| Literature DB >> 35214887 |
Maria Celeste Dias1, Conceição Santos2,3, Márcia Araújo1,3, Pedro M Barros4, Margarida Oliveira4, José Miguel P Ferreira de Oliveira5.
Abstract
Cork oak (Quercus suber) is a species native to Mediterranean areas and its adaptation to the increasingly prevalent abiotic stresses, such as soil salinization, remain unknown. In sequence with recent studies on salt stress response in the leaf, it is fundamental to uncover the plasticity of roots directly exposed to high salinity to better understand how Q. suber copes with salt stress. In the present study we aimed to unveil the antioxidants and key-genes involved in the stress-responses (early vs. later responses) of Q. suber roots exposed to high salinity. Two-month-old Q. suber plants were watered with 300 mM NaCl solution and enzymatic and non-enzymatic antioxidants, lipid peroxidation and the relative expression of genes related to stress response were analysed 8 h and 6 days after salt treatment. After an 8 h of exposure, roots activated the expression of QsLTI30 and QsFAD7 genes involved in stress membrane protection, and QsRAV1 and QsCZF1 genes involved in tolerance and adaptation. As a result of the continued salinity stress (6 days), lipid peroxidation increased, which was associated with an upregulation of QsLTI30 gene. Moreover, other protective mechanisms were activated, such as the upregulation of genes related to antioxidant status, QsCSD1 and QsAPX2, and the increase of the antioxidant enzyme activities of superoxide dismutase, catalase, and ascorbate peroxidase, concomitantly with total antioxidant activity and phenols. These data suggest a response dependent on the time of salinity exposure, leading Q. suber roots to adopt protective complementary strategies to deal with salt stress.Entities:
Keywords: AP2/ERF family transcription factors; dehydrins; membrane protection; oxidative stress; salinization; zinc finger CCCH domain-containing proteins
Year: 2022 PMID: 35214887 PMCID: PMC8875824 DOI: 10.3390/plants11040557
Source DB: PubMed Journal: Plants (Basel) ISSN: 2223-7747
Figure 1Root total antioxidant activity (A), total phenol content (B), and malondialdehyde level (C) in Q. suber roots under control and salinity conditions (8 h and 6 days after 300 mM NaCl treatment). White bars: control; black bars: 8 h; grey bars: 6 days. Values are mean ± SEM (n = 6). Letters indicate significant differences between groups (p < 0.05).
Figure 2Relative expression levels of genes encoding antioxidant enzymes (A) and antioxidant enzyme activities (CAT—catalase, SOD—superoxide dismutase, and APX—ascorbate peroxidase) (B) in Q. suber roots under control and salinity conditions (8 h and 6 days after 300 mM NaCl treatment). The target genes were: copper/zinc superoxide dismutase (QsCSD1), manganese superoxide dismutase (QsMSD1), catalase (QsCAT2), and ascorbate peroxidase 2 (QsAPX2). White bars: control; black bars: 8 h; grey bars: 6 days. Values are mean ± SEM (n = 3–6). For each gene or enzyme different letters indicate significant differences between control and salinity treatments (p < 0.05).
Figure 3Relative expression levels of genes encoding stress biomarkers in Q. suber roots under control and salinity conditions (8 h and 6 days after 300 mM NaCl treatment). Values are mean ± SEM (n = 6). For each gene, different letters indicate significant differences between control and salinity treatments (p < 0.05).
Figure 4Correlation and PCA of the data. (A) Pearson correlation coefficients indicate negative (blue) or positive (red) correlations. * p < 0.05; ** p < 0.01.; (B) PCA biplot of the data in Q. suber. C—control, 8 h—8 h after NaCl treatment, and 6 d—6 days after NaCl treatment.
Primers used for qPCR.
| Primers (5′—3′) | Target RNA | Tblastx E-Value (Coverage) | |
|---|---|---|---|
| F_CTGAGCGGGAAATTGTTCGTG; R_GCAGTCTCCAACTCCTGCTC | actin (XM_024037498.1) | 0.0 (70%) | |
| F_TACTGTCCCAGAGCTCACCC; R_CACGGAACATAGCTGAGGCA | tubulin (KJ563262.1) | 0.0 (96%) | |
| F_CGCTCTTGGAGACACAACAA; R_CCATCAGCACCAACATTGAC | superoxide dismutase [Cu-Zn] 4A (XM_024050079.1) | 3 × 10−87 (59%) | |
| F_CCTTCTCTCTTCCCGATCTCTC; R_GGAGTCGCCTTTAGCGATG | superoxide dismutase [Mn] (XM_024016741.1) | 2 × 10−124 (54%) | |
| F_GCTAGGGGAGCTAGTGCAAAG; R_CAGGGTTTCAGGGCTACCA | catalase isozyme 3-like (XM_024064618.1) | 0.0 (81%) | |
| F_CGGATCATCTGAGGGATGTATT; R_CAAAAATAAGAGGGTTGCTGGTC | L-ascorbate peroxidase, cytosolic (XM_024061016.1) | 2 × 10−138 (61%) | |
| F_GCTCCTTGAGGCATCACACT; R_AGGCGATGGAGTTGGTTCTG | Zn finger CCCH domain-containing protein 29-like (XM_024044287.1) | 0.0 (58%) | |
| F_GCCGTTATCTCCGCATCCTT; R_CCACCAGCACCATTAGCAGA | E-responsive TF ERF105-like (XM_024066622.1) | 4 × 10−26 (24%) | |
| F_GACCCACCTCATACAAGCCC; R_TTAGCCCCCAGTTCCTGTCT | omega-3 fatty acid desaturase (XM_024037902.1) | 2 × 10−135 (38%) | |
| F_ATATGGCAACCCAACCCACC; R_CATACCTTGGAGAGTGGCGG | dehydrin Xero 1-like (XM_024052398.1) | 2 × 10−13 (46%) | |
| F_AAGCCGGTTCAACTTTCCCA; R_CGCGTGAACAGCTTTTTGAGA | AP2/ERF and B3 domain-containing TF RAV1-like (XM_024016479.1) | 2 × 10−102 (66%) |