Myofibers are the main components of skeletal muscle, which is the largest tissue in the body. Myofibers are highly adaptive and can be altered under different biological and disease conditions. Therefore, transcriptional and epigenetic studies on myofibers are crucial to discover how chromatin alterations occur in the skeletal muscle under different conditions. However, due to the heterogenous nature of skeletal muscle, studying myofibers in isolation proves to be a challenging task. Single-cell sequencing has permitted the study of the epigenome of isolated myonuclei. While this provides sequencing with high dimensionality, the sequencing depth is lacking, which makes comparisons between different biological conditions difficult. Here, we report the first implementation of single myofiber ATAC-Seq, which allows for the sequencing of an individual myofiber at a depth sufficient for peak calling and for comparative analysis of chromatin accessibility under various physiological and disease conditions. Application of this technique revealed significant differences in chromatin accessibility between resting and regenerating myofibers, as well as between myofibers from a mouse model of Duchenne Muscular Dystrophy (mdx) and wild-type (WT) counterparts. This technique can lead to a wide application in the identification of chromatin regulatory elements and epigenetic mechanisms in muscle fibers during development and in muscle-wasting diseases.
Myofibers are the main components of skeletal muscle, which is the largest tissue in the body. Myofibers are highly adaptive and can be altered under different biological and disease conditions. Therefore, transcriptional and epigenetic studies on myofibers are crucial to discover how chromatin alterations occur in the skeletal muscle under different conditions. However, due to the heterogenous nature of skeletal muscle, studying myofibers in isolation proves to be a challenging task. Single-cell sequencing has permitted the study of the epigenome of isolated myonuclei. While this provides sequencing with high dimensionality, the sequencing depth is lacking, which makes comparisons between different biological conditions difficult. Here, we report the first implementation of single myofiber ATAC-Seq, which allows for the sequencing of an individual myofiber at a depth sufficient for peak calling and for comparative analysis of chromatin accessibility under various physiological and disease conditions. Application of this technique revealed significant differences in chromatin accessibility between resting and regenerating myofibers, as well as between myofibers from a mouse model of Duchenne Muscular Dystrophy (mdx) and wild-type (WT) counterparts. This technique can lead to a wide application in the identification of chromatin regulatory elements and epigenetic mechanisms in muscle fibers during development and in muscle-wasting diseases.
Skeletal muscle evolved for contraction and the production of force. The main component of skeletal muscle are myofibers which are formed from the fusion of myogenic precursor cells (Buckingham et al., 2003) resulting in large postmitotic syncytia that are composed of repeating contractile units, called sarcomeres (Huxley and Hanson, 1954). Myofibers exhibit wide variations in their metabolic activity and contractile properties (Zierath and Hawley, 2004). In addition, they have a highly adaptive nature where their size, myosin heavy chain isoform, energy metabolism, and the overall skeletal muscle mass, among other characteristics, are regulated by complex processes involving rates of protein turnover (Bohé et al., 2001; Mittendorfer et al., 2005), as well as transcriptional (Quiat et al., 2011) and posttranscriptional (Weskamp et al., 2021) control of gene expression. Due to their adaptive nature, myofibers can change in response to exercise (Zierath and Hawley, 2004; Wilson et al., 2012; Dons et al., 1979), aging (Deschenes, 2004) and diseases, such as sarcopenia (Thompson, 2002; Nilwik et al., 2013) and cachexia (Roberts et al., 2013). Therefore, the study of the myofiber transcriptome and epigenome can provide key insights into how skeletal muscle adapts and changes under various stimuli, and it can potentially lead to the discovery of novel therapeutic venues for muscle related diseases.Myofibers also act as a key signaling component of muscle stem cells (MuSCs) (Lazure et al., 2020), which are in turn required for the regeneration of muscle fibers after injury (Snow, 1977; Shadrach and Wagers, 2011; Dumont et al., 2015). Skeletal muscle is a very heterogenous tissue composed not only of myofibers and their associated MuSCs, but also numerous different non-myogenic cell types (Giordani et al., 2019). Previous studies using whole muscle sequencing captures not only the myofibers but also the other resident cell types in the muscle, making it challenging to attribute any changes in the transcriptome and epigenome specifically to myofibers as they could be due to changes in these other cell types. Recent advances in Next Generation Sequencing (NGS) now allow for high-dimensional analysis at a single-cell level. Recent studies using these technologies to study muscle tissue, such as single nucleus RNA-Seq and single nucleus ATAC-Seq have analyzed the transcriptome and epigenome of the myonuclei within the muscle fiber (Petrany et al., 2020; Dos Santos et al., 2020; Kim et al., 2020). However, they present certain limitations