Generation of two induced pluripotent stem cell (iPSC) lines (BBANTWi006-A, BBANTWi007-A) from Brugada syndrome patients carrying an SCN5A mutation.

Brugada syndrome (BrS) is an inherited primary electrical disorder of the heart. 25% of BrS patients carry a mutation in the SCN5A gene, encoding the cardiac specific voltage-gated sodium channel Nav1.5. Here we report two iPSC lines (BBANTWi006-A, BBANTWi007-A) of a brother and a sister carrying an SCN5A mutation (c.4813 + 3_4813 + 6dupGGGT) causing BrS. iPSCs were generated from dermal fibroblasts and reprogrammed with the Cytotune®-iPS 2.0 Sendai Reprogramming Kit (Invitrogen). The generated iPSCs showed a normal karyotype, expressed pluripotency markers, were differentiated into cells of the three germ layers and carried the original genotype.

Resource table

Resource utility

Because the invasiveness of a heart biopsy often prohibits the use of native cardiomyocytes to investigate the pathomechanism of cardiac arrhythmias including Brugada syndrome, iPSC-derived cardiomyocytes provide an alternative to study the underlying disease mechanisms, including the variable expressivity and reduced penetrance observed in family members carrying the same mutation.

Resource details

Brugada syndrome (BrS) is an inherited primary electrical disorder of the heart with a prevalence of approximately 1/2000 and accounts for about 4 % of all sudden cardiac deaths (SCD) (Antzelevitch et al., 2005). Following symptoms can be observed: heart palpitations, syncopes and SCD. Mutation carriers show a variability in symptoms, even within one family. Up to 25% of the BrS patients carry a mutation in the SCN5A gene, encoding Nav1.5, the alpha subunit of the cardiac specific voltage gated sodium channel, which plays an important role in the generation of the action potential upstroke. Here, we present two iPSC lines generated from fibroblasts from BrS patients carrying an SCN5A mutation (c.4813 + 3_4813 + 6dupGGGT). This mutation has been reported twice but was not yet studied in cardiomyocytes (Hong et al., 2005, Rossenbacker et al., 2005). The clinical spectrum of mutation carriers ranges from asymptomatic over abrupt syncopes to a significant number of SCD (Sieliwonczyk et al., 2021). To study the mechanism of this phenotypical variability, two iPSC lines from SCN5A founder mutation carrier siblings are generated (Table 1), one from a symptomatic patient (BBANTWi006-A) and one from an asymptomatic (BBANTWi007-A) mutation carrier and will be differentiated into iPSC-derived cardiomyocytes.

Table 1

Characterization and validation of 2 iPSC lines BBANTWi006-A, BBANTWi007-A.

Classification	Test	Result	Data
Morphology	Photography Bright field	Normal	Not shown but available with author
Phenotype	Qualitative analysis:Immunocytochemistry	Positive for: Oct3/4, Nanog, Tra1-60, Tra1-81	Fig. 1 panel A and panel B
	Quantitative analysis:RT-qPCR	Expression of POU5F1, NANOG, SOX2 and DNMT3B	Fig. 1 panel C
Genotype	HumanCytoSNP-12 array	Resolution 72 kb, no major copy number variations	Fig. 1 Panel E and Panel F
Identity	HumanCytoSNP-12 array	>99,9% of identical SNPs	Fig. 1 Panel H
	STR analysis	N/A	N/A
Mutation analysis (IF APPLICABLE)	Sequencing	Heterozygous SCN5A c.4813 + 3_4813 + 6dupGGGT	Fig. 1 panel D
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by PCR: Negative	Not shown but available with author
Differentiation potential	e.g. Embryoid body formation with RT-qPCR	Expression of markers from each germ layer	Fig. 1 panel G
List of recommended germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Ectoderm: PAX6 & MAP2Mesoderm: NKX2.5 & ACTA2 (A-SMA)Endoderm: SOX17 & CXCR4Reference genes: GAPDH & ACTB	Fig. 1 panel G
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

