/TV (Figure 3c), however we observed decrease in trabecular number (Figure 4d; Tb. N. WT: 12.3 mm-1 (SD 0.2); KO: 10.6 mm-1 (SD 0.2); p < 0.001, two-way ANOVA) and increase in trabecular thickness (Figure 4e; Tb. Th. WT: 0.06 mm (SD 0.001); KO: 0.07 mm (SD 0.002); p = 0.007, two-way ANOVA) in Socs2
-/- knee joints in comparison to WT knee joints. DMM had no effect on the epiphyseal bone parameters in comparison to sham, in either WT or Socs2
-/- knee joints (Figures 4c to 4f).
Fig. 3
Deletion of Socs2 does not prevent osteoarthritic articular cartilage lesions in a surgical model of osteoarthritis. a) Toluidine blue stained sections of the knee joint of wild type (WT) and Socs2-/- (knockout (KO)) mice showing development of articular cartilage lesions in the medial tibia (10×). b) Osteophyte severity score, c) mean articular cartilage damage Osteoarthritis Research Society International (OARSI) score,
and d) maximum articular cartilage damage OARSI score in WT sham (n = 3), WT destabilization of the medial meniscus (DMM) (n = 6), KO sham (n = 6), and KO DMM (n = 6). Scale bar = 0.05 mm. Data are presented as mean and standard error of the mean, showing individual animals; Kruskal-Wallis one-way analysis of variance was used.
Fig. 4
Socs2-deficient mice exhibit decreased subchondral bone plate and trabecular number, irrespective of destabilization of the medial meniscus (DMM) surgically induced osteoarthritis. Micro-CT analysis of the medial and lateral tibial a) subchondral bone plate (SCB) thickness (mm), b) SCB bone volume/tissue volume (BV/TV; %), c) epiphyseal trabecular BV/TV (%), d) epiphyseal trabecular number (mm-1), e) epiphyseal trabecular thickness (mm), and f) epiphyseal trabecular separation (mm) in wild type (WT) and Socs2-/- (knockout (KO)) mice with DMM or sham surgery (n = 6 per group). Data are presented as mean and standard error of the mean and show individual animal data. Two-way analysis of variance with Bonferroni adjustments was used for multiple comparisons. *p < 0.05; ***p < 0.001.
Deletion of Socs2 does not prevent osteoarthritic articular cartilage lesions in a surgical model of osteoarthritis. a) Toluidine blue stained sections of the knee joint of wild type (WT) and Socs2-/- (knockout (KO)) mice showing development of articular cartilage lesions in the medial tibia (10×). b) Osteophyte severity score, c) mean articular cartilage damage Osteoarthritis Research Society International (OARSI) score,
and d) maximum articular cartilage damage OARSI score in WT sham (n = 3), WT destabilization of the medial meniscus (DMM) (n = 6), KO sham (n = 6), and KO DMM (n = 6). Scale bar = 0.05 mm. Data are presented as mean and standard error of the mean, showing individual animals; Kruskal-Wallis one-way analysis of variance was used.Socs2-deficient mice exhibit decreased subchondral bone plate and trabecular number, irrespective of destabilization of the medial meniscus (DMM) surgically induced osteoarthritis. Micro-CT analysis of the medial and lateral tibial a) subchondral bone plate (SCB) thickness (mm), b) SCB bone volume/tissue volume (BV/TV; %), c) epiphyseal trabecular BV/TV (%), d) epiphyseal trabecular number (mm-1), e) epiphyseal trabecular thickness (mm), and f) epiphyseal trabecular separation (mm) in wild type (WT) and Socs2-/- (knockout (KO)) mice with DMM or sham surgery (n = 6 per group). Data are presented as mean and standard error of the mean and show individual animal data. Two-way analysis of variance with Bonferroni adjustments was used for multiple comparisons. *p < 0.05; ***p < 0.001.
Socs2 deletion has no effect on joint ageing
To examine the effects of Socs2 deletion in aged joints, histological examination revealed no differences in the articular cartilage lesion mean and maximum severity scores between aged WT and Socs2-/- mice in any of the joint compartments (Figures 5a to 5c). Similar to our previous analysis of DMM-treated WT and Socs2
-/- mice (Figure 4), micro-CT analysis of the subchondral bone revealed thinner subchondral bone plate in the medial compartment of Socs2
-/- knee joints, in comparison to WT knee joints (Figure 6a; SCB Th. WT: 0.2 mm (SD 0.005); KO: 0.1 mm (SD 0.004); p < 0.001, two-way ANOVA). No differences were observed in the subchondral bone % BV/TV between genotypes (Figure 6b), however the epiphyseal trabecular BV/TV was decreased in Socs2
-/- knee joints (Figure 6c; Tb. BV/TV WT: 73.5% (SD 1.5%); KO: 64.6% (SD 2.2%); p = 0.001, two-way ANOVA). No significant differences were observed in trabecular number (Figure 6d), trabecular thickness (Figure 6e), or trabecular separation (Figure 6f) between aged WT and Socs2-/- mice.