where they sequence all myonuclei present in the muscle and cannot distinguish between different myofibers, as well as having low sequencing depth with a limited capacity for downstream analyses.The chromatin state plays a key role in transcriptional regulation and the determination of cellular identity (Zhu et al., 2018). Although the accessible regions make up only 3% of the total genome, it represents over 90% of known transcription factor binding sites (Thurman et al., 2012). Chromatin accessibility is a determinant of gene expression, and changes in chromatin accessibility have been identified in different biological and disease conditions such as during development (Liu et al., 2019a; Trevino et al., 2020), cancers (Corces et al., 2018; Rendeiro et al., 2016), and neurological disorders (Wang et al., 2020; Bastle and Maze, 2019). Thus, in recent years, the study of epigenetics and chromatin accessibility has become a promising field for the development of novel therapeutics. Today, ATAC-Seq is a widely used method that allows for the mapping of the accessible chromatin regions in the genome. ATAC-Seq relies on the hyperactive Tn5 transposase that fragments the accessible regions in the genome while simultaneously ligating sequencing compatible adaptors (Corces et al., 2017; Buenrostro et al., 2015). Over the years, ATAC-Seq has been applied to many different cell types and tissues (Liu et al., 2019b; Yan et al., 2020; Rocks et al., 2022). However, to our knowledge, it has not been performed on a single myofiber, possibly due to the rigidity of their membrane, high levels of mitochondria (Janssen et al., 2000; Ortenblad et al., 2018; Mishra et al., 2015), and the low number of myonuclei that are present in a single myofiber (Neal et al., 2012; Cramer et al., 2020).Here, we have adapted OMNI-ATAC-seq to determine the genome-wide chromatin accessibility of myonuclei contained within a single Extensor Digitorum Longus (EDL) muscle fiber of a mouse. The single myofiber ATAC-Seq (smfATAC-Seq) method that we applied in this study allows for the investigation of the accessible chromatin regions of a single myofiber, without the presence of other confounding cell types. The smfATAC-Seq has a sequencing depth of approximately 6 million final reads aligned which provides approximately 30,000 peaks called. Using this method, we provide comparative analysis of chromatin accessibility between resting and regenerating myofibers, as well as their MuSC progenitors. In addition, application of this method to the study of myofibers isolated from a mouse model of Duchenne Muscular Dystrophy (mdx) (McGreevy et al., 2015) and their WT counterparts provide a genome-wide assessment of changes in chromatin accessibility in Duchenne Muscular Dystrophy (DMD). This method can be used in the future to profile the epigenetic state of myofibers in different disease conditions, and under various physiological and physical stimuli, and to identify active cis-regulatory elements in muscle fibers.
Results
Generation of ATAC-Seq libraries from a single myofiber
A single EDL myofiber of a mouse contains an average of 200–300 myonuclei (Neal et al., 2012; Cramer et al., 2020), making genome-wide analyses of the chromatin state difficult. With the advancements in next generation sequencing (NGS) and the development of the OMNI ATAC-Seq protocol (Corces et al., 2017), analysis of chromatin accessibility of samples with an input of as low as 500 cells is now possible (Corces et al., 2017). However, myofibers present additional challenges with their rigid membrane and high levels of mitochondria (Janssen et al., 2000; Ortenblad et al., 2018; Mishra et al., 2015). Here, we report a robust protocol for the successful application of ATAC-Seq on a single myofiber isolated from the EDL muscle. Our method relies on the lysis and permeabilization of a single myofiber followed by transposition with a hyperactive Tn5 transposase (Corces et al., 2017) (Figure 1). DNA fragment sizes obtained from the smfATAC-Seq were of a similar range in size as those obtained from conventional OMNI ATAC-Seq which we have performed on 5000 MuSCs that were freshly isolated by Fluorescence Activated Cell Sorting (FACS) (Figure 1—figure supplement 1). Furthermore, analysis showed that only 0.9–2.09% of reads were derived from the mitochondria in smfATAC-Seq (Table 1), suggesting that this method is highly efficient for the removal of mitochondria from mitochondria-rich myofibers. Following the removal of mitochondrial reads, there were approximately 6 million final reads aligned and 30,000 peaks called, demonstrating a sufficient sequencing depth for downstream analysis (Table 1).
Figure 1.
Schematic of ATAC-seq performed on a single myofiber.
Schematic of the steps and reactions involved in the preparation of sequencing ready libraries of single myofiber DNA for ATAC-Seq. Briefly, myofibers were isolated from the EDL muscle and an individual myofiber was transferred to a 0.2 mL microtube. The myofiber was then lysed with ddH2O and the myonuclei were permeabilized with 0.5% Triton X-100. Then, open chromatin regions were tagmented with hyperactive Tn5 transposase and the DNA fragments were purified through column purification. The tagmented DNA was then amplified by PCR and Nextera adaptors were incorporated. Finally, size selection and purification were performed using 0.85 X AMPure beads, resulting in sequencing ready libraries. Figure was made using BioRender.
