Literature DB >> 35271688

The non-ELR CXC chemokine encoded by human cytomegalovirus UL146 genotype 5 contains a C-terminal β-hairpin and induces neutrophil migration as a selective CXCR2 agonist.

Christian Berg1,2, Michael J Wedemeyer3, Motiejus Melynis1, Roman R Schlimgen3, Lasse H Hansen4,5, Jon Våbenø6, Francis C Peterson3, Brian F Volkman3, Mette M Rosenkilde1, Hans R Lüttichau1,2.   

Abstract

Human cytomegalovirus (HCMV) is a major pathogen in immunocompromised patients. The UL146 gene exists as 14 diverse genotypes among clinical isolates, which encode 14 different CXC chemokines. One genotype (vCXCL1GT1) is a known agonist for CXCR1 and CXCR2, while two others (vCXCL1GT5 and vCXCL1GT6) lack the ELR motif considered crucial for CXCR1 and CXCR2 binding, thus suggesting another receptor targeting profile. To determine the receptor target for vCXCL1GT5, the chemokine was probed in a G protein signaling assay on all 18 classical human chemokine receptors, where CXCR2 was the only receptor being activated. In addition, vCXCL1GT5 recruited β-arrestin in a BRET-based assay and induced migration in a chemotaxis assay through CXCR2, but not CXCR1. In contrast, vCXCL1GT1 stimulated G protein signaling, recruited β-arrestin and induced migration through both CXCR1 and CXCR2. Both vCXCL1GT1 and vCXCL1GT5 induced equally potent and efficacious migration of neutrophils, and ELR vCXCL1GT4 and non-ELR vCXCL1GT6 activated only CXCR2. In contrast to most human chemokines, the 14 UL146 genotypes have remarkably long C-termini. Comparative modeling using Rosetta showed that each genotype could adopt the classic chemokine core structure, and predicted that the extended C-terminal tail of several genotypes (including vCXCL1GT1, vCXCL1GT4, vCXCL1GT5, and vCXCL1GT6) forms a novel β-hairpin not found in human chemokines. Secondary NMR shift and TALOS+ analysis of vCXCL1GT1 supported the existence of two stable β-strands. C-terminal deletion of vCXCL1GT1 resulted in a non-functional protein and in a shift to solvent exposure for tryptophan residues likely due to destabilization of the chemokine fold. The results demonstrate that non-ELR chemokines can activate CXCR2 and suggest that the UL146 chemokines have unique C-terminal structures that stabilize the chemokine fold. Increased knowledge of the structure and interaction partners of the chemokine variants encoded by UL146 is key to understanding why circulating HCMV strains sustain 14 stable genotypes.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35271688      PMCID: PMC8939814          DOI: 10.1371/journal.ppat.1010355

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   6.823


Introduction

Human cytomegalovirus (HCMV) is a highly prevalent human herpesvirus that causes severe disease in immunocompromised patients. Both primary infection and reactivation of latent infection is a significant concern among HIV/AIDS patients, organ transplant recipients, in chemotherapy, and during pregnancy due to the risk of mother-to-child transmission, as it can lead to disability and death [1]. The 235 kb genome of HCMV encodes a large number of immune modulators that are used for immune evasion, viral dissemination, and latency. A common feature for herpesviruses is that a large part of their immunomodulatory genes are somehow connected to the chemokine system, as these viruses either encode chemokine receptors or chemokine ligands used to manipulate the host immune system, or they modulate the expression of host-encoded chemokine receptors [2,3]. Previous studies have observed a high degree of genetic diversity among different clinical HCMV isolates, including disruptive mutations to many immunomodulatory genes [4,5]. One of the most diverse genes, UL146, encodes the chemokine vCXCL1 [6] of which 14 distinct genotypes have been identified from clinical isolates [7,8]. We have previously demonstrated that UL146 genotype 1 (vCXCL1GT1, corresponding to the UL146 encoded by the Toledo strain) induces chemotaxis through its agonistic activity on G protein signaling of the neutrophil chemokine receptors CXCR1 and CXCR2 [9]. The attraction of neutrophils [10,11] to infection sites has been shown to facilitate viral dissemination and has established vCXCL1 as a virulence factor in a mouse model [12]. CXCR2 has been suggested to be the main receptor for vCXCL1-induced migration as CXCR1+ CXCR2- natural killer (NK) cells are co-attracted to a lesser extent than neutrophils [11]. Differences of variable importance in CXCR1/CXCR2 binding affinity, signaling potency, and chemotactic properties have been observed for several UL146 genotypes [10], but, apart from genotype 1 [9], the 13 remaining genotypes are yet to be characterized for functional activity against the remaining 17 chemokine receptors including CXCR1. All endogenous chemokines for CXCR1 and CXCR2 contain an ELR (Glu-Leu-Arg) motif in their N-terminus [13] and any change to the ELR motif in these chemokines eliminates their signaling through CXCR1 and CXCR2 [14]. Furthermore, introduction of an ELR motif in a non-ELR chemokine allows it to bind to CXCR1 and CXCR2 [15]. Thus, the ELR motif has been considered a molecular signature for CXCR1/2-targeting chemokines. Interestingly, UL146 genotypes 5 and 6 lack this motif (Fig 1), which suggests that these two UL146 variants target different chemokine receptors, which would imply an altered biological effect of the gene and, potentially, a change in pathogenicity for HCMV strains encoding UL146 genotype 5 and 6. Furthermore, no consensus on the signal peptide cleavage site exists for the non-ELR genotypes with published sequences defaulting to the same site as the other genotypes [10] while the signal peptide prediction server SignalP 4.1 [16] suggests a cleavage site that results in a longer N-terminus. These substantial differences in N-terminus length, ELR motifs, and general sequence variability are further complicated by differences in predicted glycosylation patterns (Figs 1 and 2A) [17,18]. Additionally, these HCMV-encoded chemokines have an extended C-terminus, which is only seen in seven of the nearly 50 human chemokines (XCL1, CCL16, CCL21, CCL25, CCL28, CXCL9 and CXCL12γ). Experimental structures of CCL25 and CXCL9 have not been reported, but NMR studies of XCL1 [19], CCL21 [20], CCL28 [21], and CXCL12γ [22] have demonstrated unstructured C-termini, while the distal C-terminus is not represented in an X-ray crystal structure of CCL16 (PDB ID: 5LTL).
Fig 1

Sequence alignments of the endogenous human chemokine CXCL8 and the 14 highly divergent genotypes of the HCMV-encoded UL146 chemokine.

Alignment generated with ClustalW 2.1 and adapted to illustrate differences in secondary structure. White on black illustrates identical residues, and black on grey similar residues. Important differences are color coded. The ELR motif is marked white on red and residues 100% conserved in UL146 are marked with a star (*). Genotypes 5 and 6 are shown with the longer N-terminus predicted by the SignalP 4.1 server [16]. Predicted glycosylation sites are marked black on green (N-glycosylation) and black on yellow (O-glycosylation) based on the NetNGlyc 1.0 [17] and NetOGlyc 4.0 [18] server predictions (threshold = 0.5). The two additional cysteine residues in the vCXCL1GT4 sequence (suggesting a third disulfide bond) are marked black on orange. The secondary structures of the chemokines are shown above the sequences as determined by NMR and X-ray structures for CXCL8 [23–25] and determined by Rosetta modelling for vCXCL1GT1–GT14. The proposed fourth and fifth β-strands unique to several vCXCL1 genotypes of the UL146 encoded chemokines have been marked by light blue (for the exact location of the α-helix and the β-strands for a particular UL146 genotype see S1 Fig).

Fig 2

Purification and mass spectrometry analysis of recombinant vCXCL1GT1 and vCXCL1GT5 expressed in COS-7 cells.

(A) Cartoon representation of predicted glycosylation sites in the 14 genotypic vCXCL1 proteins (B) HPLC elution profiles of conditioned media from eukaryotic cells transfected with UL146GT1 (top panel) and UL146GT5 (bottom panel). Minor background peaks are marked numerically. mAU; milliabsorbance units. (C) MALDI-TOF mass spectrometry analysis of untreated (top chromatogram) and PNGase F treated (bottom chromatogram) samples of vCXCL1GT1 and vCXCL1GT5 (red and blue peaks isolated in panel B).

Sequence alignments of the endogenous human chemokine CXCL8 and the 14 highly divergent genotypes of the HCMV-encoded UL146 chemokine.

Alignment generated with ClustalW 2.1 and adapted to illustrate differences in secondary structure. White on black illustrates identical residues, and black on grey similar residues. Important differences are color coded. The ELR motif is marked white on red and residues 100% conserved in UL146 are marked with a star (*). Genotypes 5 and 6 are shown with the longer N-terminus predicted by the SignalP 4.1 server [16]. Predicted glycosylation sites are marked black on green (N-glycosylation) and black on yellow (O-glycosylation) based on the NetNGlyc 1.0 [17] and NetOGlyc 4.0 [18] server predictions (threshold = 0.5). The two additional cysteine residues in the vCXCL1GT4 sequence (suggesting a third disulfide bond) are marked black on orange. The secondary structures of the chemokines are shown above the sequences as determined by NMR and X-ray structures for CXCL8 [23-25] and determined by Rosetta modelling for vCXCL1GT1–GT14. The proposed fourth and fifth β-strands unique to several vCXCL1 genotypes of the UL146 encoded chemokines have been marked by light blue (for the exact location of the α-helix and the β-strands for a particular UL146 genotype see S1 Fig).

Purification and mass spectrometry analysis of recombinant vCXCL1GT1 and vCXCL1GT5 expressed in COS-7 cells.

(A) Cartoon representation of predicted glycosylation sites in the 14 genotypic vCXCL1 proteins (B) HPLC elution profiles of conditioned media from eukaryotic cells transfected with UL146GT1 (top panel) and UL146GT5 (bottom panel). Minor background peaks are marked numerically. mAU; milliabsorbance units. (C) MALDI-TOF mass spectrometry analysis of untreated (top chromatogram) and PNGase F treated (bottom chromatogram) samples of vCXCL1GT1 and vCXCL1GT5 (red and blue peaks isolated in panel B). In this study, we characterize the receptor targeting profile of the non-ELR chemokine vCXCL1GT5 and analyze its receptor activity in parallel with vCXCL1GT1 in G protein signaling, β-arrestin recruitment, and chemotaxis assays, and we compare their signaling capabilities to those of another ELR (vCXCL1GT4) and non-ELR (vCXCL1GT6) genotype. Furthermore, we investigate the effect of N- and C-terminal chemokine truncations on receptor activation of selected vCXCL1 genotypes. Finally, we generate in silico structural models for all 14 genotypes using Rosetta to gain insight into the tertiary structures of these viral chemokines, and we compare the modelling to in vitro data of the vCXCL1GT1 tail structure generated by NMR and TALOS+ analysis.

Results

The mature vCXCL1GT5 is a 97 amino acid glycosylated chemokine with an extended N-terminus and a predicted novel C-terminal β-hairpin

Viral gene codon usage (e.g. for HIV and herpesviruses) can be unusual, resulting in poor or no expression of viral proteins unless a viral expression regulator is co-expressed [26]. Thus, we determined the codon availability indexes (CAI) of UL146 genotypes 1 and 5 genes using the JCAT algorithm [27], and both had a very low CAI of 0.10 indicating a highly unusual codon usage and low expression. To ensure sufficient expression of vCXCL1GT1 and vCXCL1GT5, the UL146 genes were codon-optimized (resulting in CAI values of 0.69 and 0.64, respectively), synthesized, and inserted in a eukaryotic expression vector. To ensure that the mature chemokines corresponded to those naturally secreted from HCMV-infected cells, vCXCL1GT1 and vCXCL1GT5 were expressed in eukaryotic COS-7 cells. The chemokines were collected in conditioned serum-free medium and purified by cation-exchange followed by HPLC purification, which gave two major unique peaks eluting at 31% and 37% acetonitrile respectively (Fig 2B) that were not present in the medium of cells transfected with the empty expression vector. MALDI-TOF analysis of the corresponding isolated fractions revealed pure samples with three peaks at 12188–12791 Da for vCXCL1GT5 (Fig 2C). The predicted mass of the vCXCL1GT5 was 10730 Da, but as the chemokine was likely N-glycosylated at position 86 (Fig 1), we treated the sample with PNGase F, which yielded a single peak at 10754 Da (Fig 2C), corresponding to the predicted mass of the full 97-residue vCXCL1GT5 plus a sodium ion (Na+ of 23 Da, a common adduct). Trypsinization identified the chemokine with 37.1% coverage (S2 Fig). These experiments show that the signal peptide cleavage site for vCXCL1GT5 is positioned between residues 19 and 20 of the precursor protein, resulting in an extended N-terminus (nine residues) compared to the ELR vCXCL1 chemokines (four residues) (Fig 1). For vCXCL1GT1, two N-glycosylation sites at positions 76 and 87 were predicted (Fig 1) and MALDI-TOF showed three peaks at 14290–14889 Da (Fig 2C). In accordance with the predicted signal peptide cleavage site between residues 22 and 23 of the precursor protein yielding a mature chemokine mass of 11073 Da, PNGase F-treatment resulted in a single peak of 11070 Da corresponding to a short N-terminus of four residues (Fig 1). The mass loss upon deglycosylation was approximately twice as large for vCXCL1GT1 (3220–3819 Da) as for vCXCL1GT5 (1434–2037 Da), which fits with the number of predicted N-glycosylation sites in the two proteins. Identifying the mature forms of vCXCL1GT1 and vCXCL1GT5 enabled an increased chemokine production by expression of the wild-type (1–97) genotype 5 UL146 in E. coli as well as the previously characterized genotype 1 UL146 for reference (Fig 1). As previous studies have shown that N-terminal truncation of the endogenous CXCR1 and CXCR2 ligands CXCL1 and CXCL8 can lead to increased activity [28-30], we also expressed two N-terminally truncated versions of vCXCL1GT5, vCXCL1GT5 (4–97) and vCXCL1GT5 (6–97), corresponding to an alternate predicted signal peptide cleavage site (4–97) and the cleavage site of the regular ELR vCXCL1s (6–97) (Fig 1). Furthermore, the other non-ELR chemokine (vCXCL1GT6) and an additional ELR chemokine (vCXCL1GT4) were also expressed in order to probe for differences in receptor activation within both non-ELR and ELR groups of the vCXCL1 chemokines. Finally, a tailless version of vCXCL1GT1 was expressed to examine the function of the extended C-terminus. Recombinant proteins were generated by two different protocols. In short, inclusion bodies were isolated, solubilized, and the chemokines underwent refolding and purification by FPLC cation-exchange chromatography followed by either size-exclusion chromatography or HPLC. Peptide masses were confirmed by mass-spectrometry. These recombinant UL146 chemokines were used for all experiments presented in this paper. To gain structural insight into vCXCL1GT1 and vCXCL1GT5, we used Rosetta to generate comparative models of both genotypes based on reported structures of CXCL2 (PDB ID: 3N52), CXCL5 (PDB ID: 2MGS), and CXCL8 (PDB ID: 5WDZ). These models were assessed by Rosetta total energy and the energetically favored top models (i.e. lowest Rosetta total score) were visually inspected. The top models for both vCXCL1GT1 and vCXCL1GT5 adopt the classic chemokine fold, with an unstructured N-terminus (Fig 3A and 3D) leading into an antiparallel 3-stranded β-sheet (Fig 3B and 3E) followed by an α-helix. Although some human chemokines have additional unstructured residues at the C-terminus, most terminate shortly after the α-helix. Both vCXCL1GT1 and vCXCL1GT5 contain an extended C-terminal tail of approximately 25 residues, which form a β-hairpin motif in all top models, although the spatial position of this motif varies (Figs 3C and 3F, and S1).
Fig 3

