Literature DB >> 35232444

Novel bone morphogenetic protein 15 (BMP15) gene variants implicated in premature ovarian insufficiency.

Fatemeh Afkhami1, Shirin Shahbazi2, Laya Farzadi3, Shahla Danaei4.   

Abstract

BACKGROUND: Bone morphogenetic protein 15 (BMP15) is expressed in oocytes and plays a crucial role in the reproduction of mono-ovulating species. In humans, BMP15 gene mutations lead to imperfect protein function and premature ovarian insufficiency. Here we investigated the BMP15 gene variants in a population of Iranian women with premature ovarian insufficiency. We conducted predictive bioinformatics analysis to further study the outcomes of BMP15 gene alterations.
METHODS: Twenty-four well-diagnosed premature ovarian insufficiency cases with normal karyotype participated in this study. The entire coding sequence and exon-intron junctions of the BMP15 gene were analyzed by direct sequencing. In-silico analysis was applied using various pipelines integrated into the Ensembl Variant Effect Predictor online tool. The clinical interpretation was performed based on the approved guidelines.
RESULTS: By gene screening of BMP15, we discovered p.N103K, p.A180T, and p.M184T heterozygous variants in 3 unrelated patients. The p.N103K and p.M184T were not annotated on gnomAD, 1000 Genome and/or dbSNP. These mutations were not identified in 800 Iranians whole-exome sequencing that is recorded on Iranom database. We identified the p.N103K variant in a patient with secondary amenorrhea at the age of 17, elevated FSH and atrophic ovaries. The p.M184T was detected in a sporadic case with atrophic ovaries and very high FSH who developed secondary amenorrhea at the age of 31.
CONCLUSIONS: Here we newly identified p.N103K and p.M184T mutation in the BMP15 gene associated with idiopathic premature ovarian insufficiency. Both mutations have occurred in the prodomain region of protein. Despite prodomain cleavage through dimerization, it is actively involved in the mature protein function. Further studies elucidating the roles of prodomain would lead to a better understanding of the disease pathogenesis.
© 2022. The Author(s).

Entities:  

Keywords:  BMP15; Gene mutation; In silico analysis; POI

Mesh:

Substances:

Year:  2022        PMID: 35232444      PMCID: PMC8886931          DOI: 10.1186/s12958-022-00913-6

Source DB:  PubMed          Journal:  Reprod Biol Endocrinol        ISSN: 1477-7827            Impact factor:   5.211


Background

Premature Ovarian Insufficiency (POI) also called premature ovarian failure (POF) is considered by loss of ovarian activity before the age of 40. It can be distinguished as primary amenorrhea with delayed menarche, secondary amenorrhea and oligomenorrhea over 4 months. POI is diagnosed by an increase in follicle-stimulating hormone (FSH) of higher than 25mIU/ml, repeated twice over 4 weeks [1]. Antimullerian hormone (AMH) is produced by the granulosa cells of growing follicles and is of considerable value in the timely detection of POI. Ovarian reserve can be detected by transvaginal ovarian ultrasound and estimated by AMH levels in POI cases [2]. The prevalence of POI was mainly considered 1 -1.5%. However, a recent meta-analysis reported a global prevalence of 3.7% with a higher rate in medium and low developed countries [3]. In the aetiology of POI, a wide range of explanations have been considered including involvement of infectious, autoimmune, iatrogenic or genetic factors. Among them, genetic aberrations account for approximately 20–25% of cases. FMR1 permutation is the most common genetic abnormality in POI, followed by bone morphogenetic protein 15 (BMP15) gene defects [4]. BMP15 gene is located on Xp11.2 and encodes a 392- amino acid protein of transforming growth factor-β superfamily (TGF-β). The protein is composed of the signal peptide, prodomain and transforming growth factor β- like (TGFβ-like) domain [5]. BMP15 is expressed in oocytes and acts synergically with growth differentiation factor 9 (GDF9) towards the regulation of folliculogenesis [6]. Using a mouse model, it has been shown that BMP15 promote follicular development along with FSH [7]. In vitro study revealed that the simultaneous addition of GDF9 and BMP15 to the culture leads to improvement of the human primordial follicles activation [8]. BMP15 peptides either form homodimers or bind to GDF9 and make heterodimers called cumulin. Dimerization occurs via the TGFβ-like domain. A furin-like protease cleaves prodomain upon protein maturation, however, prodomain remains associated with secreted mature dimer. BMP15 and cumulin control the migration and proliferation of primordial germ cells through separate signal pathways [9, 10]. Pathogenic mutations can disrupt the transcription/translation of BMP15 protein or weaken the interaction with GDF9 [11]. Preliminary studies on knockout models have shown that GDF-9 deficiency led to impaired folliculogenesis and infertility, while a null mutation in the BMP-15 gene caused only reduced fertility in female mice [12]. Subsequent studies suggested differences in BMP15 function between mice and other mammals. A study aiming to identify factors regulating ovulation rate in sheep found that heterozygous carriers of BMP15 mutation had increased ovulation while homozygous were infertile [13]. Additional evidence from the porcine knockdown model confirmed that the role of BMP15 in single-ovulatory species is more pronounced than in multi-ovulatory species [14]. This difference is explained in the balance of GDF9 and BMP15. The dominance of GDF9 signaling leads to multiple ovulations and high fertility, whereas the production of BMP15 modulate pri-mordial germ cell sensitivity to gonadotropins and leads to single ovulation, low fertility and appropriate ovarian reserve [15]. Considering the importance of BMP15 in the pathogenesis of POI, we aimed to investigate the related mutations in a population of affected Iranian women. We further conducted predictive bioinformatics analysis in a comprehensive manner, to evaluate BMP15 gene alterations linked to POI.