(A) Bioanalyzer profile of an ATAC-Seq library prepared from 5,000 MuSCs. (B) Example bioanalyzer profile of ATAC-Seq library prepared from a single myofiber. (C) Representative picture of a ready to sequence MuSC ATAC-seq library after size selection, visualized on an agarose gel. (D) Fold enrichment for the TSS of MyoD compared to negative control region of Chromosome 17 qE5 between MuSC ATAC-Seq libraries and untagmented DNA as seen by qPCR (n = 5, 3 biological replicates and two technical duplicates), two-tailed t-test, error bars = ± SD. (E) Representative picture of a ready to sequence ATAC-seq library from a single myofiber after size selection, visualized on an agarose gel. (F) qPCR for the TSS of MyoD compared with a negative control region of Chromosome 17 qE5 for the ATAC-Seq libraries prepared from single myofibers (n = 3, biological triplicates), two-tailed t-test, error bars = ± SD.
Figure 1—figure supplement 1.
Quality control of ATAC-Seq libraries.
(A) Bioanalyzer profile of an ATAC-Seq library prepared from 5,000 MuSCs. (B) Example bioanalyzer profile of ATAC-Seq library prepared from a single myofiber. (C) Representative picture of a ready to sequence MuSC ATAC-seq library after size selection, visualized on an agarose gel. (D) Fold enrichment for the TSS of MyoD compared to negative control region of Chromosome 17 qE5 between MuSC ATAC-Seq libraries and untagmented DNA as seen by qPCR (n = 5, 3 biological replicates and two technical duplicates), two-tailed t-test, error bars = ± SD. (E) Representative picture of a ready to sequence ATAC-seq library from a single myofiber after size selection, visualized on an agarose gel. (F) qPCR for the TSS of MyoD compared with a negative control region of Chromosome 17 qE5 for the ATAC-Seq libraries prepared from single myofibers (n = 3, biological triplicates), two-tailed t-test, error bars = ± SD.
Table 1.
Sequencing read information for smfATAC-Seq and MuSCs ATAC-Seq libraries.
Library
Number of raw reads
Number of surviving reads
Aligned filtered reads (mm10 reference)
Duplicate reads
Mitochondrial reads
Percentage of mitochondrial reads (%)
Final reads aligned
Number of peaks
Fraction in peaks (FrIP)
Muscle Stem Cells_1
175924734
113938436
103130186
47623836
529,967
0.51
54976383
65,568
0.3642
Muscle Stem Cells_2
174965936
117357212
103570009
43672484
374,176
0.36
59523349
68,658
0.1971
Muscle Stem Cells_3
131990380
91261584
79944121
31299456
223,540
0.28
48421125
69,573
0.1296
Injured_1
229935426
117212678
90040002
81024926
830,215
0.92
8184861
32,853
0.2885
Injured_2
194563870
129934972
98752157
88549329
1300615
1.32
8902213
28,351
0.2863
Injured_3
142411536
62888552
52132455
42271079
868,808
1.67
8992568
25,002
0.2325
Uninjured_1
145465410
75781456
61034569
52588315
1274332
2.09
7171922
12,276
0.2181
Uninjured_2
151015852
64192706
50120282
45914841
965,037
1.93
3240404
14,742
0.3208
MDX_1
107540762
50979732
40485803
36205908
802,561
1.98
3477334
40,833
0.7256
MDX_2
103130726
54209722
46455472
37291531
1099747
2.37
8064194
39,254
0.4932
MDX_3
108130662
48920904
40677359
34484003
1171316
2.88
5022040
35,691
0.5589
WT_1
104219578
43914902
34162142
28600498
1651199
4.83
3910445
26,873
0.7283
WT_2
110108692
37411936
31299222
25345321
1143317
3.65
4810584
28,430
0.64
WT_3
183583506
72489354
56983637
49310923
1840265
3.23
5832449
39,178
0.7611
WT_4
86533840
36708706
28714893
25157965
1404712
4.89
2152216
21,252
0.752
Schematic of ATAC-seq performed on a single myofiber.
Schematic of the steps and reactions involved in the preparation of sequencing ready libraries of single myofiber DNA for ATAC-Seq. Briefly, myofibers were isolated from the EDL muscle and an individual myofiber was transferred to a 0.2 mL microtube. The myofiber was then lysed with ddH2O and the myonuclei were permeabilized with 0.5% Triton X-100. Then, open chromatin regions were tagmented with hyperactive Tn5 transposase and the DNA fragments were purified through column purification. The tagmented DNA was then amplified by PCR and Nextera adaptors were incorporated. Finally, size selection and purification were performed using 0.85 X AMPure beads, resulting in sequencing ready libraries. Figure was made using BioRender.