Structural analysis of vCXCL1 GT1 and vCXCL1 GT5 via molecular modeling and Nuclear Magnetic Resonance (NMR) Spectroscopy.

Cartoon representations of the top ten models (lowest Rosetta total score) of vCXCL1GT1 are overlaid and viewed from the left (A) and front (B). Each polypeptide chain is rainbow colored from N- (blue) to C-terminus (red). The extended C-terminus is hidden to highlight the convergence in the modeling (core Cα-RMSD: 3.9Å) and formation of the expected C-terminal α-helix. (C) Right-side view of three of the top vCXCL1GT1 models with the wild-type C-terminus, which forms a β-hairpin in all cases, but with no consensus location. (D) The ten top models of vCXCL1GT5 are shown overlaid and viewed from the left (core Cα-RMSD: 1.8Å) and front (E). (F) Right-side view of three of the top vCXCL1GT5 models with the wild-type C-terminus, which forms a β-hairpin in all cases, but with no consensus position. (G) NMR 1H-15N HSQC spectrum of the C-terminus of vCXCL1GT1 (residues 51–95). Backbone NH assignments are indicated by the one letter amino acid code and residue number. (H) Predicted secondary structure for vCXCL1GT1 based on secondary chemical shifts for residues 51–95 using TALOS+. The modeled secondary structure of vCXCL1GT1 using RosettaCM is displayed above. (I) Plot of {1H}-15N Heteronuclear NOE values reflecting the picosecond-nanosecond motions of the vCXCL1GT1 C-terminus. Proline residues are indicated with a red P, a gap at position 82 indicates inconclusive assignment information for this residue.

Structural analysis of vCXCL1 GT1 and vCXCL1 GT5 via molecular modeling and Nuclear Magnetic Resonance (NMR) Spectroscopy.

Cartoon representations of the top ten models (lowest Rosetta total score) of vCXCL1GT1 are overlaid and viewed from the left (A) and front (B). Each polypeptide chain is rainbow colored from N- (blue) to C-terminus (red). The extended C-terminus is hidden to highlight the convergence in the modeling (core Cα-RMSD: 3.9Å) and formation of the expected C-terminal α-helix. (C) Right-side view of three of the top vCXCL1GT1 models with the wild-type C-terminus, which forms a β-hairpin in all cases, but with no consensus location. (D) The ten top models of vCXCL1GT5 are shown overlaid and viewed from the left (core Cα-RMSD: 1.8Å) and front (E). (F) Right-side view of three of the top vCXCL1GT5 models with the wild-type C-terminus, which forms a β-hairpin in all cases, but with no consensus position. (G) NMR 1H-15N HSQC spectrum of the C-terminus of vCXCL1GT1 (residues 51–95). Backbone NH assignments are indicated by the one letter amino acid code and residue number. (H) Predicted secondary structure for vCXCL1GT1 based on secondary chemical shifts for residues 51–95 using TALOS+. The modeled secondary structure of vCXCL1GT1 using RosettaCM is displayed above. (I) Plot of {1H}-15N Heteronuclear NOE values reflecting the picosecond-nanosecond motions of the vCXCL1GT1 C-terminus. Proline residues are indicated with a red P, a gap at position 82 indicates inconclusive assignment information for this residue. Next, we generated models for the remaining vCXCL1 genotypes, each of which adopted the classical chemokine structure (S3A Fig). Of the 14 genotypes, three (vCXCL1GT3, vCXCL1GT13, and vCXCL1GT14) showed a loop-turn-loop conformation for the extended C-terminus, while the other 11 all displayed a C-terminal β-hairpin (S1 and S3B Figs). To assess the reliability of the molecular modeling, we used Nuclear Magnetic Resonance (NMR) to assign the backbone chemical shifts of vCXCL1GT1. A heteronuclear single-quantum coherence (HSQC) spectrum showed well-dispersed peaks indicative of a folded protein, including the shifts corresponding to the extended C-terminus (Fig 3G). Using TALOS+, we parsed secondary structure elements in the extended vCXCL1GT1 C-terminus based on the 1H, 13Cα, 13Cβ, 13C′, and 15N chemical shifts [31]. The TALOS+ analysis predicted β-strands for residues 72–79 and 85–94 with high confidence, matching the consensus location of the β-hairpin in the Rosetta models (Fig 3H). Additionally, high {1H}-15N heteronuclear NOE values (>0.6) in the C-terminus suggested that the vCXCL1GT1 protein backbone in this region is well ordered (Fig 3I).

vCXCL1GT5 is a selective CXCR2 agonist in G protein signaling

We investigated the receptor target(s) of the three non-ELR vCXCL1GT5 chemokine variants by screening for both agonistic and antagonistic activity on G protein signaling on a panel of all 18 classical human chemokine receptors in an IP accumulation assay (Fig 4). The HCMV-encoded chemokine receptor US28Δ300 (a C-terminally truncated US28 with increased signaling properties [32]) was also included. vCXCL1GT5 was found to activate CXCR2 at ~60% of the maximal activity of CXCL8 and did not activate CXCR1 or any other chemokine receptor (Fig 4B), whereas the two N-terminally truncated variants (vCXCL1GT5 (4–97) and vCXCL1GT5 (6–97)) were half as efficacious as the wild-type chemokine on CXCR2 at ~30% (31% and 29%, respectively) the efficacy of the CXCL8 on CXCR2. The results support that the 1–97 variant with the extended N-terminus is the secreted functional form of vCXCL1GT5. Pretreatment of the chemokine receptors with 1 μM vCXCL1GT5 did not block or inhibit the response of any of the 18 human chemokine receptors or US28Δ300 (Fig 4B), and the same results were seen for the truncated vCXCL1GT5 variants. Thus, no antagonistic activity on G protein signaling was observed, and as vCXCL1GT5 was unable to activate or inhibit the US28 receptor we found no evidence that vCXCL1GT5 participated in an autocrine loop through US28. These experiments demonstrate that vCXCL1GT5 is a CXCR2 selective agonist with respect to G protein signaling.
Fig 4

Screening of non-ELR vCXCL1GT5 activity on G protein signaling of an array of all 18 classical human chemokine receptors and the HCMV-encoded US28.

(A) N-terminal sequences of the wild-type and truncated versions of vCXCL1GT5. (B) Agonism of 1 μM wild-type vCXCL1GT5, vCXCL1GT5 (4–97), and vCXCL1GT5 (6–97) on chemokine receptor G protein signaling in an IP accumulation assay compared to the response of the endogenous ligand for the receptor. The following endogenous chemokines were used as a positive control (concentrations shown in brackets): CCR1;CCL5 (B: 100 nM, C: 10 nM), CCR2;CCL7 (B: 100 nM, C: 10 nM), CCR3;CCL11 (B: 100 nM, C: 10 nM), CCR4;CCL17 (B: 100 nM, C: 10 nM), CCR5;CCL5 (B: 100 nM, C: 10 nM), CCR6;CCL20 (B: 100 nM, C: 1 nM), CCR7;CCL19 (B: 100 nM, C: 10 nM), CCR8;CCL1 (B: 100 nM, C: 10 nM), CCR9;CCL25 (B: 100 nM, C: 10 nM), CCR10;CCL27 (B: 100 nM, C: 10 nM), CXCR1;CXCL8 (B: 1 μM, C: 10 nM), CXCR2;CXCL8 (B: 1 μM, C: 100 nM), CXCR3;CXCL11 (B: 100 nM, C: 10 nM), CXCR4;CXCL12 (B: 100 nM, C: 10 nM), CXCR5;CXCL13 (B: 100 nM, C: 10 nM), CXCR6;CXCL16 (B: 100 nM, C: 1 nM), XCR1;XCL1 (B: 100 nM, C: 100 nM), CX3CR1;CX3CL1 (B: 100 nM, C: 1 nM), US28Δ300;CX3CL1 (B: 100 nM, C: 1 nM); n = 3–6. All error bars are presented as SEM. (C) Antagonism of 1 μM wild-type vCXCL1GT5, vCXCL1GT5 (4–97), and vCXCL1GT5 (6–97) on chemokine receptor G protein signaling in an IP accumulation assay using submaximal concentrations of the endogenous chemokines described above; n = 3–6. All error bars are presented as SEM.

Screening of non-ELR vCXCL1GT5 activity on G protein signaling of an array of all 18 classical human chemokine receptors and the HCMV-encoded US28.

(A) N-terminal sequences of the wild-type and truncated versions of vCXCL1GT5. (B) Agonism of 1 μM wild-type vCXCL1GT5, vCXCL1GT5 (4–97), and vCXCL1GT5 (6–97) on chemokine receptor G protein signaling in an IP accumulation assay compared to the response of the endogenous ligand for the receptor. The following endogenous chemokines were used as a positive control (concentrations shown in brackets): CCR1;CCL5 (B: 100 nM, C: 10 nM), CCR2;CCL7 (B: 100 nM, C: 10 nM), CCR3;CCL11 (B: 100 nM, C: 10 nM), CCR4;CCL17 (B: 100 nM, C: 10 nM), CCR5;CCL5 (B: 100 nM, C: 10 nM), CCR6;CCL20 (B: 100 nM, C: 1 nM), CCR7;CCL19 (B: 100 nM, C: 10 nM), CCR8;CCL1 (B: 100 nM, C: 10 nM), CCR9;CCL25 (B: 100 nM, C: 10 nM), CCR10;CCL27 (B: 100 nM, C: 10 nM), CXCR1;CXCL8 (B: 1 μM, C: 10 nM), CXCR2;CXCL8 (B: 1 μM, C: 100 nM), CXCR3;CXCL11 (B: 100 nM, C: 10 nM), CXCR4;CXCL12 (B: 100 nM, C: 10 nM), CXCR5;CXCL13 (B: 100 nM, C: 10 nM), CXCR6;CXCL16 (B: 100 nM, C: 1 nM), XCR1;XCL1 (B: 100 nM, C: 100 nM), CX3CR1;CX3CL1 (B: 100 nM, C: 1 nM), US28Δ300;CX3CL1 (B: 100 nM, C: 1 nM); n = 3–6. All error bars are presented as SEM. (C) Antagonism of 1 μM wild-type vCXCL1GT5, vCXCL1GT5 (4–97), and vCXCL1GT5 (6–97) on chemokine receptor G protein signaling in an IP accumulation assay using submaximal concentrations of the endogenous chemokines described above; n = 3–6. All error bars are presented as SEM.

vCXCL1GT5 causes IP accumulation through CXCR2 in a dose-dependent manner

Having established that vCXCL1GT5 selectively targets CXCR2, in contrast to vCXCL1GT1 that targets both CXCR1 and CXCR2 [9], we decided to investigate the dose/response relationship of G protein activation of the two chemokine receptors using two ELR vCXCL1s (genotype 1 and genotype 4) and the two non-ELR vCXCL1s (genotype 5 and genotype 6) with CXCL8 for reference (Fig 5A–5D). Additionally, the two N-terminally truncated vCXCL1GT5 variants were tested (Fig 5E and 5F). On CXCR1, vCXCL1GT1 activated G protein signaling with a lower potency than CXCL8, while no activity was seen for vCXCL1GT4 (Fig 5A). On CXCR2, vCXCL1GT1 and vCXCL1GT4 matched the activity of CXCL8 (Fig 5B). The two non-ELR vCXCL1s (vCXCL1GT5 and vCXCL1GT6) were, like the ELR chemokine vCXCL1GT4, unable to activate CXCR1 (Fig 5C), but activated CXCR2 to the same extent although with lower potency than CXCL8 (Fig 5D). The two N-terminally truncated vCXCL1GT5 variants showed the same pattern of activation as vCXCL1GT5, but did not significantly activate the receptor at concentrations below 1 μM (Fig 5E and 5F).
Fig 5

Dose/response activity of vCXCL1GT1, vCXCL1GT4, vCXCL1GT6, and vCXCL1GT5 variants on G protein signaling of CXCR1 and CXCR2.