Methods

Patients

This study was approved by the Ethics Committee of Tarbiat Modares University, Tehran, Iran (IR.MODARES.REC.1399.006). The clinical interpretation was performed based on the European society of human reproduction and embryology (ESHRE) guidelines [2]. All participants delivered written informed consent before participating in the study. Physical examination, blood testing and sonography were performed as part of routine clinical workup by the experienced gynecologists. Twenty four normal-karyotype women with idiopathic secondary amenorrhea before the age of 40 were entered into our study. Based on the genetic counselling, patients were further allocated into sporadic and familial groups. Having at least two serum FSH levels higher than 25mIU/ml was the main inclusion criteria. The exclusion criteria comprised any of the following: chromosomal aberrations including FMR1 premutation, personal or family history of autoimmune diseases, ovarian surgery, radiotherapy or chemotherapy. To rule out autoimmune disease, related serological tests containing thyroid peroxidase antibody, anti-tissue transglutaminase IgG and thyroglobulin antibody were checked.

DNA extraction and PCR-Sequencing

Genomic DNA was extracted from whole blood samples using the salting-out method. The purity and concentration of the extracted DNA were measured by spectrophotometry. Specific primers were designed for two exons of BMP15 using Oligo explorer and Primer Express software as follows: exon1F;GTTGTGGAGCCAGGATGCAG, exon1R;AAGCCTGACAGTAAACCCACC, exon2F;AATTTTAGGGCTGATTATAGC, exon2R;TTGGTACAGGATTACTTGCAG. To perform the PCR reaction, 2X PCR master mix (Amplicon, Pishgam, Iran) containing an ultimate concentration of 1.5 mM MgCl2 was used in a final volume of 50 µl. The PCR program included 5 min initial priming at 95 °C and then 30 cycles with 30 s at 95 °C, 30 s at 59 °C, 30 s at 72 °C with a final extension of 72 °C for 10 min. The PCR products were electrophoresed on 1.5% agarose gel along with the 100 base pairs DNA marker. Bi-directional Sanger sequencing was performed on all samples across two coding exons and flanking intronic sequences. Sanger sequencing results were interpreted using the Chromas software version 2.01.

In silico analysis

The probable pathogenic effect of the amino acid changes was detected by SIFT, PolyPhen, etc., which were integrated into the Ensembl Variant Effect Predictor (VEP) https://asia.ensembl.org/Homo_sapiens/Tools/VEP?db=core. The prevalence of the variants was checked on the Iranome website http://www.iranome.ir/. The Iranome browser represents whole-exome sequencing data of 800 healthy individuals from eight Iranian major ethnic groups with the approximate 1:1 Female/Male ratio. All samples were selected from individuals who were > 30 years old to reduce the bias of late-onset Mendelian disorders. The mean age at blood draw was 50.61 ± 9.33, and the age range 30–84 years old in the whole project [16]. Structural modeling of BMP15 wild-type and missense variants were computed by the SWISS-MODEL servers. The protein models were assessed using the Ramachandran plot from the MolProbity program.

