Literature DB >> 35258399

Interleukin-17 promotes proliferation, migration, and invasion of trophoblasts via regulating PPAR-γ/RXR-α/Wnt signaling.

Zhuo Zhang1, Yuhua Yang1, Xiaomei Lv1, Hongyuan Liu1.   

Abstract

To investigate the effect of Interleukin 17 (IL-17) on the invasive capacity of trophoblast cells and the underlying mechanism, we collected placental tissues samples from pregnant women with preeclampsia (PE) and healthy pregnant women. The expression levels of IL-17 mRNA and protein in tissue samples were determined using qRT-PCR and Western blot, respectively. Cell viability and cell proliferation was determined using CCK-8 assay, and colony formation assay, respectively. Cell migration and invasion capacity were determined using transwell cell migration assay. Our results showed that the mRNA expression of IL-17 was significantly increased in PE patients and may be used as a sensitive biomarker for PE (P < 0.01). IL-17 overexpression promoted cell viability, migration, and invasion of human extravillous trophoblast cell line, HTR8/SVneo; however, IL-17 knockdown inhibited these effects. Additionally, IL-17 activated PPAR-γ/RXR-α signaling pathway, which promoted proliferation, migration, and invasion of trophoblast cells. Moreover, PPAR-γ/RXR-α heterodimers activated Wnt signaling. In conclusion, our study provides evidence that IL-17 is overexpressed in PE and promotes proliferation, migration and invasion of trophoblast cells via activating PPAR-γ/RXR-α/Wnt signaling.

Entities:  

Keywords:  Interleukin 17; PPAR-γ/RXR-α heterodimers; invasiveness; trophoblast; wnt signaling

Mesh:

Substances:

Year:  2022        PMID: 35258399      PMCID: PMC8805847          DOI: 10.1080/21655979.2021.2020468

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Introduction

Preeclampsia (PE) is an idiopathic pregnancy-specific syndrome characterized by proteinuria. PE is a major cause of miscarriage and fetal death in pregnant women [1,2]. Epidemiological studies show that the incidence of PE is about 3–5% globally and 2–8% in Country [3]. Early diagnosis and intervention is important to reduce adverse events caused by PE. Recently, spiral artery recasting has been shown to be closely related to the occurrence and development of PE. Spiral artery recasting is characterized by trophoblast invasion and secondary activation of apoptosis of vascular endothelial smooth muscle cells. Changes in invasiveness of trophoblasts are considered to be an important pathological basis for the occurrence of PE [4,5]. Therefore, understanding the molecular mechanisms underlying the invasiveness of trophoblasts is of vital importance. Interleukin 17 (IL-17) is a pro-inflammatory factor secreted by Th17 cells. IL-17 is highly inflammatory and can activate inflammation by regulating the expression of other inflammatory factors, such as IL-6 and IL-8 [6]. Studies have shown that IL-17 is closely related to trophoblast cell infiltration [7]. However, the specific molecular mechanism through which IL-17 regulates and enhances trophoblast invasion has not been elucidated. Retinoic acids (RAs), active products of vitamin A, play a key role in embryogenesis as well as cell differentiation, migration, and invasion [8]. RA signaling through its receptors (such as RARA, RARB, RARG, and the retinoic X receptor RXRA) is closely associated with the development of fetal placenta [9]. For example, increase in decidual RAR-α causes retardation of placental growth. RXR-α is overexpressed in cytotrophoblasts differentiation and its knockdown increases the invasion of extravillous cytotrophoblasts into uterine tissues [10,11]. Decrease in RAs contributes to the pathogenesis of PE [12]. However, the exact role of RA signaling in PE has not been elucidated. Thie aim of this study was to investigate the role of IL-17 in PE and the underlying mechanisms. We hypothesized that IL-17 might promote the proliferation, migration and invasion of trophoblast cells via activating PPAR-γ/RXR-α/Wnt signaling.