G protein signaling of CXCR1 and CXCR2 by vCXCL1GT1 and vCXCL1GT4 (A+B), wild-type vCXCL1GT5 and vCXCL1GT6 (C+D), and vCXCL1GT5 (4–97), and vCXCL1GT5 (6–97) (E+F) in an IP accumulation assay. Error bars presented as SEM. For CXCR1, the number of repeated observations for each sum curve were: CXCL8 n = 10; vCXCL1GT1 n = 8; vCXCL1GT4 n = 3; wild-type vCXCL1GT5 n = 10; vCXCL1GT6 n = 3; vCXCL1GT5 (4–97) n = 4; vCXCL1GT5 (6–97) n = 4. For CXCR2, the number of repeated observations for each sum curve were: CXCL8 n = 10; vCXCL1GT1 n = 8; vCXCL1GT4 n = 3; wild-type vCXCL1GT5 n = 10; vCXCL1GT6 n = 3; vCXCL1GT5 (4–97) n = 3; vCXCL1GT5 (6–97) n = 3.

Dose/response activity of vCXCL1GT1, vCXCL1GT4, vCXCL1GT6, and vCXCL1GT5 variants on G protein signaling of CXCR1 and CXCR2.

G protein signaling of CXCR1 and CXCR2 by vCXCL1GT1 and vCXCL1GT4 (A+B), wild-type vCXCL1GT5 and vCXCL1GT6 (C+D), and vCXCL1GT5 (4–97), and vCXCL1GT5 (6–97) (E+F) in an IP accumulation assay. Error bars presented as SEM. For CXCR1, the number of repeated observations for each sum curve were: CXCL8 n = 10; vCXCL1GT1 n = 8; vCXCL1GT4 n = 3; wild-type vCXCL1GT5 n = 10; vCXCL1GT6 n = 3; vCXCL1GT5 (4–97) n = 4; vCXCL1GT5 (6–97) n = 4. For CXCR2, the number of repeated observations for each sum curve were: CXCL8 n = 10; vCXCL1GT1 n = 8; vCXCL1GT4 n = 3; wild-type vCXCL1GT5 n = 10; vCXCL1GT6 n = 3; vCXCL1GT5 (4–97) n = 3; vCXCL1GT5 (6–97) n = 3. From this dose/response investigation, it was clear that the N-terminally truncated vCXCL1GT5 variants had severely inhibited signaling properties compared to the wild-type chemokine (Fig 5F), which suggests that the first three residues of the N-terminus, Gly-Phe-Gly (GFG), are crucial to the activity of vCXCL1GT5. As expected, the two tested ELR vCXCL1s followed the same pattern of receptor activation as human ELR chemokines in either selectively targeting CXCR2 (vCXCL1GT4) or targeting both CXCR1 and CXCR2 (vCXCL1GT1).

Both ELR and non-ELR vCXCL1 stimulate β-arrestin recruitment

A previous study has demonstrated the ability of several vCXCL1s to recruit β-arrestin through CXCR2 [10]. In order to investigate the ability of vCXCL1GT1 and vCXCL1GT5 to recruit β-arrestin by both CXCR1 and CXCR2 they were tested in a BRET-based β-arrestin recruitment assay using CXCL8 as a positive control (Fig 6). We also tested how G protein-coupled receptor kinase (GRK) phosphorylation affected β-arrestin recruitment by co-transfecting with GRK2 and GRK6. The results mirrored those from the G protein signaling assay, as vCXCL1GT1 was able to stimulate β-arrestin recruitment on CXCR1 (Fig 6B) at >100-fold lower potency than CXCL8 (Fig 6A) while vCXCL1GT5 did not (Fig 6C). For CXCR2, both vCXCL1GT1 and vCXCL1GT5 stimulated β-arrestin recruitment at comparable efficacies to CXCL8 but with ~10-fold lower potencies (Fig 6D–6F).
Fig 6

The effect of vCXCL1GT1 and vCXCL1GT5 on β-arrestin recruitment through CXCR1 and CXCR2 with/without GRKs.

Agonism of CXCL8 (A+D), vCXCL1GT1 (B+E), and wild-type vCXCL1GT5 (C+F) on the β-arrestin recruitment pathway of CXCR1 and CXCR2 in a BRET-based assay without GRKs (circle, ●), with GRK2 (square, ■), and with GRK6 (triangle, ▲); n = 3–4. Error bars presented as SEM.

The effect of vCXCL1GT1 and vCXCL1GT5 on β-arrestin recruitment through CXCR1 and CXCR2 with/without GRKs.

Agonism of CXCL8 (A+D), vCXCL1GT1 (B+E), and wild-type vCXCL1GT5 (C+F) on the β-arrestin recruitment pathway of CXCR1 and CXCR2 in a BRET-based assay without GRKs (circle, ●), with GRK2 (square, ■), and with GRK6 (triangle, ▲); n = 3–4. Error bars presented as SEM. Addition of GRK2 increased the activity of CXCL8 and vCXCL1GT1 on CXCR1 slightly (Fig 6A and 6B), while GRK6 co-transfection did not have a significant effect, suggesting that GRK2 is involved in the phosphorylation of CXCR1 upon CXCL8 and vCXCL1GT1-induced activation. The opposite was observed for CXCR2, as GRK2 reduced the activity of all three ligands considerably and GRK6 did so to an even greater extent (Fig 6D–6F). This GRK dependency agrees with previous observations for CXCL8 on CXCR1 and CXCR2 [33]. Thus, vCXCL1GT1 recruits β-arrestins through CXCR1 and CXCR2, and vCXCL1GT5 through CXCR2. Together with the G protein pathway experiments, this confirms that vCXCL1GT5 is a selective CXCR2 agonist.

vCXCL1GT5 does not induce migration through CXCR1 but attracts PBNs to the same degree as vCXCLGT1

Another role of β-arrestin is to induce reorganization of the cytoskeleton thereby facilitating chemotaxis [34]. Having established that vCXCL1GT5 activates and induces β-arrestin recruitment through CXCR2 but not CXCR1, while vCXCL1GT1 was an agonist on the same pathways on both receptors, we investigated whether the same pattern was seen in chemotaxis. The chemotactic properties of vCXCL1GT1 and vCXCL1GT5 were first tested using the murine pre-B lymphocyte cell line L1.2 stably transfected with either CXCR1 or CXCR2 in a transwell migration assay (Fig 7A and 7B). The efficacy of vCXCL1GT1 in inducing chemotaxis of CXCR1-expressing L1.2 cells was comparable to that of CXCL8, although CXCL8 was more potent on this receptor. In contrast, 1 μM vCXCL1GT5 produced a minimal response at 0.2% of the efficacy of 1 nM CXCL8, which is not visible in Fig 7A. CXCL8 elicited the classical bell-shaped dose response, whereas concentrations higher than 1 μM of vCXCL1GT1 would be necessary to evoke the downward slope of the curve. For the CXCR2-expressing cells, CXCL8, vCXCL1GT1 and vCXCL1GT5 all elicited the classical bell-shaped dose-response curves typical for chemotaxis assays. CXCL8 was again the most potent chemokine in evoking chemotaxis, while the viral chemokines were approximately equipotent, with vCXCL1GT1 displaying the highest efficacy. Next, we compared the two viral chemokines in a migration assay using primary cells. CXCR1 and CXCR2 are primarily present on neutrophils and responsible for their migration to sites of inflammation in response to local chemokine gradients. Thus, a transwell cell migration assay was performed for CXCL8, vCXCL1GT1 and vCXCL1GT5 using isolated PBNs, which showed substantial migration for all three chemokines (Fig 7C). Importantly, the similar migratory response of neutrophils to vCXCL1GT1 and vCXCL1GT5 indicates that CXCR1 is not necessary for inducing migration of neutrophils. The higher efficacy of vCXCL1GT1 compared to vCXCL1GT5 in inducing migration of CXCR2 transfected cells—in contrast to the same efficacy for the two viral chemokines to induce migration of neutrophils—is likely due to cell dependent differences in the chemotactic machinery resulting in saturation of specific steps in the signaling cascade leading to migration.
Fig 7

vCXCL1GT1, vCXCLGT5 and CXCL8-induced migration of L1.2 cells stably expressing either CXCR1 or CXCR2, and neutrophils.

Chemotactic activities of L1.2 cells stably transfected with (A) CXCR1 (n = 4) and (B) CXCR2 (n = 3) toward vCXCL1GT1, wild-type vCXCLGT5 and CXCL8 in a transwell migration assay. Representative assays with error bars presented as SEM. (C) Chemotactic activity of human neutrophils toward vCXCL1GT1, wild-type vCXCL1GT5 and CXCL8 in a transwell migration assay, shown as migration index (MI) determined from point measurement divided by the background measurement (n = 4). Representative assay with error bars presented as SEM.

vCXCL1GT1, vCXCLGT5 and CXCL8-induced migration of L1.2 cells stably expressing either CXCR1 or CXCR2, and neutrophils.

Chemotactic activities of L1.2 cells stably transfected with (A) CXCR1 (n = 4) and (B) CXCR2 (n = 3) toward vCXCL1GT1, wild-type vCXCLGT5 and CXCL8 in a transwell migration assay. Representative assays with error bars presented as SEM. (C) Chemotactic activity of human neutrophils toward vCXCL1GT1, wild-type vCXCL1GT5 and CXCL8 in a transwell migration assay, shown as migration index (MI) determined from point measurement divided by the background measurement (n = 4). Representative assay with error bars presented as SEM.

Deletion of the C-terminus of vCXCL1GT1 results in solvent exposure of chemokine core tryptophan residues and in a non-functional protein

In general, deletion of the C-terminus from human chemokines with long C-termini does not lead to loss of functional activity [21,22,35-44] (S1 Table). To investigate if this was also the case for vCXCL1GT1, we expressed and purified a tailless vCXCL1GT1 protein from E. coli where the 24 distal residues were deleted, resulting in a 71-residue protein (Fig 8A). Interestingly, the tailless vCXCL1GT1 did not induce IP3 accumulation through CXCR1 and CXCR2 in contrast to the wild-type vCXCL1GT1 (Fig 8B and 8C). Next, the thermal denaturation of purified wild-type vCXCL1GT1 and the tailless vCXCL1GT1 was assessed by nano differential scanning fluorimetry (nanoDSF) (Fig 8D and 8E). Due to the high sensitivity of tryptophan sidechains to their chemical environment, protein unfolding can be detected by monitoring the intensity and ratio of emission at 350 nm to 330 nm [45]. This analysis gave a two-state melting curve with an apparent Tm of 66.4°C for wild-type vCXCL1GT1, whereas tailless vCXCL1GT1 was unfolded from 20–95°C, demonstrating that the C-terminal β-hairpin of vCXCL1GT1 is required for folding of a stable chemokine core.
Fig 8

Functional activity and thermal melting curves for tailless and wild-type vCXCL1GT1.

(A) C-terminal sequences and secondary structure of wild-type and tailless vCXCL1GT1. (B+C) G protein signaling in an IP accumulation assay of wild-type and tailless vCXCL1GT1 on CXCR1 and CXCR2; n = 3. Error bars shown as SEM. (D+E) Thermal melting curves and their first derivative for wild-type and tailless vCXCL1GT1; n = 3.

Functional activity and thermal melting curves for tailless and wild-type vCXCL1GT1.

(A) C-terminal sequences and secondary structure of wild-type and tailless vCXCL1GT1. (B+C) G protein signaling in an IP accumulation assay of wild-type and tailless vCXCL1GT1 on CXCR1 and CXCR2; n = 3. Error bars shown as SEM. (D+E) Thermal melting curves and their first derivative for wild-type and tailless vCXCL1GT1; n = 3.

Discussion

The 14 stable UL146 genotypes encoded by circulating HCMV strains display considerable variation both among themselves and compared to human chemokines on several parameters such as length of the N-terminus, the presence or lack of an ELR motif, glycosylation pattern, and length of the C-terminus. We here show that the two non-ELR HCMV-encoded chemokines vCXCL1GT5 and vCXCL1GT6 are selective agonists for CXCR2—a property not shared by any human chemokines. Furthermore, Rosetta analysis predicted that the C-terminal tail of most vCXCL1 genotypes adopts a novel β-hairpin that is required for receptor activation, likely by stabilization of the chemokine fold.