Quality control of ATAC-Seq libraries.
(A) Bioanalyzer profile of an ATAC-Seq library prepared from 5,000 MuSCs. (B) Example bioanalyzer profile of ATAC-Seq library prepared from a single myofiber. (C) Representative picture of a ready to sequence MuSC ATAC-seq library after size selection, visualized on an agarose gel. (D) Fold enrichment for the TSS of MyoD compared to negative control region of Chromosome 17 qE5 between MuSC ATAC-Seq libraries and untagmented DNA as seen by qPCR (n = 5, 3 biological replicates and two technical duplicates), two-tailed t-test, error bars = ± SD. (E) Representative picture of a ready to sequence ATAC-seq library from a single myofiber after size selection, visualized on an agarose gel. (F) qPCR for the TSS of MyoD compared with a negative control region of Chromosome 17 qE5 for the ATAC-Seq libraries prepared from single myofibers (n = 3, biological triplicates), two-tailed t-test, error bars = ± SD.
smfATAC-Seq can be used to study chromatin accessibility of myofibers under different physiological conditions
In addition to adapting the OMNI ATAC-Seq method to study the chromatin accessibility of a single myofiber, we also demonstrate the application of this technique for comparative analysis of chromatin accessibility between myofibers under different conditions. For that purpose, we performed ATAC-Seq on myofibers that were in a resting (uninjured) or regenerating (injured) state. Uninjured and injured (7 days post cardiotoxin (CTX) induced injury) myofibers were isolated from wild-type C57BL/6 mice and smfATAC-Seq was performed to compare the changes in chromatin accessibility during regeneration. In addition, as a further quality control, we compared the chromatin accessibility between myonuclei within a single myofiber and 5000 freshly isolated MuSCs. This analysis not only identified accessible regions of chromatin in myofibers and MuSCs, but it also revealed a repertoire of active cis-regulatory elements in each sample.Apart from the myofibers and their associated MuSCs, skeletal muscle also contains many non-myogenic cells such as endothelial cells, adipocytes, hematopoietic cells, fibroblasts, fibro/adipogenic progenitors (FAPs), and macrophages (Giordani et al., 2019; De Micheli et al., 2020a; De Micheli et al., 2020b). Our smfATAC-Seq method allows for the analysis of chromatin accessibility of a single myofiber without the confounding effect of these contaminating cell types. Given that the whole muscle contains non-myogenic cell types, we first compared smfATAC-Seq to an ATAC-Seq performed on whole EDL muscle by Ramachandran et al., 2019 (GSM3981673) (Ramachandran et al., 2019) for the enrichment of ATAC-Seq peaks on the genes of non-myogenic cells. We obtained the list of genes that are solely expressed in the whole muscle (RPM of at least 10) but not in the myofibers (RPM of 0) by using an RNA-Seq dataset performed on whole muscle and a single myofiber by Blackburn et al., 2019 (GSE138591) (Blackburn et al., 2019). This list represents genes that are only expressed by the muscle resident non-myogenic cell types, designated as “non-fiber muscle genes”. We determined the number of peaks in smfATAC-Seq that overlap with non-fiber muscle genes, which revealed that only 0.1% of the peaks overlapped with the top 100 non-fiber muscle genes (Table 2). In comparison, 0.33% of the peaks in the whole EDL muscle ATAC-Seq (GSM3981673) (Ramachandran et al., 2019) overlapped with the top 100 non-fiber muscle genes (Table 2). The significant difference in the overlap with the non-fiber muscle genes between the whole muscle ATAC-Seq and smfATAC-Seq suggest that the whole muscle ATAC-Seq has enrichment of peaks associated with non-myogenic genes when compared to the smfATAC-Seq, which implies that smfATAC-Seq can successfully exclude the non-myogenic cell types. In contrast, the number of overlapping peaks with all the genes expressed in whole muscle in the EDL ATAC-Seq and smfATAC-Seq were similar (Table 2). To further illustrate the absence of the non-myogenic cell types in the smfATAC-Seq samples, peaks at the promoter regions of marker genes of muscle resident cells were searched for. Specifically, Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) was used to determine whether endothelial cells were present (Khan et al., 2005). Similarly, Resistin (Retn) and Cd45 were used as markers for adipocytes and hematopoietic cells, respectively (Steppan et al., 2001; McKinney-Freeman et al., 2009). The cell Surface Antigen Thy1 was the marker selected for fibroblasts (Agorku et al., 2019). In addition, Lymphocyte antigen 6A (Ly6a) and Adhesion G-protein-coupled receptor E1 (Adgre1) were selected for fibro/adipogenic progenitors (FAPs) and macrophages, respectively (Waddell et al., 2018; Joe et al., 2010). None of these marker genes had ATAC-Seq peaks at their promoters, indicating that only a single myofiber is processed without any other contaminating cell types (Figure 2—figure supplement 1).