Materials and methods

Materials

Study participants

Clinical samples were collected from pregnant women with PE and healthy control at Shijiazhuang People’s Hospital. The inclusion criteria for the PE group included: (1) the relevant diagnostic criteria for PE; (2) Good mental state; (3) the patient voluntarily signed the informed consent form. The exclusion criteria for the PE group included: (1) artificial insemination, or multiple pregnancy; (2) absence of clinical data; (3) patients with chronic hypertension or other cardiovascular diseases. (4) patients with inflammatory condition. The inclusion criteria for the healthy control NC group included: (1) normal indexes of all physical examinations; (2) singleton pregnancy; (3) no past history of eclampsia. The exclusion criteria for NC group included: (1) refusal to sign an informed consent form; (2) pregnancy-induced hypertension or gestational diabetes [13]. And the Characteristic information of the PE patients and healthy controls were collected from the Shijiazhuang People’s Hospital. This study was approved by Ethics committee of the Shijiazhuang People’s Hospital.

Reagent

The following reagents were purchased from the indicated manufacturers: human extravillous trophoblast cell line HTR8/SVneo (in early pregnancy) from ATCC (Manassas, VA, USA), DMEM high sugar medium from Shandong Boko Biological Industry Co., Ltd (City, Country), fetal bovine serum from Shandong Boko Regenerative Medicine Co., Ltd (City, Country), trypsin from Shenzhen Love Biotechnology Co., Ltd (Shenzhen, China), TRIzol reagent from Shanghai Bohu Biotechnology Co., Ltd (Shanghai, China), UltraSYBR mixture from Shanghai Bangjing Industrial Co., Ltd (Shanghai, China), tissue lysate from Shanghai Yuchun Biotechnology Co., Ltd (Shanghai, China), ReverTra Ace qPCR-RT kit from Dongyang Textile (Shanghai) Biotechnology Co., Ltd (Shanghai, China), Lipo3000TM reagent from Beijing Noble Technology Co., Ltd (Beijing, China), Rabbit anti-human GAPDH monoclonal antibody from Shanghai Lei Hao Information Technology Co., Ltd (Shanghai, China), and HRP conjugated goat anti-rabbit IgG from Mingxiu (Shanghai, China) Biotechnology Co., Ltd (Shanghai, China).

Method

Specimen collection

Clinical samples (1 cm3) were collected from the participants. The tissues were immediately cleaned and dried before being frozen and stored at −80ºC for detection of IL-17 expression.

Cell culture and transfection

HTR8/SVneo cells were cultured in DMEM media supplemented with 10% fetal bovine serum in a standard humidified incubator (37ºC, 5% CO2). Cells were passaged after reaching 90% confluency. Cells were seeded at a density of 1 × 105 cell per well in 6-well plates and treated with 1 µM BMS493 (an inhibitor of pan-RAR receptors). Cells were later transfected with siRNA-IL-17, IL-17 overexpression plasmids or the negative control using Lipofectamine® 3000 (Invitrogen, Waltham, MA, USA) and were used for further experiments after 48 h.

Quantitative RT-PCR

Total RNA was extracted from the tissue samples and cells (following transfection) using TRIzol. The concentration and purity of the total RNA were assessed from OD 260/280 readings (ratio >1.8) using a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The RNA (1 µg) was used to synthesize cDNA using SYBR Premix Ex Taq (Takara), as per manufacturer’s instructions. PCR was performed using Power SYBR® Green PCR Master Mix (TaKaRa). The reaction system: 2 µL cDNA, 0.4 µL each of forward and reverse primers, 0.4 µL ROX reference dye, 10 µL SYBR Premix Ex Taq, and 6.8 µL double-distilled H2O. The reaction conditions were as follows: the reaction has a total of 40 cycles, of which 65ºC 1 min 10 min 95ºC 15 s min 95ºC. GAPDH was used as the internal reference. Relative mRNA expression was calculated using the 2−ΔΔCq method [14]. The primer sequences are shown in Table 1.
Table 1.