Statistical analyses

The collected clinical data were statistically analyzed using SPSS version 24 with a significance level chosen at 5%. Correlation studies of the quantitative and qualitative data were performed by ANOVA and Chi-square tests, respectively.

Results

Clinical status of patients

All of the patients had spontaneously entered menarche and none of the patients was exhibited primary amenorrhea. The mean age at menarche was calculated at 13.12 ± 1.56 years old. The mean age at POI diagnosis was 26.84 ± 9.07 years old ranged from 12 to 39. Median and mean levels of serum FSH were 40.8 and 75.92 mIU/ml, respectively. The analyses of AMH serum levels were available for 19 out of 24 patients and the majority of them were below 0.02ng/ml. The sonographic evaluation revealed that 79.16% of the patients had atrophic ovaries and 20.83% had normal ovarian pattern. Patients’ interviews and genetic counselling disclosed that 6 out of 24 cases had a family history of menstrual irregularities, infertility and/or secondary amenorrhea.

BMP15 genotyping

As shown in Fig. 1, by the PCR-sequencing analysis of BMP15, we discovered p.N103K, p.A180T, and p.M184T heterozygous variants in 3 unrelated patients. This is the first report of the link between p.N103K and p.M184T to the POI pathogenesis.
Fig. 1

Electropherogram analysis of mutations and SNP alleles in unrelated POI patients

Electropherogram analysis of mutations and SNP alleles in unrelated POI patients The patient carrier of p.N103K variant entered menarche at the age of 16 and secondary amenorrhea happened when she was at the age of 17. As specified in Table 1, elevated FSH levels and a low normal range of AMH were detected in this patient. The sonographic evaluation exhibited an atrophic ovaries pattern. She was born from a consanguineous background without any indication of POI or related conditions in her family members.
Table 1

Identified variants and clinical characteristics of the patients according to the ESHRE guideline

VariantCurrent Age(yrs.)Age atMenarche(yrs.)Patternsof mensesatDiagnosisAge atDiagnosis(yrs.)Sonographic finding atDiagnosisFSH(mIU/mL)atDiagnosisAMH(ng/ml)atDiagnosisMaternal Parity
p.N103S2913Secondary Amenorrhea17Atrophic Ovaries1350.01-
p.N103K2016Secondary Amenorrhea17Atrophic Ovaries400.82-
p.A180T4213

Irregular menses

(Oligomenorrhea more than 18 months)

39Normal Ovaries300.03One Child
p.M184T3316Secondary Amenorrhea31

Atrophic

Ovaries

1000.01One Child
Identified variants and clinical characteristics of the patients according to the ESHRE guideline Irregular menses (Oligomenorrhea more than 18 months) Atrophic Ovaries p.M184T was detected in a sporadic POI patient who was prematurely menopaused at the age of 31. High FSH levels of 100mIU/ml and very low levels of AMH were detected by hormonal profiling. Ultrasound examination showed an atrophic pattern in both ovaries. Detailed family history revealed that the parents were not relatives and there was no history of POI and/or related disorders among her relatives. We identified p.A180T in a 42-years-old patient who was a descendant of consanguineous marriage with a familial history of POI. She had been diagnosed at age of 39 following a history of oligomenorrhea for more than 18 months. The hormonal assessment showed high FSH and very low AMH levels. The sonographic evaluation indicated normal ovarian status (Table 1). We also detected two known variants of BMP15; c.-9 C > G and p.N103S [17]. Previous studies from Syria and India reported the p.N103S, in both cases and controls [18, 19]. This variant is mentioned in the ClinVar database as a benign variant causing ovarian dysgenesis. The annotation of its corresponding allele, c.308 A > G showed an allele frequency of 0.057 and 0.028 in gnomAD and 1000 Genome, respectively. Iranome browser specified a high c.308 A > G allele frequency of 0.075 in the Iranian population. In our study 1 out of 24 patients (1/48 alleles) was the carrier of this SNP variant.

rs3810682, c.-9 C > G

The 5`-UTR variant, c.-9 C > G, was detected in 29.16% of the patients, all in heterozygous status including 2 compound heterozygous with p.A180T and p.N103S. Statistical analysis was performed to calculate the correlation between c.-9 C > G SNP and clinicopathological parameters of the patients. Table 2 shows a statistically significant association between c.-9 C > G SNP and patients FSH levels (p value = 0.02).
Table 2

