| Literature DB >> 35251136 |
Hengqian He1, Juntao Zhang1, Weikun Gong1, Mengyun Liu1, Hao Liu1, Xiaoyong Li2, Yufei Wu1, Qinkang Lu1.
Abstract
Background: Circular RNAs (circRNAs), a class of non-coding and undegradable RNAs, play many pathological functions by acting as miRNA sponges, interacting with RNA-binding proteins, and others. The recent literature indicates that circRNAs possess the advanced superiority for the early screening of diabetic retinopathy (DR).Entities:
Keywords: biomarker; circular RNAs; diabetes mellitus; diabetic retinopathy; diagnostic value
Year: 2022 PMID: 35251136 PMCID: PMC8891611 DOI: 10.3389/fgene.2022.833573
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primers of validated circRNAs in RT-qPCR.
| circRNA ID | Forward (5–3′) | Reverse (5–3′) |
|---|---|---|
| hsa_circ_0095008 | ATGCGACCATCCACCTCAAAG | ACATCACACACAATCACGGCA |
| hsa_circ_0005062 | TCATCAGCACCCTGTCGTCT | CTGCTTTTCCTGTGATTTTACCCA |
| hsa_circ_0001883 | AGAGAGTACCAGACCCGACA | GCAAGTGAGCGAAATGCTCTT |
| hsa_circ_0040707 | GCTCTTTGCAGGGTCGACAA | AGTGGTTTTTGGGGCCGTTG |
| hsa_circ_0002031 | GTGATCGTTGGCGGACATTT | ATGCTGCTGTCATGTGCTTCT |
| GAPDH | ATGGAAATCCCATCACCATCTT | CGCCCCACTTGATTTTGG |
FIGURE 1Profile of circRNA level in DR samples. (A) Identified circRNAs between DR and control groups by heat map analyzes. (B) Identified circRNAs between DR and DM groups by heat map analyzes. (C) Differentially expressed circRNAs between DR and control groups by Volcano map analysis; (D) The differently expressed circRNAs between DR and DM groups by Volcano map analysis. The red dots represent significant upregulation, and green dots represent significant downregulation.
FIGURE 2Differentially expressed circRNAs in DR samples by GO analysis. (A) DR vs control group, (B) DR vs DM group.
FIGURE 3Differentially expressed circRNAs in DR patients by KEGG analysis. (A) DR vs control group, (B) DR vs. DM group.
List of differentially expressed circRNAs in patients with DR.
| circRNA ID | DR vs controls | DR vs DM | ||||
|---|---|---|---|---|---|---|
| Fold change | p-value | Regulation | Fold change | p-value | Regulation | |
| hsa_circ_0095008 | 3.302807 | 0.000866 | Down | 2.057623 | 0.040505 | Down |
| hsa_circ_0005062 | 2.764961 | 0.009428 | Down | 4.017943 | 0.000528 | Down |
| hsa_circ_0001883 | 3.217526 | 0.004683 | Up | 2.126805 | 0.041181 | Up |
| hsa_circ_0040707 | 3.140882 | 0.019335 | Up | 3.287805 | 0.016502 | Up |
| hsa_circ_0002031 | 2.379722 | 0.005157 | Down | 3.232438 | 0.042273 | Down |
FIGURE 4Validation of five candidate circRNAs in DR samples (n = 42) by RT-qPCR. (A) hsa_circ_0095008; (B) hsa_circ_0001883; (C) hsa_circ_0040707; (D) hsa_circ_0005062; (E) hsa_circ_0002031), compared with DM samples (n = 60) and controls (n = 20).*p < 0.05, **p < 0.01, ***p < 0.001.
Detailed clinical parameters of study population.
| Controls | DM | DR | |
|---|---|---|---|
| No. | 20 | 60 | 42 |
| Age (years) | 41.35 ± 3.116 | 63.58 ± 1.344 | 65.511.271 |
| Sex, female | 9 | 35 | 22 |
| BMI | 24.35 ± 0.3988 | 23.72 ± 0.5683 | |
| HbA1c (%) | 7.652 ± 0.1992 | 7.443 ± 0.2271 | |
| SBP (mmHg) | 148.0 ± 2.570 | 144.2 ± 2.309 | |
| DBP (mmHg) | 76.12 ± 1.965 | 74.29 ± 2.173 | |
| Glucose (mmol/L) | 7.246 ± 0.2674 | 7.586 ± 0.3935 | |
| TCHO (mmol/L) | 4.759 ± 0.1309 | 5.156 ± 0.1604 | |
| TG (mmol/L) | 1.746 ± 0.1433 | 1.576 ± 0.1369 | |
| LDL (mmol/L) | 1.255 ± 0.03701 | 1.275 ± 0.04632 | |
| HDL (mmol/L) | 2.804 ± 0.1109 | 3.126 ± 0.1376 | |
| Tbil (umol/L) | 12.90 ± 0.6937 | 12.94 ± 0.9465 |
BMI, body mass index; HbA1c, glycated hemoglobin A1c; SBP, systolic blood pressure; DBP, diastolic blood pressure; TCHO, total cholesterol; TG, triglyceride; LDL, low-density lipoprotein; LDL, low-density lipoprotein; TBil, total bilirubin.
AUC characteristics of hsa_circ_0095008 and hsa_circ_0001883.
| Group | CircRNA ID | AUC | Sensitivity | Specificity | PPV | NPV |
|---|---|---|---|---|---|---|
| (95% CI) | % (95%CI) | % (95%CI) | % (95%CI) | % (95%CI) | ||
| DR vs DM | hsa_circ_0095008 | 0.671 | 52.38 | 81.67 | 66.7 | 71 |
| 0.565–0.778 | 36.42–68.00 | 69.56–90.48 | 50.6–82.8 | 60.3–81.7 | ||
| hsa_circ_0001883 | 0.607 | 50.00 | 70.00 | 52.5 | 66.1 | |
| 0.495–0.719 | 34.2–65.8 | 56.8–81.2 | 37–68 | 54.3–77.9 | ||
| DR vs controls | hsa_circ_0095008 | 0.804 | 71.43 | 85 | 90.9 | 58.6 |
| 0.681–0.926 | 55.42–84.28 | 62.11–96.79 | 81.1–100.7 | 40.7–76.5 | ||
| hsa_circ_0001883 | 0.725 | 61.90 | 75 | 81.25 | 46.7 | |
| 0.595–0.855 | 45.6–76.4 | 50.9–91.3 | 67.7–94.8 | 28.8–64.5 |
AUC, area under curve; PPV, positive predictive value; NPV, negative predictive value.
FIGURE 5ROC analysis of hsa_circ_0095008 and hsa_circ_0001883 in DR samples. Diagnostic value of (A) hsa circ 0095008 and (B) hsa circ 0001883 for DR. Blue lines represent ROC curves of circRNAs for distinguishing DR patients from healthy controls ,while red lines represent ROC curves of circRNAs for distinguishing DR patients from DM patients without DR.
FIGURE 6Target miRNA prediction of hsa_circ_0095008 and hsa_circ_0001883 in DR samples. The CircRNA/miRNA regulatory networks of (A) hsa_circ_0095008 and (B) hsa_circ_0001883 were predicted by miRanda- 3.3 software.The red and blue dots represent circRNAs and miRNAs, respectively.