Structural elements of the vCXCL1GT1 and vCXCL1GT5 proteins

The predicted signal peptide cleavage sites of vCXCL1GT1 and vCXCL1GT5 were confirmed through eukaryotic chemokine expression using MALDI-TOF and PNGase F treatment (Fig 2), revealing different lengths of the N-terminus for ELR and non-ELR vCXCL1. In the initial report on vCXCL1, the molecular weight of the deglycosylated, secreted protein was estimated using western blots [6]. Another group expressed several vCXCL1 variants in insect cells, and although MALDI-TOF was used for mass determinations, molecular weights were not reported for the individual vCXCL1 genotypes, nor was removal of N- and O-linked glycans [10]. In the present study, we found vCXCL1GT1 and vCXCL1GT5 to be N-glycosylated as predicted (Fig 1). The pattern of predicted glycosylation for all genotypes is interesting and a distinctive feature for the individual genotypes. Six genotypes (GT1, 2, 3, 5, 8 and 12) are predicted to be N-glycosylated, five genotypes (GT4, 9, 10, 11 and 13) to be O-glycosylated and three genotypes (GT6, 7 and 14) not to be glycosylated at all (Figs 1 and 2A). The resulting proteoforms of these post-translational modifications provide the vCXCL1 variants with different epitopes important for binding to the extracellular matrix and immune cells and variation in the ability to shield epitopes of the chemokine core from the immune system of the host. Homology modeling predicted that 11 of the 14 vCXCL1 genotypes form a novel 4th and 5th β-strand at the extended C-terminus. These strands form a β-hairpin that turns upon itself at a common glycine-proline motif (S1 Fig). The presence of this β-hairpin in multiple top scoring modeling runs in Rosetta and the identification of two stable β-strands by secondary NMR chemical shift analysis of five atoms (HN, Cα, Cβ, CO, N) for the last 45 residues of vCXCL1GT1 in TALOS analysis support the existence of this unique secondary structure. While an extended C-terminal tail is also found in some human chemokines, these lack secondary structure elements in contrast to these HCMV-encoded chemokines [19-22] (S1 Table). The presence of the β-hairpin in a majority of the 14 genotypes implies conserved but unknown functions. The thermal unfolding and functional data of the tailless vCXCL1GT1 protein suggest that one role of the terminal β-hairpin is to stabilize the chemokine fold (Fig 8D and 8E). This is in contrast to NMR structures of tailless versions of human chemokines with extended C-termini (XCL1, CCL21, CCL25, CCL28 and CXCL12γ), which contain a preserved chemokine fold [21,22,35,39,40,46] (S1 Table) and which retain functional activity [21,22,35,36,39-44] (S1 Table). Furthermore, in addition to stabilization of the chemokine fold, other functions of the β-hairpin are likely. Documented roles for the unstructured extended C-termini of human chemokines include antifungal activity [21] and glycosaminoglycan (GAG) binding [22,40,43]. Thus, a high content of basic residues in the C-terminus has been linked to GAG binding. The C-termini of CCL21 and CXCL12γ are highly basic (32% and 58%) and deletion of these C-termini results in loss of GAG binding [22,40,43] (S1 Table). Likewise, the C-termini of vCXCL1GT10 (34%) and vCXCL1GT12 (27%) also have a high content of basic residues suggesting GAG binding (S1 Table). In contrast, the extended C-termini of some of the human (XCL1 and CCL16) and some of the viral (vCXCL1GT1, vCXCL1GT2 and vCXCL1GT4) chemokines are significantly less basic, which suggest binding to unidentified proteins such as cell surface receptors or other chemokines (S1 Table). Chemokine binding is a particularly interesting possibility as CXC chemokines are known to dimerize along the β1-strands. This possibility was illustrated in models of vCXCL1GT4 that have a non-canonical third disulfide bond which was not found in other genotypes (Figs 1 and 9A). This disulfide bond linked the first β-strand to the end of the α-helix and facilitated the β-hairpin to continue the anti-parallel β-sheet core (Fig 9B). This organization mimics CXC dimerization, as seen by alignment to one monomer of a CXCL8 dimer (Fig 9C). While it is possible that other genotypes may adopt this extended β-sheet conformation, it is less likely as the α-helix is unrestrained by a disulfide bridge, thus allowing the β-hairpin more freedom of movement. Importantly, this conformation highlights the possibility for the β-hairpin to bind the β1-strand of another chemokine. Binding host chemokines and inhibiting their interaction with cognate receptors could manipulate the immune response and lead to improved viral fitness.
Fig 9

The predicted third disulfide bond of vCXCL1GT4 allows the C-terminal β-hairpin to mimic CXC chemokine dimerization.

(A) The top model of vCXCL1GT4 is shown in cartoon form with disulfide bridges shown as spheres. The canonical disulfide bonds (DS1 and DS2) stabilize chemokine tertiary structure. A unique disulfide (DS3) links the β1-strand to the C-terminal α-helix. (B) The top model of vCXCL1GT4 is rotated 180° to show the front view. vCXCL1GT4 models have a consensus location for the C-terminal β-hairpin, which continues the 3-stranded β-sheet core. This mimics the CXC dimer interface shown in panel C. The constraint from the third disulfide bond may help stabilize this conformation, as there was no consensus β-hairpin location in other genotype models. (C) The top vCXCL1GT4 model was aligned to one of the CXCL8 chains in a structure of a CXCL8 dimer (PDB ID: 6LFM). The other dimer subunit is shown in cartoon form (gray), and the extended C-terminus of vCXCL1GT4 is hidden for clarity as it overlaps with the CXC dimer interface. The third disulfide bond in vCXCL1GT4 locks the α-helix into an orientation that would clash with a classic CXC dimer. The vCXCL1GT4 α-helix angle varies 20° from the α-helix of CXCL8, shown as a dotted orange line.

The predicted third disulfide bond of vCXCL1GT4 allows the C-terminal β-hairpin to mimic CXC chemokine dimerization.

(A) The top model of vCXCL1GT4 is shown in cartoon form with disulfide bridges shown as spheres. The canonical disulfide bonds (DS1 and DS2) stabilize chemokine tertiary structure. A unique disulfide (DS3) links the β1-strand to the C-terminal α-helix. (B) The top model of vCXCL1GT4 is rotated 180° to show the front view. vCXCL1GT4 models have a consensus location for the C-terminal β-hairpin, which continues the 3-stranded β-sheet core. This mimics the CXC dimer interface shown in panel C. The constraint from the third disulfide bond may help stabilize this conformation, as there was no consensus β-hairpin location in other genotype models. (C) The top vCXCL1GT4 model was aligned to one of the CXCL8 chains in a structure of a CXCL8 dimer (PDB ID: 6LFM). The other dimer subunit is shown in cartoon form (gray), and the extended C-terminus of vCXCL1GT4 is hidden for clarity as it overlaps with the CXC dimer interface. The third disulfide bond in vCXCL1GT4 locks the α-helix into an orientation that would clash with a classic CXC dimer. The vCXCL1GT4 α-helix angle varies 20° from the α-helix of CXCL8, shown as a dotted orange line.

The non-ELR vCXCL1GT5 chemokine is a selective CXCR2 agonist

We have previously established that the ELR chemokine vCXCL1GT1 (encoded by UL146 from the Toledo strain) is a dual CXCR1 and CXCR2 agonist when tested on a panel of cell lines expressing all human chemokine receptors individually [9]. In the present study, we elaborate on that finding by demonstrating that the non-ELR vCXCL1GT5 (encoded by the Davis strain) is a selective CXCR2 agonist in G protein signaling using an IP accumulation assay (Figs 4B, 5A, and 5B). Thus, both vCXCL1 variants have the common trait of only targeting receptors activated by human ELR chemokines. The importance of CXCR1 and CXCR2 as receptor targets for this HCMV-encoded family of chemokines is further supported by the fact that both vCXCL1GT4 and vCXCL1GT6 activated CXCR2 selectively (Fig 5B and 5D). As some viral chemokines, e.g. vMIP-II encoded by Kaposi’s sarcoma-associated herpesvirus and MC148 encoded by a poxvirus, act as chemokine receptor antagonists [47-49], vCXCL1GT5 was screened for antagonism on the 18 chemokine receptors but was not found to block G protein signaling (Fig 4C). The CXCR2 selectivity of vCXCL1GT5 was confirmed for the β-arrestin pathway in a BRET-based assay, where it was unable to stimulate β-arrestin recruitment through CXCR1 (Fig 6C), while potent recruitment was seen through CXCR2 (Fig 6F). In contrast, vCXCL1GT1 recruited β-arrestin through both CXCR1 and CXCR2, thus confirming its action as a dual agonist. Finally, the selective use of CXCR2 for vCXCL1GT5 was also confirmed in migration assays using stable cell-lines expressing either CXCR1 or CXCR2. Although the non-ELR vCXCL1GT5 only activated CXCR2, we found that it was able to induce chemotaxis of neutrophils with equal potency and efficacy to the ELR vCXCL1GT1 in a transwell migration assay (Fig 7). Another group previously expressed all vCXCL1 genotypes except genotypes 3, 4, and 5 in insect cells and tested them on PBNs and cell lines transfected with CXCR2 (but not CXCR1) in different functional assays [10]. Although vCXCL1GT5 was not included, the other non-ELR genotype vCXCL1GT6 with a highly similar sequence to genotype 5 (Fig 1) was tested. They found that vCXCL1GT1 was able to activate G protein-dependent and–independent pathways through CXCR2, agreeing with our observation, but in contrast to our results, they found vCXCL1GT6 unable to stimulate G protein signaling and β-arrestin recruitment through CXCR2 [10]. Additionally, although they and others have reported that the ELR-containing vCXCL1GT1 and vCXCL1GT2 elicit robust chemotactic responses in neutrophils [6,10,11], no induction of neutrophil chemotaxis was observed for vCXCL1GT6 [10]. Thus, in contrast to our findings for vCXCL1GT6 and the analogous non-ELR chemokine vCXCL1GT5, they did not see any activity of vCXCL1GT6. There could be various reasons for this discrepancy, one being expression of the non-ELR vCXCL1 with a short N-terminus, corresponding to our N-terminally truncated vCXCL1GT5 (6–97), which we here show is not the mature, functional chemokine. Herpesviruses not only interact with the human chemokine system through virally encoded chemokines, but also through virally encoded chemokine receptors. For example, HCMV encodes four 7TM (seven-transmembrane domain) receptors including US28, which is a well-characterized chemokine receptor [2,3]. Cytomegalovirus-infected cells express US28 during latency and the receptor has been validated as a drug target in mouse models [50]. US28 can signal constitutively but also through binding of CC and CX3C chemokines [51,52]. While no current data supports US28 interaction with CXC chemokines, we speculated whether HCMV could activate US28 through vCXCL1GT5 in an autocrine loop, and thereby rewire an infected cell to a state supporting latency. However, we were unable to demonstrate US28 activation by vCXCL1GT5 (Fig 4B). The recently solved structure of CXCL8 bound to CXCR2 (PDB ID: 6LFO) has shed light on receptor activation by an ELR chemokine [53]. This structure shows extensive contacts between the receptor and the ELR motif considered crucial for activation. However, here we show that vCXCL1GT5 and vCXCL1GT6, both of which lack an ELR motif, signal through CXCR2, and to our knowledge, this has not been described for any naturally occurring chemokine before. To investigate the ability of vCXCL1GT5 to circumvent the ELR selectivity of CXCR2, we aligned our chemokine models to CXCL8 in the CXCL8:CXCR2 complex (Fig 10). Both vCXCL1GT1 and vCXCL1GT5 mimic the core structure of CXCL8, and the C-terminal β-hairpin does not appear to hinder interactions with the receptor N-terminus (chemokine-recognition site 1) (Fig 10A and 10C). The N-terminus of the chemokine, which contains the ELR motif, binds and activates the receptor via the orthosteric pocket. The model of vCXCL1GT1 has the N-terminus in a matching position as CXCL8, with Glu2 (Glu4 in this CXCL8 structure) of the ELR motif located near receptor residues Arg208, Arg212, and Arg278 that drive receptor activation (Fig 10B). In lieu of the ELR motif, which precedes the first conserved cysteine, vCXCL1GT5 contains the N-terminal sequence 1-GFGTEGNGR-9. In the top models of vCXCL1GT5 (generated without the receptor present), this longer N-terminus turns back upon itself and is not likely to activate CXCR2 in the same manner as CXCL8 (Fig 10D). During a binding event, the N-terminus of vCXCL1GT5 may adopt a stable conformation, facilitated by Arg9 at the Cys-1 position which acts as a stabilizing anchor point in CXCL8. It is unclear if Asn7 is sufficient to activate CXCR2, or if Glu5 can be reoriented to contact receptor residues critical for activation. The truncation data for vCXCL1GT5 support the first scenario, as removal of 1-GFGTE-5 reduces, but does not completely abrogate, signaling ability. Similarly, removal of 1-GFG-3 reduces signaling ability. These residues may act to stabilize the extended N-terminus in an orientation favorable for activation.
Fig 10

Alignment of vCXCL1GT1 and vCXCL1GT5 models with CXCL8 in the experimental CXCL8:CXCR2 complex.

(A) The top model (lowest Rosetta total score) for vCXCL1GT1 is shown in cartoon form (red) aligned to the structure of the CXCL8:CXCR2 complex (PDB: 6LFO). The extended C-terminus is unlikely to interfere with binding to CXCR2, as the N-terminus of CXCR2 (chemokine-recognition site 1) binds the opposite side of the chemokine. (B) Expanded view of the boxed region in panel A showing important residues as sticks and numbered by residues present in the structure. The first conserved cysteine residue is shown as a sphere. The glutamate in the ELR motif is in a very similar position for both vCXCL1GT1 and CXCL8. This residue has been shown to be critical for the activation of CXCR2 and interacts with receptor residues R208, R212, and R278. (C) The top scoring model for vCXCL1GT5 is shown in cartoon form (blue) aligned to the structure of the CXCL8:CXCR2 complex. The β-hairpin is not predicted to interrupt site-1 binding in this model. (D) Expanded view of the boxed region in panel C showing important residues as sticks and numbered by residues present in the structure. The first conserved cysteine residue is shown as a sphere. vCXCL1GT5 does not contain an ELR motif, instead the five residues proceeding the cysteine are 5-EGNGR-9 (Glu5 shown in stick form). The longer N-terminus in vCXCL1GT5 is an unstructured loop in this model, which was generated without the receptor present. In this position, it is unlikely that Glu5 will make sufficient contact with the displayed receptor residues. During a binding event, the chemokine N-terminus may adopt a stable conformation, facilitated by Arg9, whereby Glu5 could participate in receptor activation. Alternatively, Asn7 may form ELR-like contacts sufficient to activate the receptor.