Correlation between the − 9G polymorphism and clinicopathological parameters of the patients,

Clinical Indicators-9G PolymorphismPchi-square
Yes (%)No (%)
Age at menopause (yrs.).470.50
<30 3 (42.9)10 (58.8)
≥30 4 (57.1)7 (41.2)
Age at menarche (yrs.).560.33
<13 5 (71.4)10 (58.8)
≥13 2 (28.6)7 (41.2)
FSH levels (mIU/ml) .02 4.88
<40 3 (42.9)1 (5.9)
≥40 4 (57.1)16 (94.1)
AMH levels (ng/ml).073.26
<.02 3 (50)10 (76.9)
≥.02 3 (50)3(23.1)
Sonographic findings.610.25
Normal Ovaries 1 (14.3)4 (23.5)
Atrophic Ovaries 6 (85.7)13 (76.5)
Correlation between the − 9G polymorphism and clinicopathological parameters of the patients,

In-silico analysis

Further in-silico analysis was conducted to search the effects of the newly identified p.N103K and p.M184T on protein biogenesis and function. Table 3 lists the in-silico predicted values of these mutations in comparison to previously reported nonsynonymous missense alterations of BMP15. The indicated data were extracted from the Ensembl VEP online tool.
Table 3

Variants annotation, allele frequencies and in-silico prediction of nonsynonymous missense alterations of BMP15

ReferencePosition/SubstitutionAmino acidsExistingvariantAFgnomADAFIranome AFSIFTPolyPhenCADDPHRED
[20]

13 A/C

50,910,796

AGT/CGT

S5R

rs113099187

CM0910176

0.03580.009278-

0.01

Deleterious

0.368

Benign

13.19
[19]

181 C/T 50,910,964

CGG/TGG

R61W

rs144392417

CM061653

---

0.24

Tolerated

0

Benign

9.513
[21]

202 C/T 50,910,985

CGG/TGG

R68W

rs104894763

CM061661

0.00050.0006997-

0

Deleterious

0.877

Possibly damaging

22.4
[19]

226 C/T

50,911,009

CGT/TGT

R76C

rs104894766

CM061662

COSV53141666

COSV99399454

0.00130.00041290.005625

0

Deleterious

0.959

Probably damaging

22.8
[19]

227G/A

50,911,010

CGT/CAT

R76Hrs1557279925 CM061656 COSV53140125-1.977e-05-

0.06

Tolerated

0.959

Probably damaging

20.8
[22]

242 A/G 50,911,025

CAT/CGT

H81Rrs781801740---

0.47

Tolerated

0.001

Benign

0.010
[19]

308 A/G

50,911,091

AAT/AGT

N103S

rs41308602

CM1513124

COSV53140249

0.02830.057070.07500

0.3

Tolerated

0

Benign

0.190

309T/G

50,911,092

AAT/AAG

N103K - - - -

0.35

Tolerated

0.006

Benign

3.452
[23]

G/C 50,915,834

GTT/CTT

V136Lrs1387861526-5.465e-06-

0.02

Deleterious

0.292

Benign

15.84
[20]

413G/A

50,915,841

CGC/CAC

R138H

rs371418883

CM092909

COSV53139787

-3.281e-05-

0.56

Tolerated

0.854

Possibly damaging

9.814
[20]

443T/C

50,915,871

CTC/CCC

L148P

rs114823607

CM061658

0.01090.003174-

0

Deleterious

0.987

Probably damaging

23.0
[21]

538G/A

50,915,966

GCT/ACT

A180T

rs104894767

CM061654

CX062295

COSV53141311

0.00320.010010.006875

0.33

Tolerated

0.007

Benign

0.059

551T/C

50,915,979

ATG/ACG

M184T - - - -

0.13

Tolerated

0.003

Benign

7.245
[22]

581T/C

50,916,009

TTC/TCC

F194Srs1412185180.00080.0020450.001250

0.09

Tolerated

0.003

Benign

13.02
[19]

588T/A 50,916,016

AAT/AAA

N196KCM061651---

0.07

Tolerated

0.027

Benign

6.408
[22]

595 G/A 50,916,023

GGA/AGA

G199Rrs782378869 COSV53142031-2.181e-05-

0.54

Tolerated

0.018

Benign

0.415
[24]

