| Literature DB >> 35198541 |
Jungang Du1, Biao Ma1, Jiali Li1, Yaping Wang1, Tianyu Dou1, Shujuan Xu1, Mingzhou Zhang1.
Abstract
Legionella, a waterborne pathogen, is the main cause of Legionnaires' disease. Therefore, timely and accurate detection and differentiation of Legionella pneumophila and non-Legionella pneumophila species is crucial. In this study, we develop an easy and rapid recombinase polymerase amplification assay combined with EuNPs-based lateral flow immunochromatography (EuNPs-LFIC-RPA) to specifically distinguish Legionella pneumophila and non-Legionella pneumophila. We designed primers based on the mip gene of Legionella pneumophila and the 5S rRNA gene of non-Legionella pneumophila. The recombinase polymerase amplification reaction could go to completion in 10 min at 37°C, and the amplification products could be detected within 5 min with EuNPs-LFIC strips. Using a florescent test strip reader, the quantitative results were achieved by reading the colored signal intensities on the strips. The sensitivity was 1.6 × 101 CFU/ml, and a linear standard linear curve plotted from the test strip reader had a correlation coefficient for the determination of Legionella pneumophila (R 2 = 0.9516). Completed concordance for the presence or absence of Legionella pneumophila by EuNPs-LFIC-RPA and qPCR was 97.32% (κ = 0.79, 95% CI), according to an analysis of practical water samples (n = 112). In short, this work shows the feasibility of EuNPs-LFIC-RPA for efficient and rapid monitoring of Legionella pneumophila and non-Legionella pneumophila in water samples.Entities:
Keywords: Legionella pneumophila; europium nanoparticles; fluorescent immunochromatographic assay; recombinase polymerase amplification; simultaneous detection
Year: 2022 PMID: 35198541 PMCID: PMC8859533 DOI: 10.3389/fchem.2021.815189
Source DB: PubMed Journal: Front Chem ISSN: 2296-2646 Impact factor: 5.221
Information of bacterial strains used for specificity tests in the study.
| Strain number | Species | Id of strains | Result of eunps-lfic-rpa | |
|---|---|---|---|---|
|
| 5S rRNA gene | |||
| 1 |
| ATCC33152 | + | + |
| 2 |
| LP-002 | + | + |
| 3 |
| ATCC 43702 | − | + |
| 4 |
| ATCC 33877 | − | + |
| 5 |
| ATCC 33217 | − | + |
| 6 |
| ATCC 35072 | − | + |
| 7 |
| ATCC 49625 | − | + |
| 8 |
| ATCC 33342 | − | + |
| 9 |
| ATCC 35304 | − | + |
| 10 |
| ATCC 33462 | − | + |
| 11 |
| GIMCC1.345 | − | − |
| 12 |
| ATCC 13076 | − | − |
| 13 |
| GIMCC1.449 | − | − |
| 14 |
| GIMCC1.142 | − | − |
| 15 |
| SE-001 | − | − |
| 16 |
| GIMCC1.201 | − | − |
| 17 |
| ECO-071 | − | − |
| 18 |
| GIMCC1.843 | − | − |
| 1 |
| GIMCC 1.424 | − | − |
| 20 |
| CICC 10865 | − | − |
| 21 |
| ATCC17802 | − | − |
| 22 |
| VP-034 | − | − |
| 23 |
| ATCC19115 | − | − |
| 24 |
| CMCC 93026 | − | − |
Afforded by Zhejiang Academy of Science and Technology for Inspection and Quarantine; +: positive result; ‒: negative result.
GIMCC, Guangdong microbiology culture left, Guangdong, China; ATCC, American type culture collection, Virginia, United States; CICC, China left of industrial culture collection, Shanghai, China; CMCC, national left for medical culture collections, Beijing, China.
Sequences of Legionella for RPA and qPCR primers/probe.
| Primer name | Sequence (5′-3′) | Target gene | Fragment length |
|---|---|---|---|
| RPA primers and probes | |||
| Lep-RPA-F1 | 5′-GTCTTATAGCATTGGTGCCGATTTGGGG-3′ |
| 216 bp |
| Lep-RPA-R1 | 5′-Digoxin-CCTTTTACTTTATTTTCATCCGCTTTCTTA-3′ | ||
| Lep-RPA-P1 | 5′-Biotin-TAGCATTGGTGCCGATTTGGGGAAGAATTTT [THF]AAAAATCAAGGCAT-C3-Spacer | ||
| nLep-RPA-F2 | 5′-GCGATTTGGAACCACCTGATACCATCTCGA-3′ | 5S rRNA | 87 bp |
| nLep-RPA-R2 | 5′-Digoxin-CTGGCGATGACCTACTTTCGCATGAGGAAG-3′ | ||
| nLep-RPA-P2 | 5′-FAM-CCTGATACCATCTCGAACTCAGAAGTGAAACATTT [THF]CCGCGCCAATG-C3-Spacer | ||
| qPCR primers and probe | |||
| Lep-rtF1 | CAAGGCATAGATGTTAATCC |
| 81 bp |
| Lep-rtR1 | TTCGGTTAAAGCCAATTG | ||
| Lep-rtP1 | FAM-CCACTCATAGCGTCTTGCATG-BHQ1 | ||
FIGURE 1The schematic of EuNPs-LFIC-RPA assay.
FIGURE 2Parameter optimization of dual EuNPs-LFIC-RPA assay. (A) incubation time; (B) the concentration of magnesium ions.
FIGURE 3Sensitivity of EuNPs-LFIC-RPA and qPCR assays for Legionella pneumophila. Sensitivity was evaluated with Legionella pneumophila strain ranging from 1.6 × 107 to 1.6 × 100 CFU/ml. (A) The amplified products could be observed with lateral flow strips under 365 nm UV lamp. The intensity was used for quantitative analysis (plotted by Origin 8), and it shows a linear correlation with the concentration of pure cultures. (B) The qPCR assay used the same gradient concentration of pure cultures, and the standard curve was generated with the Bio-Rad CFX Manager.
FIGURE 4Specificity of EuNPs-LFIC-RPA and qPCR assays for Legionella pneumophila. (A,B) The light signal was read out by the FIC-S2011-B14 fluorescent strip reader. (C) The similar results obtained by qPCR assays.
Concordance between EuNPs-LFIC-RPA and qPCR tests in specimens for detection of Legionella pneumophila.
| Test result | Numbers of samples (%) with qPCR | Total numbers of samples (%) | Absolute agreement (%) | Kappa value (95% CI) | |
|---|---|---|---|---|---|
| Lep (+) | Lep (−) | ||||
| LF-RPA result | |||||
| Lep (+) | 6 | 2 | 8 (7.14) | 97.32 | 0.79 |
| Lep (−) | 1 | 103 | 104 (92.86) | ||
| Total | 7 (6.25) | 105 (93.75) | 112 | ||
CI, confidence interval; Lep (+) result refers to Legionella pneumophila detection, Lep (−) result reflects the absence of Legionella pneumophila.