Table 2.
Percentage of ATAC-Seq peaks that overlap with the TSS±500 bp by at least 1 bp.
Top 100 genes expressed in whole muscle but not in myofiber
Top 50 genes expressed in whole muscle but not in myofiber
All genes expressed in whole muscle tissue
All genes in the genome
Number of overlapping peaks
Total number of peaks
% overlapping peaks
Number of overlapping peaks
Total number of peaks
% overlapping peaks
Number of overlapping peaks
Total number of peaks
% overlapping peaks
Number of overlapping peaks
Total number of peaks
% overlapping peaks
Uninjured_Fiber
12
19,704
0.0609013
3
19,704
0.0152253
7,865
19,704
39.915753
12,995
19,704
65.951076
Injured_Fiber
65
47,112
0.1379691
12
47,112
0.0254712
14,259
47,112
30.266174
26,198
47,112
55.607913
EDL_Whole_Muscle
198
60,719
0.3260923
65
60,719
0.1070505
18,419
60,719
30.334821
33,048
60,719
54.427774
Genes identified as being expressed solely in whole muscle but not in myofiber were retrieved from “High-resolution genome-wide expression analysis of single myofibers using SMART-Seq, JBC,
Blackburn et al., 2019” and were defined as any gene with an expression of at least 10 RPM in the whole muscle RNA-seq, but 0 RPM in the single myofiber RNA-seq. All genes expressed in whole muscle tissue was defined as any gene that had an RPM value of at least 10 RPM from the whole muscle RNA-seq data by Blackburn et al., 2019 accessible through the GEO accession number GSE138591.
Figure 2—figure supplement 1.
IGV snapshots of non-myogenic genes.
(A) Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) expressed in endothelial cells. (B) Resistin (Retn) as a marker of adipocytes. (C) CD45 expressed in hematopoietic cells. (D) CD90 (Thy1) expressed in fibroblasts. (E) Lymphocyte antigen 6 a (Ly6a) expressed in fibro/adipogenic progenitors (FAPs). (F) Adhesion G-protein-coupled receptor E1 (ADGRE1) gene expressed in macrophages. (G) The housekeeping gene RPS2 used as a positive control. (H) Housekeeping gene TATA-Box Binding protein (Tbp) used as a positive control. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
smfATAC-Seq can be successfully applied to myofibers under different conditions. For instance, we applied smf-ATAC-Seq to analyze the chromatin accessibility of myofibers under resting and CTX-mediated injury conditions. In a disease condition or in injury, not all myofibers undergo damage or regenerate to the same degree. Therefore, individual myofibers within a muscle can be in different physiological and disease conditions asynchronously (Folker and Baylies, 2013). Damaged or regenerating myofibers can be visualized by their characteristic feature of centrally located nuclei (Roman and Gomes, 2018). Injured myofibers in this method were visually selected for the presence of the centrally located myonuclei by Hoechst staining and the selected myofiber was used for downstream processing with smfATAC-Seq (Figure 2A and B). The selection of a specific myofiber that our smfATAC-Seq allows for, as well as the application of trypsin to remove any associated cells that may be present, results in the sequencing of DNA fragments corresponding purely to the myonuclei within a specific myofiber.
Figure 2.
smfATAC-Seq can effectively identify the accessible regions on a single myofiber.