598 C/T

50,916,026

CAC/TAC

H200Yrs2021658520.00030.0002781-

0.53

Tolerated

0.001

Benign

2.424
[19]

617G/A

50,916,045

CGT/CAT

R206H

rs782516193

CM061657

-6.543e-05-

0.46

Tolerated

0.003

Benign

0.734
[19]

661 T/C 50,916,089

TGG/CGG

W221Rrs375284458 CM0616590.00030.000398-

0.13

Tolerated

0.174

Benign

11.79
[25]

704 A/G

50,916,132

TAT/TGT

Y235C

rs104894765

CM041254

---

0

Deleterious

0.95

Probably damaging

22.7
[24]

985 C/T

50,916,413

CGC/TGC

R329C

rs782375794

CM100080

COSV99399521

-1.653e-05-0.02 Deleterious0.916 Probably damaging22.5
[26]

986G/A 50,916,414

CGC/CAC

R329Hrs782306478-1.1e-05-

0.57

Tolerated

0.007

Benign

0.095
[27]

1070G/A 50,916,498

TGT/TAT

C357Yrs1557280378-1.097e-05-

0

Deleterious

1

Probably damaging

24.3

AF Frequency of existing variants in 1000 genomes combined population, gnomAD AF Frequency of existing variants in gnomAD exomes combined population, Iranome AF Allele frequency in Iranome database

Variants annotation, allele frequencies and in-silico prediction of nonsynonymous missense alterations of BMP15 13 A/C 50,910,796 AGT/CGT rs113099187 CM0910176 0.01 Deleterious 0.368 Benign 181 C/T 50,910,964 CGG/TGG rs144392417 CM061653 0.24 Tolerated 0 Benign 202 C/T 50,910,985 CGG/TGG rs104894763 CM061661 0 Deleterious 0.877 Possibly damaging 226 C/T 50,911,009 CGT/TGT rs104894766 CM061662 COSV53141666 COSV99399454 0 Deleterious 0.959 Probably damaging 227G/A 50,911,010 CGT/CAT 0.06 Tolerated 0.959 Probably damaging 242 A/G 50,911,025 CAT/CGT 0.47 Tolerated 0.001 Benign 308 A/G 50,911,091 AAT/AGT rs41308602 CM1513124 COSV53140249 0.3 Tolerated 0 Benign 309T/G 50,911,092 AAT/AAG 0.35 Tolerated 0.006 Benign G/C 50,915,834 GTT/CTT 0.02 Deleterious 0.292 Benign 413G/A 50,915,841 CGC/CAC rs371418883 CM092909 COSV53139787 0.56 Tolerated 0.854 Possibly damaging 443T/C 50,915,871 CTC/CCC rs114823607 CM061658 0 Deleterious 0.987 Probably damaging 538G/A 50,915,966 GCT/ACT rs104894767 CM061654 CX062295 COSV53141311 0.33 Tolerated 0.007 Benign 551T/C 50,915,979 ATG/ACG 0.13 Tolerated 0.003 Benign 581T/C 50,916,009 TTC/TCC 0.09 Tolerated 0.003 Benign 588T/A 50,916,016 AAT/AAA 0.07 Tolerated 0.027 Benign 595 G/A 50,916,023 GGA/AGA 0.54 Tolerated 0.018 Benign 598 C/T 50,916,026 CAC/TAC 0.53 Tolerated 0.001 Benign 617G/A 50,916,045 CGT/CAT rs782516193 CM061657 0.46 Tolerated 0.003 Benign 661 T/C 50,916,089 TGG/CGG 0.13 Tolerated 0.174 Benign 704 A/G 50,916,132 TAT/TGT rs104894765 CM041254 0 Deleterious 0.95 Probably damaging 985 C/T 50,916,413 CGC/TGC rs782375794 CM100080 COSV99399521 986G/A 50,916,414 CGC/CAC 0.57 Tolerated 0.007 Benign 1070G/A 50,916,498 TGT/TAT 0 Deleterious 1 Probably damaging AF Frequency of existing variants in 1000 genomes combined population, gnomAD AF Frequency of existing variants in gnomAD exomes combined population, Iranome AF Allele frequency in Iranome database The newly identified p.N103K was not annotated on gnomAD, 1000 Genome or dbSNP. Investigation on the Iranome database revealed that p.N103K did not occur in 800 healthy Iranians. The SIFT and PolyPhen results showed scores of 0.35 and 0.006, respectively. In the same way, the p.M184T new mutation was not annotated in databases. Bioinformatics analysis showed scores of 0.13 and 0.003 by the SIFT and PolyPhen prediction tools, respectively. Figure 2 shows the conserved score of the M184 and N103 residues among different species indicating a higher score for M184. Both mutations are located in the secondary structure elements of the prodomain (Fig. 3B), which are essential for regulating mature protein production, secretion, and activity. M184 and N103 are present in β6 and β1` sheet of the peptide structure, respectively [26]. As shown in Fig. 3 A, M184 and A180 are situated in the same β-sheet of the peptide structure.
Fig. 2

