| Literature DB >> 35211153 |
Wen Zhang1,2, Xiao Yan Zhao1, Jie Wu1, Ling Jin1, Jianjian Lv1,3, Baoquan Gao1,3, Ping Liu1,3.
Abstract
Salt-alkali tolerance is one of the important breeding traits of Portunus trituberculatus. Identification of molecular markers linked to salt-alkali tolerance is prerequisite to develop such molecular marker-assisted breeding. In this study, Bulked Segregant Analysis (BSA) was used to screen molecular markers associated with salt-alkali tolerance trait in P. trituberculatus. Two DNA mixing pools with significant difference in salt-alkali tolerance were prepared and 94.83G of high-quality sequencing data was obtained. 855 SNPs and 1051 Indels were firstly selected as candidate markers by BSA analysis, out of which, 20 markers were further selected via △index value (close to 0 or 1) and eight of those were successfully verified. In addition, based on the located information of the markers in genome, eight candidate genes related to salt-alkali tolerance were anchored including ubiquitin-conjugating enzyme, aspartate-tRNA ligase, vesicle-trafficking protein, and so on. qPCR results showed that the expression patterns of all these genes changed significantly after salt-alkali stress, suggesting that they play certain roles in salt-alkali adaptation. Our results will provide applicable markers for molecular marker-assisted breeding and help to clarify the mechanisms of salt-alkali adaptation of P. trituberculatus.Entities:
Keywords: BSA; INDEL; Portunus trituberculatus; SNP; salt-alkali
Year: 2022 PMID: 35211153 PMCID: PMC8861530 DOI: 10.3389/fgene.2022.755004
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primers used in this study.
| Primer ID | Primer sequence (5′-3′) |
|---|---|
| S1-F | AGGTCTCCCTCACAAACGC |
| S1-R | TGTGGATAGGAAAGGGTGAA |
| S2-F | CCATTACTTACTCTCACCATTTCAG |
| S2-R | CAACCTTGACGGAAACCATAC |
| S3-F | CTCACTTACCTGTCGTCACCTG |
| S3-R | GCACGCAGGTACTGAACATTT |
| S4-F | ACCACACCTGCCTAATCTACC |
| S4-R | CAAGATTCCAGTGTTTCTGTGAG |
| S5-F | AGTCACTATGAATGGCAAATATCTA |
| S5-R | CGGTTTGTAACTCTCGGGGT |
| I4-F | CTCTCCGCCAGCCCGCCATTAATGC |
| I4-R | TTACTTTCCATCCATCAGCC |
| I8-F | TGGGTGTTGTCAATCTGTGATGGCT |
| I8-R | CTGACTGACGAGACGACTGG |
| I9-F | TCGTCAGTCATCTTTCTTCTCTC |
| I9-R | TGTTTGGTTATTGGCGTTG |
Summary of sequencing data quality.
| Group | Raw data (bp) | Valid data after filtering (bp) | Efficient (%) | Error rate (%) | Q20 (%) | Q30 (%) | GC content%) |
|---|---|---|---|---|---|---|---|
| S | 45,854,625,300 | 45,753,784,500 | 99.78 | 0.04 | 93.81 | 87.06 | 40.62 |
| T | 49,159,475,100 | 49,083,786,900 | 99.85 | 0.04 | 93.92 | 87.31 | 40.86 |
Position information of candidate markers in the genome.
| Category | Number of SNPs | Number of Indels |
|---|---|---|
| Upstream | 12 | 27 |
| Exonic-Stop gain | 0 | 0 |
| Exonic-Stop loss | 0 | 0 |
| Exonic-Synonymous | 7 | 0 |
| Exonic-Non-synonymous | 2 | 0 |
| Intronic | 164 | 231 |
| Splicing | 0 | 0 |
| Downstream | 10 | 20 |
| Upstream/Downstream | 1 | 1 |
| Intergenic | 649 | 771 |
| Ts | 558 | |
| Tv | 297 | |
| Ts/tv | 1879 | |
| Total | 855 | 1051 |
Genotyping information statistics.
| Marker ID | Marker type | Genotype | Proportion of susceptible group | Proportion of tolerant group |
|
|---|---|---|---|---|---|
| S1 | A/G | GG:AG:AA | 18:2:0 | 4:10:6 | 0.000 |
| S2 | A/G | GG:AG:AA | 12:6:2 | 20:0:0 | 0.007 |
| S3 | A/G | GG:AG:AA | 15:1:0 | 6:10:0 | 0.001 |
| S4 | T/C | CC:CT:TT | 11:7:2 | 2:11:7 | 0.007 |
| S5 | A/G | GG:AG:AA | 0:3:17 | 12:0:8 | 0.000 |
| I4 | Indel | In:Del:Indel | 0:15:5 | 13:5:2 | 0.000 |
| I8 | Indel | In:Del:Indel | 5:2:13 | 18:0:2 | 0.000 |
| I9 | Indel | In:Del:Indel | 7:4:9 | 0:16:4 | 0.000 |
Annotation information of salt-alkali tolerance candidate genes.