Alignment of vCXCL1GT1 and vCXCL1GT5 models with CXCL8 in the experimental CXCL8:CXCR2 complex.

(A) The top model (lowest Rosetta total score) for vCXCL1GT1 is shown in cartoon form (red) aligned to the structure of the CXCL8:CXCR2 complex (PDB: 6LFO). The extended C-terminus is unlikely to interfere with binding to CXCR2, as the N-terminus of CXCR2 (chemokine-recognition site 1) binds the opposite side of the chemokine. (B) Expanded view of the boxed region in panel A showing important residues as sticks and numbered by residues present in the structure. The first conserved cysteine residue is shown as a sphere. The glutamate in the ELR motif is in a very similar position for both vCXCL1GT1 and CXCL8. This residue has been shown to be critical for the activation of CXCR2 and interacts with receptor residues R208, R212, and R278. (C) The top scoring model for vCXCL1GT5 is shown in cartoon form (blue) aligned to the structure of the CXCL8:CXCR2 complex. The β-hairpin is not predicted to interrupt site-1 binding in this model. (D) Expanded view of the boxed region in panel C showing important residues as sticks and numbered by residues present in the structure. The first conserved cysteine residue is shown as a sphere. vCXCL1GT5 does not contain an ELR motif, instead the five residues proceeding the cysteine are 5-EGNGR-9 (Glu5 shown in stick form). The longer N-terminus in vCXCL1GT5 is an unstructured loop in this model, which was generated without the receptor present. In this position, it is unlikely that Glu5 will make sufficient contact with the displayed receptor residues. During a binding event, the chemokine N-terminus may adopt a stable conformation, facilitated by Arg9, whereby Glu5 could participate in receptor activation. Alternatively, Asn7 may form ELR-like contacts sufficient to activate the receptor. Demonstrating that some circulating HCMV strains encode a selective CXCR2 agonist instead of a CXCR1/CXCR2 dual agonist presents the question of how the virus can benefit from this receptor selectivity. Neutrophils are known to have high expression of both CXCR1 and CXCR2 [13] which HCMV exploits through vCXCL1 to attract, infect, and disseminate [6,9,12]. Others have proposed that the primary receptor for this action is CXCR2, as neutrophils migrate more effectively than CXCR1+ CXCR2- NK cells in response to vCXCL1GT2 [11]. Our data supports the latter theory, as no difference in the migration of neutrophils was observed between vCXCL1GT1 (targeting CXCR1 and CXCR2) and the CXCR2 selective vCXCL1GT5 (Fig 7). Additionally, this suggests that non-ELR vCXCL1 is a specific chemoattractant for neutrophils as its lack of CXCR1 activity would eliminate the unwanted attraction of CXCR1+ CXCR2- leukocytes such as CD8+ cytotoxic T-cells and NK cells and the subsequent killing of infected cells [13,54,55].

Why do circulating HCMV strains encode 14 different forms of the same protein?

A possible explanation to this conundrum is that each UL146 genotype has developed in smaller isolated human communities and that these HCMV strains later fed into larger populations because of migration and trade. However, if this was the case it is difficult to explain that the same phenomenon is not seen for other human viruses encoding chemokines, including Kaposi’s sarcoma-associated herpesvirus (KSHV), human herpesvirus 6 and 8 (HHV-6 and HHV-8), and the molluscum contagiosum virus [47-49,56-59]. Another possible explanation is that encoding several forms of the same immune modulator provides HCMV with the tools to successfully infect and establish infection in a broader variety of hosts, overcoming immunological bottlenecks (Fig 11). In that way the virus could ensure a large reservoir among humans with a diverse genetic and immunological makeup. This hypothesis can be investigated in different ways. Firstly, as in the present study by comparing variant vCXCL1 chemokines in biochemical/immunological assays, or by using in vivo models [12]. Secondly, by searching for associations between specific viral genotypes and CMV disease, which has the potential to show the effect of the gene variants if the lack of large sample sizes and controls groups are addressed. Lastly, by performing genome-wide association studies (GWAS) of human hosts infected with HCMV to identify host and viral gene variants associated with disease development.
Fig 11

Hypothetical model explaining the existence of 14 stable UL146 genotypes by bottlenecks in the genetic makeup of the host.

Unidentified bottlenecks in the host allowing only one or some of several possible UL146 genotypes among circulating HCMV strains to establish infection and disseminate in a given host. Small circles show which UL146 strains are able to pass the bottleneck. Note that i) different bottlenecks can allow infection from between one and 14 genotypes, and ii) a given host/HCMV strain pair can be the result of different bottlenecks (yellow virus on human that could potentially be infected by multiple different strains). Bottom left: examples of human proteins representing potential bottlenecks. Bottom right: examples of possible research strategies for identifying host bottlenecks.

Hypothetical model explaining the existence of 14 stable UL146 genotypes by bottlenecks in the genetic makeup of the host.

Unidentified bottlenecks in the host allowing only one or some of several possible UL146 genotypes among circulating HCMV strains to establish infection and disseminate in a given host. Small circles show which UL146 strains are able to pass the bottleneck. Note that i) different bottlenecks can allow infection from between one and 14 genotypes, and ii) a given host/HCMV strain pair can be the result of different bottlenecks (yellow virus on human that could potentially be infected by multiple different strains). Bottom left: examples of human proteins representing potential bottlenecks. Bottom right: examples of possible research strategies for identifying host bottlenecks. In conclusion, we here identify two non-ELR chemokines encoded by HCMV UL146 genotype 5 and 6 capable of activating CXCR2. Furthermore, we present evidence that the majority of the 14 genotypic vCXCL1 chemokines–in contrast to human chemokines—adopt a unique C-terminal β-hairpin, with the function of stabilizing the chemokine fold. Future structural and cell biological studies of the UL146 gene products are required to determine possible interaction partners of the C-terminal β-hairpin and unravel other functions of this unique group of highly diverse chemokines.

Materials and methods

Plasmids used in cell-biological assays

For all chemokine receptors used, the human wild type receptor cDNAs without tags were cloned into the expression vector pcDNA3.1(+) (Invitrogen). The following restriction sites were used for insertion: CXCR1, CXCR2, CXCR3, CXCR4, CXCR6, XCR1, CX3CR1, CCR2, CCR6 and CCR7 (HindIII-XhoI); CXCR5 and CCR5 (HindIII-BamHI); CCR1, CCR3, CCR4, CCR9 and CCR10 (EcoRI-XhoI); CCR8 (HindIII-EcoRI); US28 (EcoRI-NotI). All constructs were verified by restriction endonuclease digestion and DNA sequencing. The chimeric G protein GαΔ6qi4myr (Gqi4myr) inserted into pcDNA3.1(+) was kindly provided by Evi Kostenis (University of Bonn) [60]. The Rluc8-arrestin3-Sp1 and mem-citrine-SH3, GRK2, and GRK6 plasmids were kindly provided by Jonathan Javitch (Columbia University) [61]. Receptor expression was verified by a functional response, i.e. when transfected cells responded upon stimulation by a natural chemokine agonist of the expressed chemokine receptor (for details see Fig 4) while non-transfected cells showed no response to the same chemokine.

Chemokines

The human chemokines CCL1, CCL5, CCL7, CCL11, CCL17, CCL19, CCL20, CCL25, CCL27, CXCL8, CXCL11, CXCL12, CXCL13, CXCL16, and CX3CL1 were purchased from PeproTech, whereas XCL1 was purchased from R&D Systems. All chemokines were reconstituted in a buffer containing 0.1% (w/v) bovine serum albumin (BSA) and 1 mM acetic acid.

Cell lines and transfections

COS-7 and HEK293 cells (ATCC) were grown at 10% CO2 and 37°C in DMEM1885 supplemented with 10% (v/v) fetal bovine serum (FBS), 2 mM L-glutamine, 180 units/ml penicillin, and 45 μg/ml streptomycin. Transient transfection of COS-7 and HEK293 cells was performed by a chloroquine based calcium phosphate precipitation method, where DNA was diluted in TE buffer and CaCl2 was added to a concentration of 0.25 M. This mixture was then slowly mixed with an equal volume of 2x HEPES buffered saline (HBS) and incubated for 45 min at RT. After incubation, the DNA mixture was dripped directly onto the cells, and growth medium containing 60 μg/ml chloroquine was added. The transfection was stopped after 5 h by changing medium. CXCR1 (HindIII-EcoRI) and CXCR2 (HindIII-EcoRI) were inserted into the pTej vector [62] and transfected into the murine pre-B cell lines L1.2 by electroporation. Stable transfectants were obtained after limiting dilution and chemical selection with G418. CHO-K1 (ATCC) and stable L1.2 cells were grown at 5% CO2 and 37°C in RPMI 1640 supplemented with 10% (v/v) FBS, 2 mM GlutaMAX (Gibco), 180 units/ml penicillin and 45 μg/ml streptomycin. Transient transfection of CHO-K1 cells was performed by lipofection using Lipofectamine 2000 (Invitrogen) according to manufacturer instructions.

Eukaryotic expression and purification of UL146

For eukaryotic expression, the UL146 gene sequences from the Toledo strain (GenBank accession no. GU937742.2) and from the Davis strain (GenBank accession no. JX512198.1) were codon optimized by the JCat algorithm [27]. The genes were synthesized by GeneArt (Invitrogen) and inserted into the pcDNA3.1(+) expression vector (Invitrogen) using the BamHI and EcoRI restriction sites. A method previously described for MC148 and vCCL3 was applied with minor modifications [48,59]. COS-7 cells were seeded in T175 flasks at 2 x 106 cells per flask and transfected with UL146 or empty vector the following day. The day after transfection, growth medium was removed and cells were washed with PBS. 20 ml harvest medium was added (DMEM1880 with NaHCO3, 2 mM L-glutamine, 180 units/ml penicillin, and 45 μg/ml streptomycin) and cells were incubated at culturing conditions for 24 h. The medium was collected, centrifuged at 500 g for 20 min, and the supernatant was transferred to a clean container. Then the supernatant was adjusted to pH 4.5 and filtered through 0.22 μm PES filters (Corning) and the filtrate was diluted with Milli-Q water 1:1 to reduce ionic strength. Cation exchange columns were prepared by first adding 750 μl thoroughly mixed SP Sepharose FF resin two times, and each column was in turn washed with 5 ml Milli-Q water, 5 ml 1 M NaOH, and five times with 1 ml Milli-Q water or until achieving neutral pH of the pass-through. The columns were then washed with 5 ml 30% isopropanol and then five times with 1 ml Milli-Q water, before they were equilibrated two times with 5 ml 50 mM sodium acetate at pH 4.5. Afterwards, the diluted cell medium filtrate was loaded on the prepared cation exchange columns and allowed to pass before washing twice with 10 ml 50 mM sodium acetate. The bound protein was eluted by adding 1 ml 50 mM sodium acetate with 2 M NaCl at a time five times. This was repeated on the next day after allowing the cell cultures to recover for 5h with growth medium and then changing back to harvest medium. The eluate was adjusted to pH 4 in 0.1% triflouroacetic acid (TFA), filtered, and loaded on a Resource 15RPC 3 ml column (GE Healthcare) for reverse-phase HPLC on an ÄKTApurifier (GE Healthcare) and the protein was eluted with a gradient of CH3CN from 0.1% TFA in water. Purified chemokines were confirmed to elicit correct masses by matrix-assisted laser desorption-ionization time of flight (MALDI-TOF) analysis using an Autoflex II instrument (Bruker). All spectra were analyzed in the Bruker Daltonics flexAnalysis 2.2 software. Chemokines produced in eukaryotic cells were further confirmed by peptide mass fingerprint using trypsin digestion (Roche Applied Science) according to the manufacturer’s instructions. Removal of N-glycans from chemokines produced in eukaryotic cells was done using PNGase F treatment according to manufacturer’s instructions (Sigma-Aldrich). The following gene sequences were used for eukaryotic protein expression: Genotype 1 UL146 (Toledo strain) ATGCGGCTGATCTTCGGCGCCCTGATCATCTTCCTGGCCTACGTGTACCACTACGAAGTGAACGGCACCGAGCTGAGATGCCGGTGCCTGCACAGAAAGTGGCCCCCCAACAAGATCATCCTGGGCAACTACTGGCTGCACCGGGACCCTAGAGGCCCTGGCTGCGACAAGAACGAGCATCTGCTGTACCCCGACGGCCGGAAGCCTCCTGGACCTGGCGTGTGTCTGAGCCCCGATCACCTGTTCAGCAAGTGGCTGGACAAGCACAACGACAACCGGTGGTACAACGTGAACATCACCAAGAGCCCTGGCCCCAGACGGATCAACATCACCCTGATCGGCGTGCGGGGCTGA Genotype 5 UL146 (Davis strain) ATGCGGCTGATCTTCGGCCTGCTGATCATCTTCATCGTGACCGATACCTGCAACGGCGGCTTCGGCACAGAGGGCAACGGCAGATGTACCTGCATCGGCTACCACCGGCTGCTGGGCCAGCTGCCTAGAGGCACATTTTGGCTGGGACATCTGCCCCCTGGCAGCCACTGTCCTAAGGGCCAAGTGATGATCAAGATCGGCCAGGGCCCCATCGTGTGCCTGAGCGATTACCACCCCCTGAGCAAGTGGATGTACGGCAACCACAAGAGCGGCAGCGAGACATGGCTGCAGATCAAGATGGAAGGCCCCAGAAACGCCACCGTGGTGCAGCGGAGCAACACCAGACCTTGA