The conservation scores of the first 200 amino acids of BMP15 protein among different species. Blue and red lines show the two side of the spectrum from amino acid insertions or differences with the lowest degree of conservation to sequence identity among different species, respectively. Black arrows indicate the score of N103 and M184 residues, respectively. Analyzed on https://www.ibi.vu.nl/programs/pralinewww/

Fig. 3

In A, the location of N103, A180 and M184 are shown. B indicates the location of reported nonsynonymous missense alterations of BMP15. Most of the variants are located on prodomain except for p.R329C, p.R329H and p.C357Y which are located on the mature TGFβ-like domain

The conservation scores of the first 200 amino acids of BMP15 protein among different species. Blue and red lines show the two side of the spectrum from amino acid insertions or differences with the lowest degree of conservation to sequence identity among different species, respectively. Black arrows indicate the score of N103 and M184 residues, respectively. Analyzed on https://www.ibi.vu.nl/programs/pralinewww/ In A, the location of N103, A180 and M184 are shown. B indicates the location of reported nonsynonymous missense alterations of BMP15. Most of the variants are located on prodomain except for p.R329C, p.R329H and p.C357Y which are located on the mature TGFβ-like domain

Modelling and Mapping of the wild-type and missense variants

Figure 4 A shows molecular modeling of wild-type M184 and N103 as compared with mutant T184 and K103, respectively. The results confirmed the localization of amino acids on the protein β-sheet structures. Figure 4B provides Ramachandran plots exhibiting Φ/Ψ backbone dihedral angles of the wild- type and mutant proteins. The wild-type showed 88.4% and 4.03% residues in the favored and outliers regions of the plot. The generated model for M184T was found to have fewer residues in the favored region (87.6%). The Rotamer Outliers was also increased for the M184T (0.79%) vs. wild- type (0.16%) which indicates a decrease in protein stability. The mutant N103K displayed the same configuration as that of the wild-type structure.
Fig. 4

 A Modeled BMP15 amino acid replacement on the three-dimensional structure. B General (no proline or glycine) Ramachandran plots of the BMP15 wild-type, M184T and N103K proteins which were provided by SWISS-MODEL online server. The different colored areas correspond to favored, allowed, generously allowed and sterically disallowed conformations

A Modeled BMP15 amino acid replacement on the three-dimensional structure. B General (no proline or glycine) Ramachandran plots of the BMP15 wild-type, M184T and N103K proteins which were provided by SWISS-MODEL online server. The different colored areas correspond to favored, allowed, generously allowed and sterically disallowed conformations

Segregation analysis of the p.A180T

As mentioned earlier, p.A180T was found in a patient with a family history of POI. The c.538G˃A missense variant located in exon 2 of BMP15 is presented in databases as the rs104894767. As illustrated in the family pedigree, two older sisters of the proband were also reached menopause before the age of 40, however, their mother entered physiological menopause at the age of 55. By Sanger sequencing, the c.538G˃A variant was analyzed in the female family members. The obtained results indicated a heterozygote alteration in the 64-years-old mother and one of the affected sisters who was menopaused at 35. The other POI sister with menopause at 40 and the 43-years-old healthy sister with regular menses did not carry the p.A180T variant (Fig. 5).
Fig. 5

Family pedigree shows the proband (arrow) and the rest of the affected family members with POI presented in colored circles. Genotyping of BMP15 is indicated below the symbols, with the A180T heterozygote variant

Family pedigree shows the proband (arrow) and the rest of the affected family members with POI presented in colored circles. Genotyping of BMP15 is indicated below the symbols, with the A180T heterozygote variant