The sequence of primers used in this study

  5′–3′
IL-17FAACGCCGAGGCCAATAACTTTC
RAGGGTCCTCATTGCGGCTCAGA
MMP-2FCACTTTCCTGGGCAACAAAT
RCTCCTCAATGCCCTTGATGT
MMP-3FTCGGTGGCTTCAGTACCT
RCCTCCTCCCAGACCTTC
VimentinFATGACCGCTTCGCCAACTAC
RCGGGCTTTGTCGTTGGTTAG
PPAR-γFGGGATCAGCTCCGTGGATCT
RTGCACTTTGGTACTCTTGAAGTT
RXR-αFCGACCCTGTCACCAACATTTGC
RGAGCAGCTCATTCCAGCCTGCC
GAPDHFGGAGCGAGATCCCTCCAAAAT
RGGCTGTTGTCATACTTCTCATGC
The sequence of primers used in this study

Western blot analysis

As described by previous study [14], Total protein was collected from the cells by using radioimmunoprecipitation assay lysis buffer (Beyotime, Jiangsu, China). Protein concentration was determined using BCA kit and separated by SDS-PAGE (40 μg per lane). The proteins were then transferred to PVDF membranes. After blocking with 5% skimmed milk for 2 h, the membranes were incubated with primary antibodies overnight at 4ºC. The membranes were incubated with goat-anti-rabbit secondary antibody (Mingxiu (Shanghai) Biotechnology Co., Ltd). All the antibodies (unless specified otherwise) were purchased from Abcam (Cambridge, UK) and diluted at 1:1000. Subsequently, the bands were visualized using an ECL chemiluminescence kit and analyzed using ImageJ 3.0 software (NIH, Bethesda, MD, USA).

Luciferase assay

Cells were seeded into 24-well plate and later co-transfected with reporter plasmids containing Wnt promoter and pcDNAPPAR-ɤ/si-PPAR-ɤ for 48 h. The luciferase activity was determined using a luciferase kit (Promega, Madison, WI, USA). Luciferase activity was normalized to Renilla luciferase activity according to a previous study [15].

Transwell cell migration assay analysis

According to a previous study [16], following transfection, cells were collected, resuspended at a density of 5 × 104 cells per ml and seeded (1 mL) per well in upper chambers of 24-well plates precoated with Matrigel. The lower chamber was filled with 1 mL FBS. After 24 h, cells that migrated or invaded into the lower chamber were fixed with 4% paraformaldehyde and subsequently stained with 0.1% crystal violet. The cells were then visualized with an inverted microscope.

Statistical analysis

The data were processed using SPSS 22.0 software (IBM Corp, Armonk, NY, USA) and expressed as mean ± SD. All data in this study conformed to normal distribution. The data were analyzed by Student t-test and ANOVA followed by Tukey’s test. P < 0.05 was considered statistically significant.

Results

IL-17 is overexpressed in PE. Moreover, overexpression of IL-17 promoted the proliferation, migration, and invasion of trophoblast cells by regulating PPAR-ɤ/RXR-α/Wnt signaling. Therefore, IL-17 may be a potential therapeutic target for PE.

IL-17 was overexpressed in preeclampsia

The expression of IL-17 mRNA was significantly higher in the PE group than in the HC group (P < 0.01). The results of the ROC curve showed that the AUC area of IL-17 in the PE group was 0.9463 (95% confidence interval: 0.8995 ~ 0.9930, P < 0.001) (Figure 1). Moreover, high expression of IL-17 was associated with systolic and diastolic blood pressure, gestational age, and proteinuria (Table 2).
Figure 1.

IL-17 was overexpressed in PE patients. (a) The mRNA expression of IL-17 in PE patients. (b) AUC analysis of IL-17 expression. **P < 0.01.

Table 2.