(A) Representative picture of an isolated WT C57BL/6 J uninjured myofiber stained for Hoechst showing the presence and location of myonuclei. Scale bar = 50 µm. (B) Representative picture of an isolated WT C57BL/6 J injured myofiber (7 days post cardiotoxin induced injury) stained for Hoechst showing centrally located myonuclei as a marker of a regenerating fiber. Scale bar = 50 µm. Hoechst stain was visualized on the DAPI channel. (C–E) Peak annotation pie charts for ATAC-Seq peaks of MuSCs, injured myofibers and uninjured myofibers, respectively. (F–H) Heatmaps showing enrichment at transcription start site (TSS) for the ATAC-Seq libraries of MuSCs, injured myofibers and uninjured myofibers, respectively. (I–P) IGV snapshots of known genes expressed in muscle fiber and/or MuSCs displaying accessibility on their respective TSS. (I) The muscle creatine kinase (Ckm). (J) Actin alpha 1 (Acta1). (K) Part of the myosin heavy chain (Myh) gene cluster. (L) Myogenic factor 6 (Myf6). (M) Paired Box 7 (Pax7). (N) Myogenic factor 5 (Myf5). (O) Housekeeping gene Gapdh. (P) POU Class 5 homeobox 1 (Pou5f1) as a negative control. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A) Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) expressed in endothelial cells. (B) Resistin (Retn) as a marker of adipocytes. (C) CD45 expressed in hematopoietic cells. (D) CD90 (Thy1) expressed in fibroblasts. (E) Lymphocyte antigen 6 a (Ly6a) expressed in fibro/adipogenic progenitors (FAPs). (F) Adhesion G-protein-coupled receptor E1 (ADGRE1) gene expressed in macrophages. (G) The housekeeping gene RPS2 used as a positive control. (H) Housekeeping gene TATA-Box Binding protein (Tbp) used as a positive control. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A–C) IGV snapshots of genes expressed in myofibers and MuSCs for all the replicates of each condition that were pooled together for further analysis. DNase-Seq track added to demonstrate correlation of the myofiber ATAC-Seq with previously performed DNase-Seq on skeletal muscle. (A) Housekeeping gene Gapdh. (B) The muscle creatine kinase (Ckm). (C) Myogenic Factor 5 (Myf5). (D–J) Scatter plot showing the Pearson correlation between the replicates. (K) Venn diagram of the number of smfATAC-Seq peaks that are unique or overlapping with the peaks from ChIP-Seq of H3K27ac performed on EDL muscle. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers). ** The ChIP-Seq data was retrieved from “Dynamic enhancers control skeletal muscle identity and reprogramming, Ramachandran et al., 2019.” (Ramachandran et al., 2019). This data is accessible through the GEO accession numbers GSM3515022 and GSM3515023.
(A) Myogenic Factor 5 (Myf5). (B) MyoD. (C) Myogenin (Myog). (D) Myogenic factor 6 (Myf6). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
smfATAC-Seq can effectively identify the accessible regions on a single myofiber.
(A) Representative picture of an isolated WT C57BL/6 J uninjured myofiber stained for Hoechst showing the presence and location of myonuclei. Scale bar = 50 µm. (B) Representative picture of an isolated WT C57BL/6 J injured myofiber (7 days post cardiotoxin induced injury) stained for Hoechst showing centrally located myonuclei as a marker of a regenerating fiber. Scale bar = 50 µm. Hoechst stain was visualized on the DAPI channel. (C–E) Peak annotation pie charts for ATAC-Seq peaks of MuSCs, injured myofibers and uninjured myofibers, respectively. (F–H) Heatmaps showing enrichment at transcription start site (TSS) for the ATAC-Seq libraries of MuSCs, injured myofibers and uninjured myofibers, respectively. (I–P) IGV snapshots of known genes expressed in muscle fiber and/or MuSCs displaying accessibility on their respective TSS. (I) The muscle creatine kinase (Ckm). (J) Actin alpha 1 (Acta1). (K) Part of the myosin heavy chain (Myh) gene cluster. (L) Myogenic factor 6 (Myf6). (M) Paired Box 7 (Pax7). (N) Myogenic factor 5 (Myf5). (O) Housekeeping gene Gapdh. (P) POU Class 5 homeobox 1 (Pou5f1) as a negative control. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
IGV snapshots of non-myogenic genes.
(A) Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) expressed in endothelial cells. (B) Resistin (Retn) as a marker of adipocytes. (C) CD45 expressed in hematopoietic cells. (D) CD90 (Thy1) expressed in fibroblasts. (E) Lymphocyte antigen 6 a (Ly6a) expressed in fibro/adipogenic progenitors (FAPs). (F) Adhesion G-protein-coupled receptor E1 (ADGRE1) gene expressed in macrophages. (G) The housekeeping gene RPS2 used as a positive control. (H) Housekeeping gene TATA-Box Binding protein (Tbp) used as a positive control. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Correlation analysis between biological replicates of each condition.
(A–C) IGV snapshots of genes expressed in myofibers and MuSCs for all the replicates of each condition that were pooled together for further analysis. DNase-Seq track added to demonstrate correlation of the myofiber ATAC-Seq with previously performed DNase-Seq on skeletal muscle. (A) Housekeeping gene Gapdh. (B) The muscle creatine kinase (Ckm). (C) Myogenic Factor 5 (Myf5). (D–J) Scatter plot showing the Pearson correlation between the replicates. (K) Venn diagram of the number of smfATAC-Seq peaks that are unique or overlapping with the peaks from ChIP-Seq of H3K27ac performed on EDL muscle. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers). ** The ChIP-Seq data was retrieved from “Dynamic enhancers control skeletal muscle identity and reprogramming, Ramachandran et al., 2019.” (Ramachandran et al., 2019). This data is accessible through the GEO accession numbers GSM3515022 and GSM3515023.