Discussion

In this study, we provided the molecular analysis of the BMP15 gene in a series of unrelated Iranian women with idiopathic POI. Our results revealed two novel variants; p.N103K and p.M184T as well as one known substitution; p.A180T. With the development of next-generation sequencing, several new genes have been linked to the disease pathogenesis which supports the concept of POI heterogeneity. Investigation of copy number variations led to the identification of microdeletions/microduplications on multiple chromosomal regions. Using high-resolution SNP arrays a 4 MB deletion in Xp11.23-p11.22 was discovered in a patient with secondary amenorrhea at the age of 34. This deletion consists of 65 genes, including the entire BMP15 [28]. A more recent study reported the deletion of both paternal and maternal copies of BMP15 in a 16-year-old patient with primary amenorrhea and FSH levels of 141mIU/ml. The deletion expanded 36 KB and contained the entire BMP15 in the Xp11.22 region. In addition, the study showed intragenic duplication of the tumor protein P63 (TP63) gene in two sisters who were also the carrier of BMP15 p.Y235C [29]. Remarkably, p.Y235C is the first discovered BMP15 mutation that was reported in 2004 in the heterozygous Italian sisters [25]. The same research group further identified p.R68W and p.A180T alterations in non-familial POI patients in 2006 [21]. In 2009 they repeated the BMP15 gene screening in 300 patients and found p.R138H and p.L148P in the prodomain region. They also reported p.S5R mutation which is localized in the signal peptide of the nascent protein. By conducting a functional in vitro assay in the human granulosa cell line, they disclosed that p.R68W, p.L148P and p.R138H cause the reduction of mature BMP15 protein. While p.A180T or p.S5R displayed no deleterious impact on protein secretion or function [20]. However, in 2017, Patiño et al. estimated four-fold lower activity of p.A180T compared to wild-type BMP15. They evaluated the expression and activity of 10 BMP15 variants and showed that these nucleotide changes could reduce mature peptide production, activity or synergy with GDF9 [26]. The obtained results regarding p.A180T remained conflicting, as in several studies it was only detected in patients [11, 19], while in others, both in patients and controls [22, 30]. Based on the Iranome database, the allele frequency of the p.A180T in the Iranian healthy population is 0.006. In our study, we found the p.A180T variant in a POI patient who was born from a consanguineous marriage with a family history of POI. Segregation analysis confirmed that the p.A180T could not be the causative mutation in this family. Modifier genes and SNPs should be considered as the influential factors in the genotype/phenotype correlation. We further identified p.N103K missense heterozygote transition. This new BMP15 mutation was detected in the offspring of first-cousin parents without any family history of POI. Our next newly identified missense heterozygote substitution; p.M184T was identified in a sporadic POI case exhibiting high FSH levels. Since p.N103K and p.M184T are not annotated in the reference databases it can be assumed that these new variants are possibly pathogenic. Their placement in the functional regions of the protein supports this conclusion. Figure 3B indicates that p.N103K and p.M184T are localized on the prodomain region of the protein. The prodomain is cleaved during the maturation process and remains non-covalently bound to the homo or heterodimers upon secretion. The folding and dimerization of the mature protein are regulated by the prodomain [31]. It has been shown that prodomain mutations can prevent its binding to mature dimers leading to decreased BMP15 activity [32]. As mentioned previously, BMP15 reduction is correlated to increased ovulation rate and the chance of dizygotic twins’ pregnancy. This increase in ovulation can eventually lead to ovarian depletion and POI [33]. It should be noted that sheep BMP15 mutations have often been occurred in the mature protein, while most human BMP15 mutations are prodomain variants [26]. Nonsynonymous missense variants of BMP15 that are listed in Table 3 are prodomain alterations except for; p.R329C, p.R329H and p.C357Y which are located on the mature TGFβ-like domain. In 2018, Zhang et al. reported homozygous p.C357Y mutation in the TGFβ-like domain. To our knowledge, this is the sole described homozygous nonsynonymous missense variant of the BMP15. The patient`s heterozygous mother was 48 years old with normal menstrual cycles. They assumed that the mutations in the TGFβ-like domain should be homozygous to cause the disease while the heterozygous mutations of the prodomain are sufficient for defective protein maturation and POI [27]. However, Patiño et al. reported another mutation in TGFβ-like domain; p.R329H, in a heterozygous POI patient [26]. The p.R329C mutation of the mature subunit was reported earlier from China. The patient was a 37-year-old woman who developed secondary amenorrhea at the age of 27. The patient’s mother had irregular menses and menopause at the age of 40. The data on hetero or homozygosity of these mother and daughter is not available [24]. More recently, Rossetti et al. examined p.R329C mutation, functionally. The results showed that heterozygote p.R329C mutation led to disrupted co-localization with GDF9 and SMAD pathway activation [34]. We found p.N103K and p.M184T in the heterozygous patients, like almost all previously reported BMP15 mutations [23]. This feature was often concluded by haploinsufficiency or negative dominance effects. However, the discovery of intragenic duplication of the TP63 in the carriers of p.Y235C has added to the complexity of interpreting the BMP15 mutations.