Prokaryotic expression and purification of UL146 –Protocol 1 (Copenhagen)

For prokaryotic expression, the sequences for the mature genotype 1, genotype 5 (1–97), genotype 5 (4–97), and genotype 5 (6–97) UL146 chemokines were codon-optimized for E. coli expression and synthesized by Integrated DNA Technologies, and inserted into the prokaryotic expression vector pET-21a(+) (provided by Mads Gravers Jeppesen from Synklino; www.Synklino.com)) using the restriction sites NdeI and HindIII. BL21 Star (DE3) pLysS OneShot competent cells (Invitrogen) were transformed with UL146 in the pET-21a(+) and cultured according to the manufacturer’s instructions at 37°C in lysogeny broth (LB) medium with added 100 μg/mL ampicillin and 25 μg/mL chloramphenicol. A single colony was picked and inoculated in 5–200 mL of LB medium and grown overnight at 37°C. The next morning, the culture was diluted 1:100 in LB medium and grown at 37°C until an optical density of 0.8 at 600 nm wavelength was achieved, measured on a NanoDrop 2000c Spectrophotometer (Thermo Fisher). Protein expression was induced by adding 0.5 mM isopropyl-D-1-thiogalactopyranoside (IPTG), and after 3 hours of post induction growth, the cells were collected by centrifugation for 30 min at 5000 g. The supernatant was removed and the cell pellet was either used immediately or flash-frozen with liquid nitrogen and stored at -80°C. The cells were ruptured by sonication with 20 s on and off pulses at 40% amplitude for 3 min using the Misonix Ultrasonic Liquid Processor The Sonicator 4000 with a 4.8 mm tip diameter in the following buffer: 50 mM trisaminomethane (Tris)-HCl pH 8, 100 mM NaCl, 5 mM EDTA, 10 mM MgCl2, 2 mM dithiothreitol (DTT), 1 mM phenylmethane sulfonyl fluoride. The suspension was centrifuged for 30 min at 15000 g, the supernatant was discarded and the pellet was resuspended and washed 4–8 times with 50 mM Tris-HCl pH 8, 300 mM NaCl, 0.1% Triton X-114, and 5 mM DTT. Then, 20 mL of denaturation buffer (3 M Guanidinium chloride (GdmCl), 100 mM Tris-Cl pH 8, 5 mM EDTA, and 5 mM DTT) per 1 g of pellet was added to solubilize the inclusion bodies, followed by 1 h incubation at RT and centrifugation for 30 min at 15000 g. The inclusion bodies were dialyzed at 4°C against 0.5x PBS (pH 6.5) containing 0.2 mM cystine and 1 mM cysteine overnight and then again for 3 h. The protein sample was centrifuged for 30 min at 5000 g, filtered through 0.22 μm filters, and loaded onto a 1–15 mL HiTrap SP FF column equilibrated in buffer A (50 mM PBS pH 6.5) and cation exchange chromatography was performed using the ÄKTA Pure (GE Healthcare) FPLC instrument. The bound protein was eluted either by a linear gradient 0–100% over 20 column volume of buffer B (50 mM PBS pH 6.5, 1 M NaCl). The fractions with the protein of interest were concentrated with a Vivaspin 20 5000 MWCO PES ultrafiltration unit (Sartorius) by manufacturer’s instructions, and afterwards loaded onto a size-exclusion chromatography (SEC) XK16/600 Superdex 75PG column, equilibrated in 1x PBS with adjusted pH to 6.5. The fractions with the protein of interest were concentrated by ultrafiltration, and concentrations were quantified by measuring the absorption at 280 nm wavelength with the NanoDrop 2000c Spectrophotometer. SDS-PAGE, coomassie staining, densitometry, and endoxtoxin level measurements were carried out by standard protocols for quality control. The samples were aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C for further use. Purified chemokines were confirmed to elicit correct masses by matrix-assisted laser desorption-ionization time of flight (MALDI-TOF) similarly to for the eukaryotic protein expression. The identities of the purified chemokines were furthermore confirmed by peptide mass fingerprint using LysC digestion (Roche Applied Science) according to the manufacturer’s instructions. The following gene sequences were used for expression in protocol 1: Genotype 1 UL146 (Toledo strain) ATGACGGAACTTCGTTGCCGTTGCCTTCACCGCAAATGGCCGCCAAACAAAATTATCTTGGGTAACTACTGGTTGCATCGCGACCCACGCGGACCTGGCTGCGATAAGAATGAACACTTATTATACCCGGACGGGCGCAAACCCCCAGGCCCTGGGGTGTGCTTATCACCAGATCATTTGTTTTCCAAGTGGCTGGACAAACACAATGACAACCGCTGGTATAACGTCAACATCACGAAATCTCCTGGTCCACGTCGTATTAACATCACACTTATCGGGGTGCGCGGCTAA Genotype 5 UL146 (Davis strain, 1–97) ATGGGATTCGGAACTGAGGGTAACGGTCGCTGTACCTGTATTGGGTACCACCGCCTGCTTGGTCAGCTTCCTCGCGGAACCTTCTGGTTAGGCCACCTTCCGCCAGGGTCCCACTGTCCGAAGGGCCAGGTGATGATTAAGATCGGTCAAGGCCCCATCGTTTGCTTGTCCGATTATCACCCTTTGAGTAAATGGATGTATGGGAACCACAAGAGCGGATCTGAAACGTGGTTGCAGATTAAGATGGAAGGACCGCGCAACGCCACTGTGGTGCAACGTTCTAATACACGTCCGTAA Genotype 5 UL146 (4–97) ATGACTGAGGGTAACGGTCGCTGTACCTGTATTGGGTACCACCGCCTGCTTGGTCAGCTTCCTCGCGGAACCTTCTGGTTAGGCCACCTTCCGCCAGGGTCCCACTGTCCGAAGGGCCAGGTGATGATTAAGATCGGTCAAGGCCCCATCGTTTGCTTGTCCGATTATCACCCTTTGAGTAAATGGATGTATGGGAACCACAAGAGCGGATCTGAAACGTGGTTGCAGATTAAGATGGAAGGACCGCGCAACGCCACTGTGGTGCAACGTTCTAATACACGTCCGTAA Genotype 5 UL146 (6–97) ATGGGTAACGGTCGCTGTACCTGTATTGGGTACCACCGCCTGCTTGGTCAGCTTCCTCGCGGAACCTTCTGGTTAGGCCACCTTCCGCCAGGGTCCCACTGTCCGAAGGGCCAGGTGATGATTAAGATCGGTCAAGGCCCCATCGTTTGCTTGTCCGATTATCACCCTTTGAGTAAATGGATGTATGGGAACCACAAGAGCGGATCTGAAACGTGGTTGCAGATTAAGATGGAAGGACCGCGCAACGCCACTGTGGTGCAACGTTCTAATACACGTCCGTAA

Prokaryotic expression and purification of UL146 –Protocol 2 (Wisconsin)

Sequences of vCXCL1 genotypes 1, 4, 5, and 6 were codon-optimized for E. coli expression and ordered from GenScript. Constructs were cloned into a pET28a-6xHis-SUMO3 vector and expressed in BL21 DE3 E.coli. Cells were expressed at 37°C in LB medium and induced with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) at an OD600 of 0.6. Cultures continued to grow for 5 and a half hours before bacteria were pelleted by centrifugation and stored at -20°C. For uniform labeling with 15N, cells were grown in M9 media containing 15N-ammonium chloride as the sole nitrogen source. Bacterial pellets were resuspended in ~20 mL of Buffer A (50 mM Na2PO4 (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1 mM phenylmethylsulphonyl fluoride (PMSF), and 0.1% (v/v) 2-mercaptoethanol (BME)) per pellet and lysed via sonication. Lysed cells were clarified at 15,000 x g and the supernatant was discarded. Pellets were resuspended by sonication in ~20 mL of Buffer AD (6 M guanidinium, 50 mM Na2PO4 (pH 8.0), 300 mM NaCl, 10 mM imidazole) and spun down at 18,000 x g for 20 min. Using an AKTA-Start system (GE Healthcare), supernatant was loaded onto a Ni-NTA column equilibrated in Buffer AD. The column was washed with Buffer AD, and proteins were eluted using Buffer BD (6 M guanidinium, 50 mM sodium acetate (pH 4.5), 300 mM NaCl, and 10 mM imidazole). Proteins were refolded overnight via drop-wise dilution into a 12-fold greater volume of Refold Buffer (50 mM Tris (pH 7.6), 50 mM NaCl) with the addition of 20 mM cysteine, and 0.5 mM cystine. Refolded protein was concentrated in an Amicon Stirred Cell concentrator (Millipore Sigma) using a 10 kDa membrane. Concentrated protein was added to 3.5 kDa dialysis tubing with the addition of ULP1 to cleave the N-terminal 6xHis-SUMO3-tag and dialyzed at 25°C against Refold Buffer overnight. The AKTA-Start system was used to load cleaved proteins onto a SP FastFlow cation exchange column equilibrated in Refold Buffer. The column was washed with Refold Buffer, and proteins were eluted using Elution Buffer (50 mM Tris (pH 7.6), 1 M NaCl). vCXCL1 proteins were separated from reduced or aggregated species by reversed-phase high performance liquid chromatography, lyophilized, and stored at -80°C for further use. Purity and identity of all proteins were confirmed by electrospray ionization mass spectrometry using a Thermo LTQ instrument, and SDS-PAGE with Coomassie staining. Recombinant proteins of vCXCL1GT1 and vCXCL1GT5 were produced by both protocol 1 and 2, and when compared, they activated G proteins through CXCR1 and CXCR2 to exactly the same extent in the IP3 accumulation assay. The following gene sequences were used for expression in protocol 2: Genotype 1 UL146 (Toledo strain, 1–95) ACAGAACTACGATGTAGATGCTTACACAGGAAGTGGCCGCCCAACAAAATTATTCTGGGTAATTATTGGCTGCATCGTGATCCGCGTGGCCCAGGCTGCGACAAGAACGAACATCTTCTCTACCCGGACGGCCGCAAACCGCCGGGCCCGGGCGTGTGCTTGTCGCCGGACCACTTGTTTAGCAAGTGGCTGGATAAGCATAACGATAATCGTTGGTATAACGTAAATATCACCAAGAGCCCGGGTCCGCGCCGTATTAACATCACCCTGATCGGTGTCCGTGGT Genotype 1 UL146 (1–71) ACAGAACTACGATGTAGATGCTTACACAGGAAGTGGCCGCCCAACAAAATTATTCTGGGTAATTATTGGCTGCATCGTGATCCGCGTGGCCCAGGCTGCGACAAGAACGAACATCTTCTCTACCCGGACGGCCGCAAACCGCCGGGCCCGGGCGTGTGCTTGTCGCCGGACCACTTGTTTAGCAAGTGGCTGGATAAGCATAACGATAATCGT Genotype 4 UL146 (NT strain) ACCGAGCTGCGTTGCAAATGCGCAGGTGGCCAAAGCTGGCATCCGAGAGGCAAGTGGCCAACCAAACATCATTGGTTGGAGTGCTACCCGCCGAGTGGAAACTGTCCGGCGGGCGAATTGCTGATTTATTTCGAGGAACACAACTGGAGCCCGAAGTGCGTTCATGTTCACAATCCGTTTGGCCAAAAATTCATGAGCAAGTGCGATAAACACGAATGGTTCGAGGTTACCTTCAACAGCACTCGTAAGTACCCGATGATCACCCGCAAGGGCTCGACCAAACCGACCTTCAGCTCCGGCAAA Genotype 5 UL146 (Davis strain) GGTTTTGGCACTGAGGGCAACGGCCGTTGCACGTGCATTGGCTACCACCGCCTGTTAGGTCAACTGCCGCGGGGTACTTTCTGGCTCGGCCATCTGCCGCCAGGTAGCCATTGCCCGAAAGGTCAAGTTATGATCAAGATCGGTCAAGGTCCGATTGTGTGCTTGTCCGACTACCACCCGTTGTCTAAGTGGATGTACGGCAACCACAAAAGCGGCAGCGAAACCTGGCTGCAAATCAAAATGGAAGGTCCTAGAAATGCTACCGTGGTGCAGCGTAGCAATACGCGTCCG Genotype 6 UL146 (ML1 strain) GGTCTGGGTAGCGAGGGGAACGGTCGTTGTACCTGTGTCGGTTATCACCGTTTTGATAAGCAGCTGCCACGCGGTACGATCTGGCTGGGTCACCGCCCTCCGGGCCCACACTGTCCGCGCGGTGACGTTCTGATGAAACTGGGTGAACAGCCGACGGTGTGTTTGAGCGACCACCACCCACTGTCCAAATGGATGTATCGTCATCACGGCTCCGACACCGAAATCTGGTTCCAGATTGAGTTTAAAGGTCCGCAGAATACCAAGGTGGTTTCTAAGTCCTTTACCCCGCCGTCA

Nuclear magnetic resonance (NMR)

NMR experiments were performed on a Bruker DRX 600 equipped with a 1H/15N/13C cryoprobe and a SampleJet robot for automated NMR screening of compounds in 96-well sample racks. NMR samples contained 90% H20, 10% D20, and 0.02% NaN3, with 25 mM D13 2-ethanesulfonic acid (MES) at pH 6.8. 1H, 15N, and 13C resonance assignments for vCXCL1GT1 were obtained at 25°C using the following experiments: 15N-1H HSQC [63] 3D HNCA [64,65] 3D HNCO [64,66], 3D HN(CO)CA [64], 3D HNCACB, 3D HN(CA)CO, 3D HCCONH, 3D SE C(CO)NH [67], and 3D HCCH TOCSY [68]. NMR data were processed with NMRPipe [69] and XEASY [70] was used for resonance assignments and analysis of spectra. Backbone φ and ψ dihedral angle constraints and chemical shift guided predictions of secondary structure were generated from shifts of the 1H, 13Cα, 13Cβ, 13C′, and 15N nuclei using the program TALOS+ [31]. Heteronuclear NOE values were measured from an interleaved pair of two-dimensional 15N-1H sensitivity-enhanced correlation spectra recorded with and without a 5-second proton saturation period.