IGV snapshots of Myogenic Regulatory Factors (MRFs).
(A) Myogenic Factor 5 (Myf5). (B) MyoD. (C) Myogenin (Myog). (D) Myogenic factor 6 (Myf6). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).Genes identified as being expressed solely in whole muscle but not in myofiber were retrieved from “High-resolution genome-wide expression analysis of single myofibers using SMART-Seq, JBC,
Blackburn et al., 2019” and were defined as any gene with an expression of at least 10 RPM in the whole muscle RNA-seq, but 0 RPM in the single myofiber RNA-seq. All genes expressed in whole muscle tissue was defined as any gene that had an RPM value of at least 10 RPM from the whole muscle RNA-seq data by Blackburn et al., 2019 accessible through the GEO accession number GSE138591.
smfATAC-Seq can identify the accessible chromatin regions of a single myofiber
To validate the quality of the ATAC-Seq data generated from a single EDL myofiber, we first investigated the profiles of the ATAC-seq samples from both injured and uninjured myofibers as well as freshly sorted MuSCs. We investigated the similarity between biological replicates for each condition (i.e. uninjured and injured myofibers and MuSCs) by visualization of ATAC-Seq peaks for the muscle-specific gene muscle creatine kinase (Ckm) (Tai et al., 2011), the housekeeping gene Gapdh and the MuSC specific gene myogenic factor 5 (Myf 5) (Rudnicki et al., 1993) (Figure 2—figure supplement 2A-C). This analysis not only indicates that smfATAC-Seq can reliably detect chromatin accessibility in a single myofiber but also the presence of comparable peaks in each biological replicate within the specific condition shows the similarity between the samples (Figure 2—figure supplement 2A-C). In addition, Pearson correlation analysis between the biological replicates showed a high correlation of ATAC-seq reads between the replicates, indicating consistency within the samples (Figure 2—figure supplement 2D-J). Furthermore, we mapped ATAC-Seq peaks with DNase-Seq from skeletal muscle (Sequence Read Archive, accession # SRX191047) and the similarity between our ATAC-Seq and previous DNase-Seq was confirmed through the common peaks present for representative genes, as visualized on the IGV (Figure 2—figure supplement 2A-C). We also analyzed the overlap between the smfATAC-Seq on EDL myofibers with the ATAC-Seq performed on the whole EDL muscle by Ramachandran et al., 2019 (GSM3981673) (Ramachandran et al., 2019). This analysis revealed that 65% of the smfATAC-Seq peaks in the uninjured myofibers overlap with the whole EDL muscle ATAC-Seq (Table 3).
Figure 2—figure supplement 2.
Correlation analysis between biological replicates of each condition.
(A–C) IGV snapshots of genes expressed in myofibers and MuSCs for all the replicates of each condition that were pooled together for further analysis. DNase-Seq track added to demonstrate correlation of the myofiber ATAC-Seq with previously performed DNase-Seq on skeletal muscle. (A) Housekeeping gene Gapdh. (B) The muscle creatine kinase (Ckm). (C) Myogenic Factor 5 (Myf5). (D–J) Scatter plot showing the Pearson correlation between the replicates. (K) Venn diagram of the number of smfATAC-Seq peaks that are unique or overlapping with the peaks from ChIP-Seq of H3K27ac performed on EDL muscle. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers). ** The ChIP-Seq data was retrieved from “Dynamic enhancers control skeletal muscle identity and reprogramming, Ramachandran et al., 2019.” (Ramachandran et al., 2019). This data is accessible through the GEO accession numbers GSM3515022 and GSM3515023.
Table 3.
Percentage of overlapping peaks between smfATAC-Seq from uninjured myofibers and whole EDL muscle ATAC-Seq.
Percent overlap (%)
smfATAC-Seq peaks that overlap with EDL-ATAC-Seq by at least 1 bp
65.9510759
smfATAC-Seq peaks that overlap with EDL-ATAC-Seq by at least 20%
61.4951279
smfATAC-Seq peaks that overlap with EDL-ATAC-Seq by at least 40%
52.6136825
smfATAC-Seq peaks that overlap with EDL-ATAC-Seq by at least 60%
42.1082014
smfATAC-Seq peaks that overlap with EDL-ATAC-Seq by at least 90%
24.3453106
Whole EDL muscle ATAC-Seq was retrieved from “Dynamic enhancers control skeletal muscle identity and reprogramming, Ramachandran et al., 2019.” This data is accessible through the GEO accession number GSM3981673.