Characteristic information of the PE and healthy patients

CharacteristicPEHealthyP value
Age  P > 0.05
 32.34 ± 5.7831.78 ± 3.51 
Systolic Blood Pressure (mm Hg)  P < 0.01
 153.61 ± 16.37112 ± 9.64 
Diastolic blood pressure (mm Hg)  P < 0.01
 104.86 ± 12.5868.17 ± 5.82 
HDL  P > 0.05
 1.85 ± 0.521.77 ± 0.43 
LDL  P > 0.05
 3.55 ± 0.693.74 ± 0.51 
Gestational Age (Weeks)  P < 0.01
 33.26 ± 3.7438.29 ± 4.64 
Proteinuria  P < 0.01
 2.45 ± 1.271.19 ± 0.96 
Characteristic information of the PE and healthy patients IL-17 was overexpressed in PE patients. (a) The mRNA expression of IL-17 in PE patients. (b) AUC analysis of IL-17 expression. **P < 0.01.

Overexpression of IL-17 promoted proliferation, migration, and invasion of trophoblast cells

To investigate the role of IL-17 in PE, we analyzed the cellular functions of trophoblast following transfection with IL-17 overexpression plasmids. As shown in Figure 2a and Figure 2b, the mRNA and protein expression of IL-17 increased significantly (P < 0.001), suggesting that the cells were successfully transfected. Overexpression of IL-17 promoted cell viability and colony formation (P < 0.01, Figure 2c and d). This was consistent with the results from transwell cell migration assay; upregulation of IL-17 significantly increased the migration and invasion ability of trophoblast cells (P < 0.01, Figure 2e). Additionally, upregulation of IL-17 increased the mRNA and protein expression of MMP-3, MMP-9, and Vimentin (P < 0.01, figure 2f and g).
Figure 2.

IL-17 promoted proliferation, migration, and invasion of trophoblast cells. Transfection efficiency of IL-17 determined using (a) qRT-PCR, and (b) Western blot. (c) Cell viability of trophoblast cells. (d) Colony formation capacity of trophoblast cells. (e) Migration and invasion capacity of trophoblast cells. Expression of MMP3, MMP9, and Vimentin at (f) the mRNA level, and (g) the protein level. **P < 0.01, ***P < 0.001.

IL-17 promoted proliferation, migration, and invasion of trophoblast cells. Transfection efficiency of IL-17 determined using (a) qRT-PCR, and (b) Western blot. (c) Cell viability of trophoblast cells. (d) Colony formation capacity of trophoblast cells. (e) Migration and invasion capacity of trophoblast cells. Expression of MMP3, MMP9, and Vimentin at (f) the mRNA level, and (g) the protein level. **P < 0.01, ***P < 0.001.

Knockdown of IL-17 suppressed proliferation, migration, and invasion of trophoblast cells

To investigate the role of IL-17 in PE, cells were transfected with siRNA-IL-17. As shown in Figure 3a, IL-17 expression was significantly decreased in siRNA-IL-17 group (P < 0.01), which was more remarkable in siRNA-IL-17 1#, (P < 0.001). Therefore, siRNA-IL-17 1# was used in the following experiments. IL-17 knockdown significantly suppressed cell viability, colony formation, migration, and invasion of trophoblast cells, HTR8/SVneo (P < 0.01, Figure 3c–e). Additionally, IL-17 knockdown decreased the mRNA and protein expression of MMP3, MMP9, and Vimentin (P < 0.01, Figure 3f and Figure 3g).
Figure 3.

IL-17 knockdown suppressed the proliferation, migration, and invasion of trophoblast. Transfection efficiency of IL-17 determined using (a) qRT-PCR, and (b) Western blot. (c) Cell viability of trophoblast cells. (d) Colony formation capacity of trophoblast cells. (e) Migration and invasion capacity of trophoblast cells. Expression of MMP3, MMP9, and Vimentin at (f) the mRNA level, and (g) the protein level. **P < 0.01, ***P < 0.001.