In this study, fibroblasts, collected through a skin biopsy from two BrS patients were transduced with Sendai virus to deliver Oct3/4, Sox2, Klf4 and hc-MYC to the cells. iPSC colonies appeared approximately 20 days after transduction and were manually picked five times before expanding them. iPSCs expressed pluripotency markers Oct3/4, Nanog, Tra-1-60, Tra-1-81 confirmed with immunocytochemistry staining (Fig. 1A and B) and NANOG, POU5F1, DNTM3B and SOX2 detected with RT-qPCR (Fig. 1C). Mutation analysis was performed with Sanger sequencing and confirmed the presence of the SCN5A mutation in the patient cell lines (Fig. 1D). Spontaneous differentiation to mesodermal, ectodermal and endodermal layers was proven with the formation of embryoid bodies followed by RT-qPCR (Fig. 1G). SNP array analysis indicated that the genotypes of donor cells (fibroblasts or blood cells) and iPSCs were consistent with each other (Fig. 1H). CNV analysis revealed no clinically relevant duplications or deletions (Fig. 1E and F, duplications in green, deletions in purple). A more detailed overview of the deletions and duplications, including genes located within the CNVs can be found in Supplementary Table 1 and 2. Absence of the Sendai vector was tested with a RT-PCR and Mycoplasma contamination was also excluded.

Fig. 1

Characterization of 2 iPSC lines BBANTWi006-A, BBANTWi007-A.

Materials and methods

Fibroblast culture and iPSC culture

A punch biopsy from the inner side of the upper arm was taken from the patient. The biopsy was cut in smaller pieces and incubated with collagenase and trypsine for 1 h in 37 °C. Afterwards fibroblasts were cultured in RPMI medium (Life Technologies) supplemented with 15% FBS (Life Technologies), 1% sodium pyruvate (Life Technologies), 100 U/mL Pen/Strep (Life Technologies) and 0,1% primocin (InvivoGen Europe). Fibroblasts were plated in one well of a 6-well plate and after two days, the cells were transduced with the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (Life Technologies) following the manufacturer’s protocol. After seven days, cells were plated on Matrigel (Corning). One day later, the medium switched from RPMI to E8 flex medium (Life Technologies). Colonies were manually picked and seeded on Matrigel coated 24-well plates and incubated at 37 °C/5%CO2/5%O2. After five rounds of picking, cells were chemically passaged as small clumps with Versene (EDTA 0,02%) (Lonza) every 4–5 days and expanded in a 1:5 ratio. Cells were supplemented with 1x Revitacell (Life Technologies) for 24 h after a picking/passage.

Embryoid body formation

iPSCs (p16-BBANTWi006-A, p16-BBANTWi007-A) were collected using Versene (EDTA 0,02%) (Lonza) for 5 min at room temperature (RT) followed by washing of the cells. 500.000 cells/well were seeded onto a 24-well low-attachment plate with E6 medium (Life Technologies) and incubated at 37 °C/5%CO2/5%O2 and half a medium change was performed every other day. After 14 days EBs were collected for RNA extraction.

RNA extraction and RT-qPCR

Total RNA was extracted from cell cultures (passage 10–15) using the Quick-RNA Miniprep Kit (Zymo-Research). cDNA was synthesized using SuperScript™ III First-Strand Synthesis System (Life Technologies). RT-qPCR was performed using Roche LightCycler480/BioRad CFX meastro with TaqMan® probes ((Life Technologies) (Table 2) and TaqMan® gene expression mastermix (Life Technologies) following manufacturer’s protocol.

Table 2

Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Markers	Mouse anti-TRA-1-60Mouse anti-TRA-1-81Rabbit anti-NANOGRabbit anti-Oct3/4	1:2001:2001:5001:100	Cell Signaling Technology Cat# 4746Cell Signaling Technology Cat# 4745Thermo Fisher Scientific Cat# PA1-097Santa Cruz Biotechnology Cat# sc-9081	AB_2119059AB_2119060AB_2539867AB_2167703
Secondary antibodies	Goat anti-Mouse IgG (AF555)Goat anti-Rabbit IgG (AF 488)	1:5001:500	Thermo Fisher Scientific Cat# A-21424Thermo Fisher Scientific Cat# A-11034	AB_141780AB_2576217
Primers
	Target	Size of band	Forward/Reverse primer (5′-3′)
Sendai virus Plasmids (PCR)	SevKOSKlf4c-MYC	181 bp528 bp410 bp532 bp	GGATCACTAGGTGATATCGAGCACCAGACAAGAGTTTAAGAGATATGTATCATGCACCGCTACGACGTGAGCGCACCTTGACAATCCTGATGTGGTTCCTGCATGCCAGAGGAGCCCAATGTATCGAAGGTGCTCAATAACTGACTAGCAGGCTTGTCGTCCACATACAGTCCTGGATGATGATG
House-Keeping Genes (RT-qPCR)	GAPDHACTB	93 bp63 bp	Hs02758991_g1Hs01060665_g1
Pluripotency Markers (RT-qPCR)	POU5F1NANOGSOX2DNMT3B	77 bp99 bp91 bp55 bp	Hs04260367_gHHs04260366_g1Hs01053049_s1Hs00171876_m1
Differentiation markers (RT-qPCR)	SOX17CXCR4PAX6MAP2NKX2.5ACTA2	149 bp153 bp76 bp98 bp64 bp105 bp	Hs00751752_s1Hs00607978_s1Hs00240871_m1Hs00258900_m1Hs00231763_m1Hs00426835_g1
Genotyping	SCN5A	525 bp	GGCTTTGGGCTCACTAGAGGGGGGTGAGAAATGCACTGAA