| Gene ID | Category | △index | Annotation |
|---|---|---|---|
| Contig 574.9 | Intergenic | −0.92 | NR:Ubiquitin-conjugating enzyme E2 O [Zootermopsis nevadensis] |
| KEGG:ubiquitin-conjugating enzyme E2-230k, putative (EC:6.3.2.19) | |||
| K10581 ubiquitin-conjugating enzyme E2 O [EC:2.3.2.24] (A) | |||
| SwissProt:E2/E3 hybrid ubiquitin-protein ligase UBE2O OS = Mus musculus GN = Ube2o | |||
| PE = 1 SV = 3; IPR_id:NULL; IPR_Anno:NULL | |||
| Contig 11.37 | Intergenic | 0.74 | NR:hypothetical protein X975_00935, partial [Stegodyphus mimosarum] |
| KEGG:putative ZDHHC-type palmitoyltransferase 6; K20032 palmitoyltransferase ZDHHC13/17 [EC:2.3.1.225] (A); SwissProt:Espin OS = Mus musculus GN = Espn PE = 1 SV = 2 | |||
| IPR_id:NULL; IPR_Anno:NULL | |||
| Contig 272.2 | Intergenic | 0.71 | NR:PREDICTED: aspartate--tRNA ligase, mitochondrial [Tribolium castaneum] |
| KEGG:kinesin-6A; kinesin 6A; K17387 kinesin family member 23 (A) | |||
| SwissProt:Aspartate--tRNA ligase, mitochondrial OS = Rattus norvegicus GN = Dars2 PE = 1 SV = 1 | |||
| IPR_id:IPR008126; IPR_Anno:Outer membrane adhesion, Yersinia | |||
| Contig 159.21 | Intergenic | 0.78 | NR:PREDICTED: gamma-tubulin complex component 6 isoform X2 [Pogonomyrmex barbatus] |
| KEGG:TUBGCP6; tubulin, gamma complex associated protein 6 | |||
| K16573 gamma-tubulin complex component 6 (A) | |||
| SwissProt:Gamma-tubulin complex component 6 OS = Homo sapiens | |||
| GN = TUBGCP6 PE = 1 SV = 3; IPR_id:IPR007259; IPR_Anno:Spc97/Spc98 | |||
| Contig 105.16 | Intergenic | 0.79 | NR:PREDICTED: uncharacterized protein LOC105387196 [Plutella xylostella] |
| KEGG: ; SwissProt: ; IPR_id:NULL; IPR_Anno:NULL | |||
| Contig 48.16 | Intergenic | −0.77 | NR: ; KEGG: ; SwissProt:Transcription termination factor 1 OS = Homo sapiens |
| GN = TTF1 PE = 1 SV = 3; IPR_id:IPR005448; IPR_Anno:Voltage-dependent calcium channel, P/Q-type, alpha-1 subunit | |||
| Contig 2378.3 | Intergenic | 0.75 | NR:PREDICTED: vesicle-trafficking protein SEC22b-B [Fopius arisanus] |
| KEGG:vesicle-trafficking protein SEC22b-B; K08517 vesicle transport protein SEC22 (A) | |||
| SwissProt:Vesicle-trafficking protein SEC22b-B OS = Danio rerio | |||
| GN = sec22bb PE = 2 SV = 1; IPR_id:IPR002255; IPR_Anno:Flavin monooxygenase (FMO) 3 | |||
| Contig 370.5 | Intergenic | −0.72 | NR:PREDICTED: protein SMG5 [Acromyrmex echinatior] |
| KEGG:protein SMG5; K11125 protein SMG5 (A) | |||
| SwissProt:Protein SMG5 OS = Homo sapiens GN = SMG5 PE = 1 SV = 3 | |||
| IPR_id:IPR018834; IPR_Anno:DNA/RNA-binding domain, Est1-type |
FIGURE 1GO enrichment analysis of salt-alkali tolerance candidate genes.
FIGURE 2KEGG enrichment analysis of salt-alkali tolerance candidate genes.
FIGURE 3qPCR results of salt-tolerant-related genes.
FIGURE 4Heat map of salt-tolerant-related genes.