IL-17 knockdown suppressed the proliferation, migration, and invasion of trophoblast. Transfection efficiency of IL-17 determined using (a) qRT-PCR, and (b) Western blot. (c) Cell viability of trophoblast cells. (d) Colony formation capacity of trophoblast cells. (e) Migration and invasion capacity of trophoblast cells. Expression of MMP3, MMP9, and Vimentin at (f) the mRNA level, and (g) the protein level. **P < 0.01, ***P < 0.001.

IL-17 activated PPAR-ɤ/RXR-α signaling

RA signaling plays a crucial in the pathologically altered placentas in PE patients (Huebner et al., 2018). Therefore, we determined the expression of PPAR-ɤ/RXR-α in trophoblast cells. As shown in Figure 4, the mRNA and protein expression of PPAR-ɤ/RXR-α was upregulated in cells overexpressing IL-17 and down regulated in cells with silenced IL-17 (P < 0.01).
Figure 4.

IL-17 activated PPAR-γ/RXR-α signaling pathway. (a) mRNA expression of PPAR-γ. (b) mRNA expression of RXR-α. (c) Protein expression of PPAR-γ/RXR-α. **P < 0.01, ##P < 0.01.

IL-17 activated PPAR-γ/RXR-α signaling pathway. (a) mRNA expression of PPAR-γ. (b) mRNA expression of RXR-α. (c) Protein expression of PPAR-γ/RXR-α. **P < 0.01, ##P < 0.01.

Activated RXR-α promoted proliferation, migration, and invasion of trophoblast cells

Rescue assays were performed to verify the role of RXR-α in PE. As shown in Figure 5a, the expression of RXR-α was significantly increased by its agonist, Magnaldehyde B (MB) (P < 0.01). Moreover, MB significantly increased cell viability, colony formation, migration, and invasion of trophoblast as well as increased the mRNA and protein expression of MMP3, MMP9, and Vimentin (P < 0.01, Figure 5b–e).
Figure 5.

Activation of RXR-α promoted proliferation, migration, and invasion of trophoblast cells. (a) mRNA expression of RXR-α. (b) Transfection efficiency of IL-17 determined by Western blot. (c) Cell viability of trophoblast cells. (d) Colony formation of trophoblast cells. (e) Migration and invasion ability of trophoblast cells. Expression of MMP3, MMP9, and Vimentin at (f) the mRNA level, and (g) the protein level. **P < 0.01, #P < 0.05, ##P < 0.01.

Activation of RXR-α promoted proliferation, migration, and invasion of trophoblast cells. (a) mRNA expression of RXR-α. (b) Transfection efficiency of IL-17 determined by Western blot. (c) Cell viability of trophoblast cells. (d) Colony formation of trophoblast cells. (e) Migration and invasion ability of trophoblast cells. Expression of MMP3, MMP9, and Vimentin at (f) the mRNA level, and (g) the protein level. **P < 0.01, #P < 0.05, ##P < 0.01.

PPAR-ɤ/RXR-α heterodimers transcriptionally activated Wnt2 signaling

Figure 6a and b show the binding sites of the binding motif of PPAR-ɤ/RXR-α heterodimers. The binding sites were further verified by luciferase assay (P < 0.01, Figure 6c and d). Moreover, the mRNA and protein expression of WNT2 increased following overexpression of PPAR-ɤ and decreased following PPAR-ɤ silencing (Figure 6e and f).
Figure 6.

PPAR-ɤ/RXR-α heterodimers transcriptionally activated Wnt2 signaling pathway. (a) The binding motif of PPAR-ɤ. (b) The binding sites of PPAR-ɤ predicted by JASPAR. (c, d) The binding sites verified by luciferase assay. (e, f) mRNA and protein expression of Wnt signaling pathway. **P < 0.01, ##P < 0.01.