Sendai virus detection

SeV genome and transgenes detection in iPSCs (p16-BBANTWi006-A, p16-BBANTWi007-A) was performed with RT-PCR (94 °C 5 min, 34x (94 °C 15 s, 60 °C 30 s, 72 °C 45 s), 72 °C 10 min, 10 °C 1 min) using primers (IDT) (Table 2) provided in the manufacturer’s protocol.

Immunocytochemistry

iPSCs (p22-BBANTWi006-A, p11-BBANTWi007-A) were fixed with ice cold methanol for 20 min at −20 °C and permeabilized with 0.1% triton X-100 (Sigma-Aldrich) at RT for 15 min. 5% goat serum (Jackson ImmunoResearch) was used as blocking buffer for 30 min at RT. Subsequently, iPSCs were incubated overnight with primary antibodies at 4 °C. After three washing steps, cells were incubated with secondary antibodies for 1 h at RT. DAPI (Life Technologies) was used to stain the nuclei of the iPSCs.

Mycoplasma detection

Contamination of mycoplasma was analyzed with the LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich) following manufacturer’s protocol.

SNP array (CNV analysis – Cell identity)

DNA sample was collected from fibroblasts or blood cells and iPSC clones (p16-BBANTWi006-A, p10-BBANTWi007-A). DNA was extracted using an automatic DNA extraction system Maxwell® RSC with Maxwell® RSC Cultured Cells DNA Kit (Promega), following manufacturer’s protocol and DNA samples were stored at + 4 °C after extraction. HumanCytoSNP-12 array (Illumina) was run according to the manufacturer’s protocol for the automated Infinium HD Assay Ultra on an iScan instrument. Results were visualized using Genome Studio software (Illumina) and identity between the iPSC clones and original cell line confirmed. Results were further analysed with CNV-WebStore, an in-house developed online available CNV Analysis tool (http://cnv-webstore.ua.ac.be).

Mutation analysis

SCN5A exon 27 was amplified in genomic DNA obtained from iPSCs and fibroblasts, by PCR (Touch down PCR: 94 °C 5 min, 20x (94 °C 45 s, 65 °C (Δ-0.5) 45 s, 72 °C 45 s), 15x (94 °C 45 s, 56 °C 45 s, 72 °C 45 s), 72 °C 1 min) in a Veriti Fast Thermal Cycler (Applied Biosystems). The mutation was verified with Sanger sequencing. Primers are listed in Table 2.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Unique stem cell lines identifier	BBANTWi006-ABBANTWi007-A
Alternative name(s) of stem cell lines	BrS9 C7 (BBANTWi006-A)BrS10 C3 (BBANTWi007-A)
Institution	University of Antwerp
Contact information of distributor	Maaike Alaerts – maaike.alaerts@uantwerpen.be
Type of cell lines	iPSC
Origin	Human
Additional origin info required	BBANTWi006-A: 50 yrs, Male, CaucasianBBANTWi007-A: 46 yrs, Female, Caucasian
Cell Source	Dermal Fibroblasts
Clonality	Clonal
Associated disease	Brugada Syndrome
Gene/locus	SCN5A c.4813 + 3_4813 + 6dupGGGT
Date archived/stock date	23/10/2018 (BBANTWi006-A)26/12/2018 (BBANTWi007-A)
Cell line repository/bank	Hpscreghttps://hpscreg.eu/cell-line/BBANTWi006-Ahttps://hpscreg.eu/cell-line/BBANTWi007-A
Ethical approval	This study was approved by the Ethics committee of Antwerp University Hospital (18/05/059).