Fig. 5
Deletion of Socs2 does not prevent osteoarthritic articular cartilage lesions from ageing. a) Toluidine blue stained sections of the knee joint of 12- to 13-month-old WT and Socs2-/- (knockout (KO)) mice showing development of articular cartilage lesions in the medial tibia (10×). b) Mean articular cartilage damage Osteoarthritis Research Society International (OARSI) score across the knee joint and c) maximum articular cartilage damage OARSI score between wild type (WT) (n = 5) and KO (n = 6) mice with ageing, in the medial tibia of the knee joint. Scale bar = 0.05 mm. Data are presented as mean and standard error of the mean, and show individual animals; Mann-Whitney U test was used.
Fig. 6
Aged Socs2-deficient mice exhibit decreased subchondral bone plate thickness. Micro-CT analysis of the medial and lateral tibial a) subchondral bone plate (SCB) thickness (mm), b) SCB bone volume/tissue volume (BV/TV; %), c) epiphyseal trabecular BV/TV (%), d) epiphyseal trabecular number (mm-1), e) epiphyseal trabecular thickness (mm), and f) epiphyseal trabecular separation (mm) in aged wild type (WT) and Socs2-/- (knockout (KO)) mice (n = 6 per group). Data are presented as mean and standard error of the mean, and show individual animals. Two-way analysis of variance with Bonferroni adjustments for multiple comparisons was used. *p < 0.05; ***p < 0.001.
Deletion of Socs2 does not prevent osteoarthritic articular cartilage lesions from ageing. a) Toluidine blue stained sections of the knee joint of 12- to 13-month-old WT and Socs2-/- (knockout (KO)) mice showing development of articular cartilage lesions in the medial tibia (10×). b) Mean articular cartilage damage Osteoarthritis Research Society International (OARSI) score across the knee joint and c) maximum articular cartilage damage OARSI score between wild type (WT) (n = 5) and KO (n = 6) mice with ageing, in the medial tibia of the knee joint. Scale bar = 0.05 mm. Data are presented as mean and standard error of the mean, and show individual animals; Mann-Whitney U test was used.Aged Socs2-deficient mice exhibit decreased subchondral bone plate thickness. Micro-CT analysis of the medial and lateral tibial a) subchondral bone plate (SCB) thickness (mm), b) SCB bone volume/tissue volume (BV/TV; %), c) epiphyseal trabecular BV/TV (%), d) epiphyseal trabecular number (mm-1), e) epiphyseal trabecular thickness (mm), and f) epiphyseal trabecular separation (mm) in aged wild type (WT) and Socs2-/- (knockout (KO)) mice (n = 6 per group). Data are presented as mean and standard error of the mean, and show individual animals. Two-way analysis of variance with Bonferroni adjustments for multiple comparisons was used. *p < 0.05; ***p < 0.001.
Discussion
Here we sought to examine whether altered growth plate dynamics underpin OA through examination of OA vulnerability in a murine model of accelerated growth (Socs2
-/-). We describe accelerated growth plate fusion in these mice, consistent with their known overgrowth phenotype. However, we found no effect of surgical intervention or ageing on the articular cartilage or subchondral bone phenotype in these mice. This suggests that in this murine model, aberrant growth dynamics are not associated with vulnerability to OA development.It is well established that in OA, chondrocytes in the articular cartilage adopt a more transient phenotype, similar to that seen in the growth plate.
This raises the question as to whether a greater understanding of the discordant chondrocyte phenotype may inform on mechanisms underpinning OA, and strategies for treatment. Staines et al
have shown that in a spontaneous model of OA (STR/Ort mouse), there is an association between aberrant growth plate dynamics and OA development. Specifically, they revealed that STR/Ort mice show an overgrowth phenotype with enriched growth plate bridging, which was associated with articular cartilage lesions at 18 to 20 weeks of age.
This is similar to the growth phenotype observed in the Socs2
-/- described herein. Further, previous work on the MRC National Survey of Health and Development revealed modest associations between greater gains in height in childhood and decreased risk of knee OA at 53 years.
Further, canine studies have shown that femoral lengthening by 30% leads to knee articular cartilage damage, which is protected by apparatus extension with a hinged fixation system to the tibia.
Together, this suggests that an accelerated growth rate may play a role in the development of OA, although what that role is has yet to be fully defined.SOCS2 is a negative regulator of GH signalling, via inhibition of the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway.