Thermal denaturation

50 μM of purified vCXCL1GT1 and vCXCL1GT1(1–71) in 50 mM MES, pH 6.8 were analyzed using nanoDSF on the Nanotemper Prometheus NT.48. Protein samples and a buffer control were placed in triplicate into single use standard capillaries and heated from 20–95°C with a heating rate of 0.5°C/min. Samples were excited at 280 nm and the F350:F330 ratio was monitored during the run to determine an apparent melting temperature (Tm) for each sample.

Inositol phosphate (IP) accumulation scintillation proximity assay (SPA)

COS-7 cells were co-transfected with receptor cDNA and the chimeric G protein Gqi4myr, which converts a Gαi signal into a Gαq readout [71,72]. One day after transfection, the cells were seeded in 96-well plates (3.5 x 104 cells per well) and incubated with 2 μCi/ml of myo-[3H]-inositol in 100 μl of growth medium for 24 h. Cells were then washed with Hanks’ buffered salt solution (HBSS) and incubated at 37°C for 15 min in 100 μl of HBSS supplemented with 10 mM LiCl. Afterwards, ligands were added and the cells were incubated for 90 min at 37°C. When used, antagonists were added 10 min prior to the agonist. After incubation, the plates were put on ice and the medium was removed by aspiration. The cells were then lysed for 30 min by addition of 40 μl 10 mM formic acid per well, and 35 μl lysate from each well was transferred to a clean 96-well plate. Then 80 μl of a 12.5 mg/mL poly-lysine-coated yttrium silicate SPA bead suspension (Perkin-Elmer) was added to each well. The plates were sealed and incubated for 15 min at RT while shaking at medium speed followed by 5 min of centrifugation at 500 g. The SPA beads were allowed to react with the [3H]-inositol phosphate lysate for 8 h and signal was determined on a TopCount NXT Microplate Scintillation and Luminescence Counter (Perkin Elmer). Measurements were made in duplicate.

Bioluminescence resonance energy transfer (BRET) β-arrestin recruitment assay

HEK293 cells were seeded in 6-well plates (6 x 105 cells per well) and co-transfected with chemokine receptor, Rluc8-arrestin3-Sp1, mem-linker-citrine-SH3, and either GRK2 or GRK6 when used. The growth medium was replaced one day after transfection. Two days after transfection, growth medium was removed by aspiration and the cells were washed with PBS supplemented with 5 mM glucose at RT. Cells were then resuspended in 3 ml PBS supplemented with 5 mM glucose per well, and 85 μl of the suspension was transferred to a 96-well black/white isoplate (Perkin Elmer) for each point. The plate was shielded from incoming light and 10 μl 50 μM coelenterazine was added to each well. After 5 min, 5 μl of ligand was added to each well and the plate was incubated at RT for 45 min in the dark. Following incubation, BRET was measured as the ratio between eYFP emission at 525 nm and Rluc emission at 485 nm using a Mithras LB 940 Multimode Microplate Reader (Berthold). Measurements were made in duplicate.

Isolation of human peripheral blood neutrophils (PBNs)

Venous blood was drawn from a healthy adult donor, collected in EDTA tubes, and mixed by inverting the tubes a few times. The mixture was transferred to clean tube and 2% dextran sulphate in a 0.9% NaCl solution was added to the blood 1:1 (v/v), and the blood was left to sediment for 15 min at RT. All remaining steps were performed on ice/at 4°C. After sedimentation, the upper phase was transferred to a clean tube and centrifuged for 10 min at 200 g, the supernatant was discarded and the pellet loosened by a quick vortexing. The pellet was resuspended in 30 ml 0.9% NaCl, vortexed, and was underlaid with 15 ml Lymphoprep (STEMCELL Technologies) and centrifuged for 30 min at 400 g. The supernatant was discarded, and within the next 30 sec, 10 ml sterile H2O was added while carefully mixing followed by 10 ml 1.8% NaCl, and the mixture was centrifuged for 6 min at 200 g. The supernatant was discarded and the pellet was visually assessed, if red, the previous lysis step was redone. If the pellet was white, it was resuspended in 5 ml 0.9% NaCl and cells were counted on a Chemometec NucleoCounter NC-3000 with the NucleoView software according to manufacturer’s instructions.

Transwell migration assay

Isolated PBNs were centrifuged for 5 min at 400 g, the supernatant was discarded and the cells were resuspended to a density of 2 x 106 cells/ml in sterile filtered RPMI1640 medium supplemented with 0.5% BSA (w/v). In a 3 μm pore size Corning HTS transwell 96-well plate (CLS3385, SIGMA), 220 μl chemokine ligand in RPMI1640 + 0.5% BSA was added to the bottom chamber of each transwell and 75 μl of the PMN suspension (150,000 cells/well) was added the upper chamber, mixing the cell suspension gently each time before pipetting. The plate was incubated for 1.5 h at 37°C and 5% CO2. For stably transfected L1.2 cells, 75 μl cell suspension containing 150,000 cells in RPMI1640 + 0.5% BSA medium were added per well and incubated for 4 h at 37°C and 5% CO2. After incubation, the membrane support was removed, plates were covered with a TopSeal-A PLUS (Perkin-Elmer) and centrifuged for 3 min at 300 g. 115 μl medium was carefully removed from each well to avoid disturbing the cell bed. The migrated cells well were resuspended by gently pipetting up and down a few times, and 100 μl was transferred to a white 96-well plate with two wells spacing between each point to avoid cross-luminescence. Light exposure was minimized and 100 μl CellTiter-Glo reagent (Promega) was added to each well. The plates were covered with TopSeal-A PLUS (Perkin-Elmer) and aluminum foil and mixed on a plate shaker for 2 min at low speed. Afterwards, the plates were incubated for 10 min at RT and luminescence was measured on an EnVision 2105 Multimode Plate Reader (Perkin-Elmer). Measurements were made in duplicate. For L1.2 cells, a standard curve was made of known cell counts and linear regression was performed to quantify the number of migrated cells.

Rosetta comparative modeling

Rosetta comparative modeling was used to generate 5000 models for each genotype of the UL146-encoded chemokines. Representative genotype sequences corresponding to the Dolan-Davison classification [7] were acquired from the following HCMV strains and GenBank deposits: GT1 (Toledo, GU937742.2); GT2 (Merlin, AY446894.2); GT3 (KSG, AY446889.1); GT4 (NT, GQ222016); GT5 (Davis, JX512198); GT6 (ML1, AY446880); GT7 (Towne, FJ616285); GT8 (TB40, AY446866); GT9 (FS, AY446877); GT10 (AL, GQ222015); GT11 (PAV11, KJ361965.1); GT12 (6397, JX512197.1); GT13 (KM, AY446893); GT14 (RK, AY446885). Structures of CXCL2 (3N52), CXCL5 (2MGS), and CXCL8 (5WDZ) were retrieved from the Protein Data Bank (PDB) and used as templates after isolating a single chemokine chain. Target sequences were threaded onto the input templates and hybridized to construct each model, which were subsequently relaxed using the ref2015 energy function. The two disulfide bridges in canonical chemokines were defined and incorporated into model construction. Output models were evaluated using total Rosetta score and the top 10 were visually inspected. These top models were evaluated for secondary structure and similarity using root-mean-square deviation of Cα atoms. Images of protein structure were generated using PyMOL.

Alignment showing the exact location of CXCL8 and vCXCL1 secondary structures.

The secondary structures of CXCL8 and vCXCL1GT1-14 are shown in light blue (β-strands) and red (α-helices) as determined by NMR and X-ray structures for CXCL8 [22-24] and by Rosetta modelling for vCXCL1GT1-GT14. (PDF) Click here for additional data file.

Peptide mass fingerprint of vCXCL1GT1 and vCXCL1GT5 expressed in eukaryotic cells.

Samples of vCXCL1GT1 (A) and vCXCL1GT5 (B) were digested with trypsin followed by mass spectroscopy. (PDF) Click here for additional data file.

Top models for each UL146 genotype by Rosetta.

(A) The top model (lowest Rosetta total score) is shown in an overlay for each genotype with the extended C-termini hidden for clarity. The average Cα-RMSD of core residues is 3.6 Å. All models adopt the canonical chemokine core structure. (B) The top models for each genotype are displayed individually. Each C-terminus forms a β-hairpin except for vCXCL1GT3, vCXCL1GT13, and vCXCL1GT14. (PDF) Click here for additional data file.

Comparison of HCMV encoded vCXCL1s and human chemokines with extended C-termini.