PPAR-ɤ/RXR-α heterodimers transcriptionally activated Wnt2 signaling pathway. (a) The binding motif of PPAR-ɤ. (b) The binding sites of PPAR-ɤ predicted by JASPAR. (c, d) The binding sites verified by luciferase assay. (e, f) mRNA and protein expression of Wnt signaling pathway. **P < 0.01, ##P < 0.01.

Discussion

In the present study, we found that IL-17 was overexpressed in PE patients. Upregulation of IL-17 promoted proliferation, migration, and invasion of trophoblast cells. Additionally, IL-17 interacted with PPAR-ɤ/RXR-α to activate Wnt2/β-catenin signaling pathway. However, knockdown of IL-17 suppressed the observed proliferation, migration, and invasion of trophoblast cells. Therefore, IL-17 may be a potential biomarker for PE. The development of fetal placenta is closely associated with abnormal accumulation of cytokines, such as interleukins (ILs), tumor necrosis factors (TNFs), and interferons (INFs) [17-19]. IL-17, a member of the interleukin family, functions as a pro-inflammatory factor in spondyloarthritis [20], psoriasis [21], and atherosclerosis [22]. Moreover, the potential role of IL-17 in inflammation and autoimmune diseases make limited contributions to the establishment of the diversity, stability, and plasticity in placenta. The imbalance of IL-17/IL-35 or IL-17/IL-10 in the placenta induces PE and low fetal weight in placental malaria [23,24]. Moreover, IL-17-induced oxidative stress is a key factor that induces hypertension during pregnancy, which may further contribute to the development of the fetal placenta [25]. In the present study, we found that IL-17 was overexpressed in PE and can therefore be used a sensitive biomarker. Overexpression of IL-17 promoted proliferation, migration, and invasion of trophoblast cells, while, IL-17 knockdown induced the degradation of trophoblast. Generally, about 90% of the research on IL-17 focuses on its potential role in inflammation and autoimmune pathways. Few studies have investigated the role of IL-17 in placental development and pregnancy. The release of IL-17 produces natural killer cells and enhances proliferation and invasion of human trophoblast cells [26,27]. The accumulation of IL-17 released by Th17 promotes the apoptosis of granular cells in vitro and induces premature ovarian failure in vivo [28]. Therefore, these results suggested that IL-17 plays a negative role in placental development and pregnancy, and that the role of IL-17 varies in different cells. Interestingly, IL-17 soluble receptor C infusion impedes Th17 function and inhibits the development of PE [29]. Therefore, suppressing the release of IL-17 in trophoblast cells may be a promising intervention strategy for PE. The alteration of RAs is crucial factor for the development of PE. For instance, low levels of RA contribute to the pathogenesis of PE [12]. These effects are regulated by RA signaling. RA receptor responder 1 is hypermethylated in choriocarcinoma of the placenta. VEGF and RARβ interact with VEGF to promote intramembranous absorption and fetal vasculature on the placental surface [30]. RXR-α, an RA receptor, promotes the differentiation of human trophoblast. Moreover, high levels of RXR-α increase the risk of PE [31]. In the present study, we found that IL-17 increased the expression of RXR-α, which promoted proliferation, migration, and invasion of trophoblast cells. Additionally, RXRs can form hetero- or homodimers that bind to specific DNA elements [32]. Previous studies have reported the role of PPAR-ɤ/RXR-α heterodimers in placental development [10,33]. In the present study, IL-17 activated PPAR-ɤ/RXR-α signaling to enhance the invasion capacity of trophoblast cells. Wnt signaling pathway is a key regulator of embryogenesis [34]. Wnt pathway is involved in blastocyst formation and trophoblast development [35,36]. The potential role of Wnt signaling in has attracted attention [37]. Depletion of Wnt2 attenuates branching and placental labyrinth formation [38]. Inactivation of Wnt signaling by LIM and SH3 Protein 2 suppresses the migration and invasion of trophoblast [39]. Wnt2 is upregulated during syncytiotrophoblast differentiation, and this aberrant expression induces the development of PE in vivo and in vitro [40,41]. In the present study, PPAR-ɤ/RXR-α heterodimers transcriptionally activated Wnt2/β-catenin signaling pathway. Therefore, IL-17 may promote proliferation, migration, and invasion of trophoblast cells via activation of PPAR-ɤ/RXR-α/Wnt signaling pathway.