Thus, mice deficient in Socs2
-/- display an excessive growth phenotype.
Characterization of their growth phenotype has revealed increased bone growth rates, growth plate widths, and chondrocyte proliferation in Socs2
-/- six‐week‐old mice compared to age-matched WT mice, suggestive of accelerated growth.
Socs2
-/- mice have normal serum levels of GH and insulin-like growth factor-1 (IGF-1), and their longitudinal overgrowth phenotype is due to local effects of the GH/IGF-1 axis on the growth plate.
Consistent with this, we revealed increased numbers and densities of growth plate bridges in Socs2
-/- mice, in comparison to WT mice. Growth plate bridges form in coordination with chondrocytes of the growth plate, exhausting their proliferative potential and undergoing senescence. They are also known to form upon growth plate injury, thought to be through an intramembranous ossification mechanism.
However, whether growth plate fusion occurs prior to or after the cessation of growth is of significant controversy in the field and has been somewhat overlooked.Using finite element modelling, work by Madi et al
and Staines et al
has previously shown growth plate bridging to increase stress dissipation in the subchondral bone region of the joint. It is therefore surprising that the increased growth plate bridging observed in our Socs2
-/- mice here had reduced subchondral bone plate and trabecular parameters. Previous studies have examined the Socs2
-/- bone phenotype with contradictory results. Our previous work has shown that Socs2
-/- mice have increased bone mass, trabecular number, and trabecular thickness.
However, others have shown the absence of SOCS2 to induce losses in cortical and trabecular bone mineral density.
These results are not consistent with the expected augmented GH/IGF-1 axis, but are consistent with our findings here and highlight the complexity of this pathway and the need for further studies to elucidate the precise role of SOCS2 signalling in bone homeostasis.Increased GH but reduced IGF-1 concentrations are present in synovial fluid of patients with OA.
However, in rodents deficient in GH and IGF-1, an increased severity of osteoarthritic articular cartilage lesions is observed.
Further, it has previously been shown that Socs2 messenger RNA (mRNA) levels are decreased in chondrocytes from osteoarthritic femoral heads.
Together, these data suggest a role for the GH/IGF-1/SOCS2 pathway in the pathology of OA. However, our results indicate that there is no effect of SOCS2 deficiency on OA vulnerability. This may be due to the normal serum levels of GH/IGF-1 observed in Socs2
-/- mice,
and suggests that compensatory cellular mechanisms exist in the Socs2
-/- which may involve other SOCS members. Indeed, eight SOCS proteins have been identified, and work by de Andrés et al
suggests that SOCS1 and SOCS3 are likely to play such a compensatory role. Further, the GH/IGF-1 status of the STR/Ort mouse, which exhibits a similar overgrowth phenotype to the Socs2
-/- mice but with spontaneous OA development, is unknown, and this may provide further insights into this mechanism. Similarly, we know that the GH signalling pathway is extremely complex, thus highlighting the need to better understand GH/IGF-1 signalling in the aetiology of OA.In summary, our data show that deletion of SOCS2 leads to accelerated growth plate fusion, but this had no effect on OA vulnerability in a surgical model of murine OA. Future studies will determine whether this lack of vulnerability is specific to this model of accelerated longitudinal growth, or whether this is characteristic of OA in general.
Authors: V E Macrae; S Horvat; S C Pells; H Dale; R S Collinson; A A Pitsillides; S F Ahmed; C Farquharson Journal: J Cell Physiol Date: 2009-02 Impact factor: 6.384
Authors: D Metcalf; C J Greenhalgh; E Viney; T A Willson; R Starr; N A Nicola; D J Hilton; W S Alexander Journal: Nature Date: 2000-06-29 Impact factor: 49.962
Authors: Kamel Madi; Katherine A Staines; Brian K Bay; Behzad Javaheri; Hua Geng; Andrew J Bodey; Sarah Cartmell; Andrew A Pitsillides; Peter D Lee Journal: Nat Biomed Eng Date: 2019-11-25 Impact factor: 25.671
Authors: K A Staines; K Madi; S M Mirczuk; S Parker; A Burleigh; B Poulet; M Hopkinson; A J Bodey; R C Fowkes; C Farquharson; P D Lee; A A Pitsillides Journal: Arthritis Rheumatol Date: 2016-04 Impact factor: 10.995
Authors: Katherine A Staines; Kamel Madi; Behzad Javaheri; Peter D Lee; Andrew A Pitsillides Journal: Front Mater Date: 2018-01-23 Impact factor: 3.515
Authors: Ross Dobie; Vicky E MacRae; Chloe Pass; Elspeth M Milne; S Faisal Ahmed; Colin Farquharson Journal: Dis Model Mech Date: 2018-01-17 Impact factor: 5.758