Left side comparison of wild-type vCXCL1s and long tailed human chemokines on secondary core structure and sequence, basic content and secondary structure of the C-terminus. Right side comparison of tailless wild-type vCXCL1s and tailless human chemokines with extended C-termini on secondary core structure and function. (XLSX) Click here for additional data file. 14 Jul 2021 Dear Dr. Luttichau, Thank you very much for submitting your manuscript "The non-ELR CXC chemokine encoded by human cytomegalovirus UL146 genotype 5 contains a predicted C-terminal β-hairpin and induces neutrophil migration as a selective CXCR2 agonist" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. While the reviewers appreciate the quality of the work, the feel that, as presented, it is only an incremental advance over previous publications. They suggest that novelty and significance could be added by more attention to the C-terminus, and by some additional modeling. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Robert F. Kalejta Associate Editor PLOS Pathogens Shou-Jiang Gao Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** While the reviewers appreciate the quality of the work, the feel that, as presented, it is only an incremental advance over previous publications. They suggest that novelty and significance could be added by more attention to the C-terminus, and by some additional modeling. Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship. Reviewer #1: The manuscript by Luttichau is a well written and comprehensive analysis of the various chemokines expressed by human cytomegalovirus (HCMV). The UL146 gene exhibits a high degree of genetic diversity based on sequencing of various clinical and laboratory virus strains. The authors provide a detailed evaluation of the sequence and structure, focusing on two variants, designated vCXCL1GT1 and vCXCL1GT2. In addition, functional analysis was performed using a variety of signaling assays, which is a strength of the study. Signaling assays included IP accumulation, beta arrestin recruitment, and cell migration. Overall, the work is soundly presented and well controlled, and the results provide an important contribution to the literature by illustrating how subtle differences in sequence and structure can be accompanied by significant changes in function and downstream signaling. Reviewer #2: This manuscript describes the unique folding in the COOH terminus of the viral chemokines from HCMV (i.e., in the title), however the majority of the paper is about the longer/shorter versions of the amino terminus. There are interesting findings such that the non ELR motif (i.e., NGR instead of ELR) in genotype GT5 (although GT6 as well) could stimulate CXCR2 and b arrestin signaling. Also the finding that the longer amino terminus led to more activation (usually additions to the NH2 leads to less activation/antagonism such as the case with CCL5). The additional finding of this paper is that it “confirmed” the potential glycosylations via MALDI TOF. The major flaws of this manuscripts are: 1) In order to address the role of the COOH on function there should have been experiments that truncated/swapped the different COOH termini. Instead it includes only modeling of the COOH. It’s possible that this longer COOH could function only in vivo as part of the GAG binding to establish the chemotactic gradient, which may not be detectable in vitro. 2) The novelty of this manuscript is lessened in that it is similar to the studies completed by Heo et al which used full length UL146 ORF expressed in baculovirus from 11 different genotypes (including what was called TX15 with an NGR motif). This manuscript really only addressed a single viral chemokine (GT5) while GT6 has a similar non ELR motif. This is another flaw in this manuscript. In the Heo manuscript they did not find that NRG vCXCL1 proteins activation of b arrestin or G protiens but did see some slight activation via calcium flux and upregulation of adhesion proteins. This contradicts the findings of this paper but, as the authors pointed out, it could be due to differences in the NH2 from baculovirus vs the ones tested in this paper. It would have been nice to see a comparison between TX15 from that paper and GT5 and GT6. 3) Another flaw is that this group used the bacterially expressed GT5 proteins in its functional assays (i.e., with a predetermined NH2 terminus and no glycosylations). Although their findings that the different NH2 termini length (i.e., longer functions better) is important, it would have been interesting to see whether this holds true for the other genotypes such as GT6 or the other GT with ambiguous signal cleavage sequences. Minor points: 1) In Fig. 7 is that the GT5 (1-97)? That needs to be clarified. 2) In Fig. 7, it’s interesting that you show different bell shaped curves for the CXCR2 transfectants but similar ones with the neutrophils. That should be explored/explained. 3) Fig. 8, 9 are modeling but would be necessary to prove it with actual experiments to confirm the modeling. Reviewer #3: Human cytomegalovirus (HCMV) encodes multiple chemokine and chemokine receptor-like genes that have been shown to be functionally active. The UL146 gene is highly diverse among sequenced clinical isolates, which suggests that this CXC chemokine is either prone to sequence evolution and/or is genetically responding to environmental pressures. Previously, the genotype GT5 (Tx15 – Heo J. Immuno 2015) has been shown to express a CXCR2 selective chemokine. The current manuscript further characterizes GT5 by determining the N’terminus by proteomics, which revealed that the full-length protein aa1-97 is the most active form, which was different than the previous report from 2015. Structural modeling predicts the extended C’terminus to encode a �  -hairpin. The paper describes their results of GT5 in binding, receptor usage, GRK activation, and cellular migration. All of these assays are well done and the results are accurately described in the well written manuscript. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions. Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: (No Response) Reviewer #2: (No Response) Reviewer #3: The manuscript functionally determined and evaluated the N’terminus for GT5 identifying the most active form. The requirement and function of the C’terminal region is still unknown. The C’terminal region contains a number of basic residues which could implicate it in protein interactions. Using the assays described in this manuscript, analysis of a vCXCL1 mutant containing deletion of the C’terminal domain to mimic IL-8 or other mutations would have been informative and add to the overall impact of the manuscript. Is this region required for binding and activity or does it play an additional, yet to be defined role? The utility of CXCR2 but not CXCR1 by UL146 GT5 is interesting and previously shown by Heo et al. In Figure 9, the authors have aligned GT1 and GT5 with IL8/CXCR2 and suggest that there are contacts R278/R208 and R212 that may allow non-ELR contacts. But what makes CXCR1 so different? Comparative modeling for CXCR1 and CXCR2 may provide insight into this unique feature especially if the structures for GT1 and GT5 are added to this analysis. Similarly, could the amino acid differences between GT1 and GT5 be used as a roadmap to identify the specific differences necessary for the effects of differential binding of CXCR1/2? The authors pose the question about why there are 14 different known variants of UL146. In Figure 10 and in the discussion the authors provide their explanation about why HCMV encodes at least 14 different genotypes for UL146. The human sequence variation for CXCR1 and 2 is very minimal, thus host variation in CXCR1 and CXCR2 probably does not account for the driving evolutionary changes in UL146. In fact, while basic motifs are shared there is quite a bit of difference between the different genotypes of UL146. In light of this, does the suggest that the protein may be doing something else or that the minor changes are important for alterations in signaling through these receptors? A more in-depth characterization of this is really necessary to try and pick apart whether UL146 is an evolutionarily active hotspot or whether the genetic variation is/was required for viral success in the human population. Do any of the other UL146 mutants display the same GT5 phenotype with binding CXCR2 and not 1? How about GT6? GT7 through GT14 contain a four amino acid deletion in the N’loop region, which is typically involved in receptor binding, this might also be an interesting group to assess receptor usage. ********** Part III – Minor Issues: Editorial and Data Presentation Modifications Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. Reviewer #1: 1. Line 60 refers to UL146 as a cytokine, whereas the title and majority of the manuscript use the term cytokine. While a chemokine is a type of cytokine, this term seems unnecessarily confusing and inconsistent here. 2. Introduction lines 74-76 – references should be provided 3. Figure 1 - clarify what black and gray shading represent 4. Fig 2 – suggest including small schematic to depict differences between two chemokine (glycosylation sites and additional 9 peptides) 5. Line 226 – “roughly half” – give exact numbers 6. Line 438 – clarify what PDB: 6LFO means 7. Line 731 – clarify cell number Reviewer #2: (No Response) Reviewer #3: See above ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at . Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols 27 Dec 2021 Submitted filename: 211226 vCXCL1 Response to reviewers.docx Click here for additional data file. 23 Jan 2022 Dear Dr. Luttichau, Thank you very much for submitting your manuscript "The non-ELR CXC chemokine encoded by human cytomegalovirus UL146 genotype 5 contains a C-terminal β-hairpin and induces neutrophil migration as a selective CXCR2 agonist" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations. The reviewers found your manuscript much improved. They suggest some edits to the text, which I think are appropriate. One of the reviewers asks for some experiments that, to me, do not appear to be essential, though including them (if the data were available) would round out the manuscript. Make sure you submit a rebuttal with your responses to all the reviewers' comments, especially why you did or did not choose to include the requested experiments. Your re-submitted manuscript will undergo rapid review. Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Robert F. Kalejta Associate Editor PLOS Pathogens Shou-Jiang Gao Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** The reviewers found your manuscript much improved. They suggest some edits to the text, which I think are appropriate. One of the reviewers asks for some experiments that, to me, do not appear to be essential, though including them (if the data were available) would round out the manuscript. Make sure you submit a rebuttal with your responses to all the reviewers' comments, especially why you did or did not choose to include the requested experiments. Your re-submitted manuscript will undergo rapid review. Reviewer Comments (if any, and for reference): Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship. Reviewer #1: The manuscript by Berg et al describes comprehensive analysis of the UL146 isotype vCXCL1-GTA5, which lacks the classic ELR motif in the N-terminus. The authors convincingly show that vCXCL1-GTA is a elective agonist for CXCR2 only, not CXCR1 as other isotypes of vCXCL1, such as GT1, using multiple readouts that include IP accumulation, beta-arrestin recruitment, and neutrophil migration. The authors were responsive to the previous reviewer comments and the overall article is suitable for publication. Reviewer #2: In this revised manuscript, the authors have been responsive to the many of the previous reviews by adding several new experiments, including vCXCL1tailless, a C terminal truncation, and an additional NRG motif (vCXCL1GT6). These important controls make this a much more robust study. In this process they have show another NRG vCXCL1 can stimulate CXCR2 and that with out the COOH tail, the protein miss folds. That is a very interesting finding. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions. Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: (No Response) Reviewer #2: Below are some important experiments that would make this manuscript more complete: 1) The addition of MALDI data on the three new proteins in this submission vCXCL1GT4, vCXCL1GT6, and vCXCL1GT1Tailless to show the proper size and (potential) glycosylations (i.e., vCXCL1GT4 is O linked, Tailless vCXCL1GT1, vCXCL1GT5 is N linked, vCXCL1GT6 is non-glycosylated). This would expand out the Fig. 2. 2) For completion /understanding whether there are differences in b arrestin signaling (Fig. 6) and migration (Fig. 7). They show b arrestin and activation with GT1, 5, but needs GT4, 6 in Fig. 6 in Fig. 7. Who knows how well these other viral chemokines affect this signaling. Could it be biased agonism? 3) There needs to be an analysis in the discussion about their findings with tailless vCXCL1GT1 since this is a novel finding. Are there any other chemokine examples where and truncations in the C terminus affected function and/or folding? ********** Part III – Minor Issues: Editorial and Data Presentation Modifications Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. Reviewer #1: Key words – consider ELR motif instead of ELR Pg 49, lines 737-742 It’s a lot of work to clone all and express all the chemokine receptors. Was this reported elsewhere that can be cited here? Also, was there a myc/His or similar tag on the receptor to verify expression? The ligand responses are convincing, but it seems like at least commenting on how receptor expression was verified would be helpful. Pg. 61, lines 1023 and 1026 -cell number is listed as 150.000 – us a comma or scientific notation (150,000 or 1.5 x 10^5), this is confusing as written Reviewer #2: These statements are not true: a. Line 101 “A non-ELR CXC chemokine activates CXCR2 and adopts a unique �  -hairpin have been observed for several UL146 genotypes [10], but, apart from genotype 1, the 13 104 remaining genotypes are yet to be characterized in detail.” This is exactly what reference 10 did in that manuscript. b. Line 324 “Previous studies have demonstrated an effect of vCXCL1GT1 on G protein signaling, but as other pathways have not been investigated”. Again reference 10 looked at signaling of the different viral chemokines including b arrestin signaling. c. In the discussion: Line 603: “Secondly, by searching for associations between specific viral genotypes and CMV disease, which has the potential to show the effect of the gene variants. Lastly, by performing genome-wide association studies (GWAS) of human hosts infected with HCMV to identify host and viral gene variants associated with disease development.” This statements (and Fig. 11) need to be modified to reflect the literature. UL146 variation has been addressed in both congenital infections (Bale and Demmler publications) and transplantation (Hassan Walker publication) settings so this statement should be modified. They were not able to connect any specific UL146 sequences with specific outcomes. Also, there is very little variability in human CXCR1 and CXCR2 (as mentioned by the previous reviewer) so it is not correct that viral gene variants would develop to infect different “populations” of humans more efficiently. These statements should be modified. d. Line 331: “For CXCR2, both vCXCL1GT5 and vCXCL1GT5 stimulated β-arrestin recruitment at comparable efficacies to CXCL8 but with ~10-fold lower potencies (Fig 6D–F)” Should read both “vCXCL1GT1 and vCXCL1GT5“ ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols References: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. 7 Feb 2022 Submitted filename: 220207 Answer to reviewers second round.docx Click here for additional data file. 9 Feb 2022 Dear Dr. Luttichau, We are pleased to inform you that your manuscript 'The non-ELR CXC chemokine encoded by human cytomegalovirus UL146 genotype 5 contains a C-terminal β-hairpin and induces neutrophil migration as a selective CXCR2 agonist' has been provisionally accepted for publication in PLOS Pathogens. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Robert F. Kalejta Associate Editor PLOS Pathogens Shou-Jiang Gao Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************************************************** Reviewer Comments (if any, and for reference): 4 Mar 2022 Dear Dr. Lüttichau, We are delighted to inform you that your manuscript, "The non-ELR CXC chemokine encoded by human cytomegalovirus UL146 genotype 5 contains a C-terminal β-hairpin and induces neutrophil migration as a selective CXCR2 agonist," has been formally accepted for publication in PLOS Pathogens. We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064
  66 in total

1.  Chemical synthesis of lymphotactin: a glycosylated chemokine with a C-terminal mucin-like domain.

Authors:  L A Marcaurelle; L S Mizoue; J Wilken; L Oldham; S B Kent; T M Handel; C R Bertozzi
Journal:  Chemistry       Date:  2001-03-02       Impact factor: 5.236

Review 2.  Virus-encoded chemokine receptors--putative novel antiviral drug targets.

Authors:  Mette M Rosenkilde
Journal:  Neuropharmacology       Date:  2005-01       Impact factor: 5.250

3.  High-throughput analysis of human cytomegalovirus genome diversity highlights the widespread occurrence of gene-disrupting mutations and pervasive recombination.

Authors:  Steven Sijmons; Kim Thys; Mirabeau Mbong Ngwese; Ellen Van Damme; Jan Dvorak; Marnix Van Loock; Guangdi Li; Ruth Tachezy; Laurent Busson; Jeroen Aerssens; Marc Van Ranst; Piet Maes
Journal:  J Virol       Date:  2015-05-13       Impact factor: 5.103

4.  HCMV vCXCL1 Binds Several Chemokine Receptors and Preferentially Attracts Neutrophils over NK Cells by Interacting with CXCR2.

Authors:  Rachel Yamin; Laura S M Lecker; Yiska Weisblum; Alon Vitenshtein; Vu Thuy Khanh Le-Trilling; Dana G Wolf; Ofer Mandelboim
Journal:  Cell Rep       Date:  2016-05-05       Impact factor: 9.423

5.  Endothelial and leukocyte forms of IL-8. Conversion by thrombin and interactions with neutrophils.

Authors:  C A Hébert; F W Luscinskas; J M Kiely; E A Luis; W C Darbonne; G L Bennett; C C Liu; M S Obin; M A Gimbrone; J B Baker
Journal:  J Immunol       Date:  1990-11-01       Impact factor: 5.422

6.  HHV8-encoded vMIP-I selectively engages chemokine receptor CCR8. Agonist and antagonist profiles of viral chemokines.

Authors:  D J Dairaghi; R A Fan; B E McMaster; M R Hanley; T J Schall
Journal:  J Biol Chem       Date:  1999-07-30       Impact factor: 5.157

7.  Solution structure of CCL21 and identification of a putative CCR7 binding site.

Authors:  Melissa Love; Jamie L Sandberg; Joshua J Ziarek; Kyle P Gerarden; Renee R Rode; Davin R Jensen; Darrell R McCaslin; Francis C Peterson; Christopher T Veldkamp
Journal:  Biochemistry       Date:  2012-01-17       Impact factor: 3.162

8.  Crystallographic Structure of Truncated CCL21 and the Putative Sulfotyrosine-Binding Site.

Authors:  Emmanuel W Smith; Eric M Lewandowski; Natasha A Moussouras; Kyle G Kroeck; Brian F Volkman; Christopher T Veldkamp; Yu Chen
Journal:  Biochemistry       Date:  2016-09-26       Impact factor: 3.162

9.  Structural Features of an Extended C-Terminal Tail Modulate the Function of the Chemokine CCL21.

Authors:  Natasha A Moussouras; Gertrud M Hjortø; Francis C Peterson; Martyna Szpakowska; Andy Chevigné; Mette M Rosenkilde; Brian F Volkman; Michael B Dwinell
Journal:  Biochemistry       Date:  2020-03-26       Impact factor: 3.162

10.  Human Cytomegalovirus Genomes Sequenced Directly From Clinical Material: Variation, Multiple-Strain Infection, Recombination, and Gene Loss.

Authors:  Nicolás M Suárez; Gavin S Wilkie; Elias Hage; Salvatore Camiolo; Marylouisa Holton; Joseph Hughes; Maha Maabar; Sreenu B Vattipally; Akshay Dhingra; Ursula A Gompels; Gavin W G Wilkinson; Fausto Baldanti; Milena Furione; Daniele Lilleri; Alessia Arossa; Tina Ganzenmueller; Giuseppe Gerna; Petr Hubáček; Thomas F Schulz; Dana Wolf; Maurizio Zavattoni; Andrew J Davison
Journal:  J Infect Dis       Date:  2019-07-31       Impact factor: 5.226

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.