| Literature DB >> 35265054 |
Andrea Luenenschloss1, Frank Ter Veld1, Stefan P Albaum2, Tobias M Neddermann2,3, Volker F Wendisch2,3, Ansgar Poetsch1,4,5.
Abstract
The physiological role of ubiquitous rhomboid proteases, membrane-integral proteins that cleave their substrates inside the lipid bilayer, is still ill-defined in many prokaryotes. The two rhomboid genes cg0049 and cg2767 of Corynebacterium glutamicum were mutated and it was the aim of this study to investigate consequences in respect to growth phenotype, stress resistance, transcriptome, proteome, and lipidome composition. Albeit increased amount of Cg2767 upon heat stress, its absence did not change the growth behavior of C. glutamicum during exponential and stationary phase. Quantitative shotgun mass spectrometry was used to compare the rhomboid mutant with wild type strain and revealed that proteins covering diverse cellular functions were differentially abundant with more proteins affected in the stationary than in the exponential growth phase. An observation common to both growth phases was a decrease in ribosomal subunits and RNA polymerase, differences in iron uptake proteins, and abundance changes in lipid and mycolic acid biosynthesis enzymes that suggested a functional link of rhomboids to cell envelope lipid biosynthesis. The latter was substantiated by shotgun lipidomics in the stationary growth phase, where in a strain-dependent manner phosphatidylglycerol, phosphatidic acid, diacylglycerol and phosphatidylinositol increased irrespective of cultivation temperature.Entities:
Keywords: corynebacteria; heat stress; membrane protease; physiological adaptation; proteomics
Year: 2022 PMID: 35265054 PMCID: PMC8899591 DOI: 10.3389/fmicb.2022.771968
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Used strains, plasmids, and oligonucleotides.
| Wild type strain |
| |
| Δ | This study | |
| Δ | This study | |
| U169 |
| |
| pK18 | Vector for allelic exchange in |
|
| pK18 | Vector with insert of PCR-amplified | This study |
| pK18 | Vector with insert of PCR-amplified | This study |
| cg0049 upstream 1 | GC | For |
| cg0049 upstream 2 | GAGGGCAATGGGCGGAATGTGCAGGTTTTTGTGGCAT | Base pairing with cg0049 downstream 1 |
| cg0049 downstream 1 | ATGCCACAAAAACCTGCACATTCCGCCCATTGCCCTC | Base pairing with cg0049 upstream 2 |
| cg0049 downstream 2 | GCG | |
| cg2767 upstream 1 | GC | For |
| cg2767 upstream 2 | GCTTCAGGGAATTTTACCGATTTTCGGTGGAATCGGCA | Base pairing with cg0049 downstream 1 |
| cg2767 downstream 1 | GTGTAGTCGCTAGGTGAAAAGGTAAAAGTTCCCTGAAGC | Base pairing with cg0049 upstream 2 |
| cg2767 downstream 2 | GCG |
Underlined terms indicate BamHI restriction site.
FIGURE 1Western blots demonstrating increased abundance of Cg2767 upon heat stress. Membrane fractions of 25 μg protein were subjected to SDS-PAGE and Western blotting. (A) Detection of Cg2767 in the stationary growth phase at 30 and 40°C in Wt and Δcg2767 strain. (B) Detection of Cg2767 in the exponential growth phase at 30 and 50°C in membrane and cytoplasmic fraction of WT strain. (C) Time course analysis for Cg2767 at 40°C in the exponential growth phase and Coomassie-stained gel area for loading control; start point of sampling (30°C, t = 0 min) is indicated in Supplementary Figure 1. The protein signal was detected at a MW of 26 kDa exclusively in the Wt membrane fraction.
FIGURE 2Lipidome of WT and rhomboid KO strain in the stationary phase. Lipidome alterations in the wild-type and Δcg2767/Δcg0049 C. glutamicum strain exposed to 30 and 40°C. Lipids were isolated using hot n-butanol extraction and spiked with defined amounts of synthetic lipid standards for semi-quantitative determination (in pg/g wet-weight), based on precursor peak intensities. Samples were analyzed with an LTQ Orbitrap mass spectrometer using high-resolution precursor scanning followed by HCD fragmentation. Interpretation of precursor and fragment spectra was performed using LipidXplorer, identifying 16 lipid species (MA, mycolic acid; PG, phosphatidylglycerol; CL, cardiolipin; PA, phosphatidic acid; PI, phosphatidylinositol; and DAG, diacylglycerol).
FIGURE 3Rhomboids affect molecular composition of cell envelope. Proteins involved in ion homeostasis, amino acid transport, transcription and translation, and lipid metabolism, as well as plasma membrane lipids changed in abundance (up or down arrows, Δcg2767/Δcg0049 C. glutamicum vs. wild type ratio) upon deletion of the two C. glutamicum rhomboid genes.
FIGURE 4Lipid metabolism is affected upon rhomboid gene deletion. Excerpts of lipid metabolism showing protein abundance changes (ratio Δcg2767/Δcg0049 C. glutamicum vs. wild type up or down arrow). Enzymes involved in acyl-CoA synthesis (AccBc, AccD1), fatty acid synthesis (FasI, FasIB), fatty acid degradation (Cg1409), and phospholipid biosynthesis (PlsC) were affected.