Conclusion

In conclusion, IL-17 is overexpressed in PE. Moreover, overexpression of IL-17 promoted the proliferation, migration, and invasion of trophoblast cells by regulating PPAR-ɤ/RXR-α/Wnt signaling. Therefore, IL-17 may be a potential therapeutic target for PE.

Highlights

IL-17 promoted the proliferation, migration and invasion of trophoblast. IL-17 was overexpressed in preeclampsia. IL-17 regulated the HTR8/SVneo.
  38 in total

1.  Interleukin-17 signaling mediates cytolytic natural killer cell activation in response to placental ischemia.

Authors:  Olivia K Travis; Dakota White; Cedar Baik; Chelsea Giachelli; Willie Thompson; Cassandra Stubbs; Mallory Greer; James P Lemon; Jan Michael Williams; Denise C Cornelius
Journal:  Am J Physiol Regul Integr Comp Physiol       Date:  2020-04-22       Impact factor: 3.619

Review 2.  Wnt/beta-catenin signaling in development and disease.

Authors:  Hans Clevers
Journal:  Cell       Date:  2006-11-03       Impact factor: 41.582

Review 3.  The Impact of IL-17 in Atherosclerosis.

Authors:  Xinjie Lu
Journal:  Curr Med Chem       Date:  2017       Impact factor: 4.530

4.  Primate-specific miR-515 family members inhibit key genes in human trophoblast differentiation and are upregulated in preeclampsia.

Authors:  Ming Zhang; Sribalasubashini Muralimanoharan; Alison C Wortman; Carole R Mendelson
Journal:  Proc Natl Acad Sci U S A       Date:  2016-10-24       Impact factor: 11.205

Review 5.  Association between maternal infections and preeclampsia: a systematic review of epidemiologic studies.

Authors:  Luis O Rustveld; Sheryl F Kelsey; Ravi Sharma
Journal:  Matern Child Health J       Date:  2007-06-19

6.  Inactivation of nuclear Wnt-beta-catenin signaling limits blastocyst competency for implantation.

Authors:  Huirong Xie; Susanne Tranguch; Xiangxu Jia; Hao Zhang; Sanjoy K Das; Sudhansu K Dey; Calvin J Kuo; Haibin Wang
Journal:  Development       Date:  2008-01-16       Impact factor: 6.868

7.  Expression and Regulation of Retinoic Acid Receptor Responders in the Human Placenta.

Authors:  Hanna Huebner; Andrea Hartner; Wolfgang Rascher; Reiner R Strick; Sven Kehl; Felix Heindl; David L Wachter; Matthias W Beckmann Md; Fabian B Fahlbusch; Matthias Ruebner
Journal:  Reprod Sci       Date:  2017-12-15       Impact factor: 3.060

8.  A transcriptionally silent RXRalpha supports early embryonic morphogenesis and heart development.

Authors:  Bénédicte Mascrez; Norbert B Ghyselinck; Pierre Chambon; Manuel Mark
Journal:  Proc Natl Acad Sci U S A       Date:  2009-03-02       Impact factor: 11.205

9.  MicroRNA miR-330-3p suppresses the progression of ovarian cancer by targeting RIPK4.

Authors:  Li Cai; Lu Ye; Xiaoqing Hu; Wenfeng He; Debao Zhuang; Qi Guo; Kuanyong Shu; Youkun Jie
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

Review 10.  The Role of the IL-23/IL-17 Pathway in the Pathogenesis of Spondyloarthritis.

Authors:  Hiroyuki Tsukazaki; Takashi Kaito
Journal:  Int J Mol Sci       Date:  2020-09-03       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.