Conclusions

In this study, we found two new variants in the BMP15 gene that have not been reported in databases. These mutations were not identified in 800 Iranians whole-exome sequencing results available on Iranom’s website. The p.N103K and p.M184T are localized on the prodomain region of the protein. Due to the cleavage of prodomain during BMP15 maturation, bioinformatics analyzes are likely to underestimate the effects of the mutations. This is while prodomain is actively involved in the homo and heterodimers secretion and function. Further studies to elucidate the roles of the prodomain could be of great value in identifying the effects of multiple mutations reported in this region.
  33 in total

1.  BMP15, fertility and the ovary.

Authors:  Ronit Abir; Benjamin Fisch; Martin H Johnson
Journal:  Reprod Biomed Online       Date:  2014-09-18       Impact factor: 3.828

2.  Invited commentary: a single nucleotide polymorphism in BMP15 is associated with high response to controlled ovarian hyperstimulation.

Authors:  Ronit Abir; Benjamin Fisch
Journal:  Reprod Biomed Online       Date:  2011-04-06       Impact factor: 3.828

3.  Missense mutations in the BMP15 gene are associated with ovarian failure.

Authors:  Hridesh Dixit; Lakshmi K Rao; Venkata V Padmalatha; Murthy Kanakavalli; Mamata Deenadayal; Nalini Gupta; Baidyanath Chakrabarty; Lalji Singh
Journal:  Hum Genet       Date:  2006-03-01       Impact factor: 4.132

4.  Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function.

Authors:  C Yan; P Wang; J DeMayo; F J DeMayo; J A Elvin; C Carino; S V Prasad; S S Skinner; B S Dunbar; J L Dube; A J Celeste; M M Matzuk
Journal:  Mol Endocrinol       Date:  2001-06

5.  Integral role of GDF-9 and BMP-15 in ovarian function.

Authors:  Fumio Otsuka; Kirsten J McTavish; Shunichi Shimasaki
Journal:  Mol Reprod Dev       Date:  2011-01-11       Impact factor: 2.609

Review 6.  Molecular Aspects and Clinical Relevance of GDF9 and BMP15 in Ovarian Function.

Authors:  Martina Belli; Shunichi Shimasaki
Journal:  Vitam Horm       Date:  2018       Impact factor: 3.421

7.  BMP15 mutations in XX gonadal dysgenesis and premature ovarian failure.

Authors:  Susanne Ledig; Albrecht Röpke; Gabriele Haeusler; Bernd Hinney; Peter Wieacker
Journal:  Am J Obstet Gynecol       Date:  2007-09-12       Impact factor: 8.661

8.  ESHRE Guideline: management of women with premature ovarian insufficiency.

Authors:  L Webber; M Davies; R Anderson; J Bartlett; D Braat; B Cartwright; R Cifkova; S de Muinck Keizer-Schrama; E Hogervorst; F Janse; L Liao; V Vlaisavljevic; C Zillikens; N Vermeulen
Journal:  Hum Reprod       Date:  2016-03-22       Impact factor: 6.918

9.  Fundamental role of BMP15 in human ovarian folliculogenesis revealed by null and missense mutations associated with primary ovarian insufficiency.

Authors:  Raffaella Rossetti; Ilaria Ferrari; Ilaria Bestetti; Silvia Moleri; Francesco Brancati; Luisa Petrone; Palma Finelli; Luca Persani
Journal:  Hum Mutat       Date:  2020-02-06       Impact factor: 4.878

Review 10.  Clinical practice. Primary ovarian insufficiency.

Authors:  Lawrence M Nelson
Journal:  N Engl J Med       Date:  2009-02-05       Impact factor: 91.245

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.