Whole EDL muscle ATAC-Seq was retrieved from “Dynamic enhancers control skeletal muscle identity and reprogramming, Ramachandran et al., 2019.” This data is accessible through the GEO accession number GSM3981673.Accessible chromatin regions are associated with various histone marks such as H3K27ac and H3K4me3 (Zhang et al., 2015; Berger, 2007; Barrera et al., 2008). Thus, we compared the smfATAC-Seq to publicly available datasets of ChIP-Seq on H3K27ac in EDL muscle that was previously performed by Ramachandran et al., 2019 (GSM3515022, GSM3515023) (Ramachandran et al., 2019). The comparative analysis has revealed that there were only 97 peaks in the smfATAC-Seq that did not overlap with the H3K27ac peaks, while the majority of the peaks, 6090 peaks, were common to the H3K27ac peaks present in the entire EDL muscle (Figure 2—figure supplement 2K). This demonstrates that the accessible regions that are assessed by smfATAC-Seq correspond to the regions of the chromatin marked by histones that are associated with open chromatin such as H3K27ac. Overall, these analyses suggest that smfATAC-Seq can robustly measure chromatin accessibility and identify active cis-regulatory elements in a single EDL myofiber.Following the initial quality control and the correlation analysis, the biological replicates from the same condition were pooled for further analysis. Peak annotation analysis for MuSCs revealed that more than half of the peaks were in the intron/distal intergenic regions (i.e. enhancer regions) and about 25% of the peaks were in the promoter region (Figure 2C, Table 4). Peak annotations for the uninjured and injured single myofibers also showed a great proportion of peaks in the enhancer and promoter regions (Figure 2D and E, Table 4). In addition, an enrichment of ATAC-seq reads around Transcription Start Sites (TSS) (±1 kb) from all datasets was observed, which is a typical result that is expected from ATAC-Seq (Yan et al., 2020) (Figure 2F–H).
Table 4.
Percentage of total peaks found in each genomic feature.
Muscle stem cells (%)
Injured myofiber (%)
Uninjured myofiber (%)
MDX myofiber (%)
WT myofiber (%)
Promoter (±1 kb TSS)
20.66
31.61
56.54
35.58
35.15
Promoter (±1 kb and/or ±2 kb TSS)
4.81
4.84
3.45
3.78
4.53
Promoter ((±2 kb and/or ±3 kb TSS))
4.37
3.92
3.01
4.14
4.30
5'UTR
0.34
0.27
0.23
0.46
0.39
3'UTR
2.50
1.82
1.15
2.86
2.58
First Exon
1.83
1.47
1.53
1.94
1.78
Other Exon
4.75
3.42
2.19
4.74
4.25
First Intron
11.85
10.87
7.35
10.93
10.56
Other Intron
20.80
18.84
10.35
18.81
18.30
Downstream ( ≤ 300 kb)
1.16
1.01
0.69
1.02
0.99
Distal Intergenic
26.95
21.93
13.51
15.74
17.15
To further assess the quality of the ATAC-Seq data, we analyzed select genes that are expressed by either MuSCs or myofibers. For instance, in the myofiber samples, we confirmed the presence of ATAC-seq peaks in the promoter regions of Ckm, Actin alpha 1 (Acta1), Myogenic factor 6 (Myf6), and Myosin heavy chain 4 (Myh4), all of which are expressed by myofibers but not MuSCs (Lazure et al., 2020; Tai et al., 2011; Nowak et al., 1999; Stuart et al., 2016) (Figure 2I–L). On the other hand, in MuSCs we observed peaks in the promoter regions of Paired Box 7 (Pax7), and Myf5, genes that are known to be expressed in MuSCs (Rudnicki et al., 1993; Seale et al., 2000) (Figure 2M–N). Gapdh was used a housekeeping gene for all samples (Figure 2O) and Pou5f1, a marker of pluripotency, was used as a negative control (Figure 2P). These observed peaks for known expressed genes demonstrate that our method, smf-ATAC-Seq, can reliably analyse chromatin accessibility in a single myofiber.Muscle regeneration and repair rely on the temporal expression of Myogenic Regulatory Factors (MRFs), Myf5, MyoD, Myog, and Myf6/MRF4 (Hernández-Hernández et al., 2017; Montarras et al., 1991; Asfour et al., 2018). Therefore, we assessed the chromatin accessibility of the MRFs in MuSCs and in the myofibers under homeostasis and regeneration (Figure 2—figure supplement 3). We observed peaks in the promoter regions of Myf5 only in the MuSCs but not in the myofibers and peaks in the promoters of Myog and Myf6/MRF4 were solely observed in the myofibers (Figure 2—figure supplement 3). However, we observed peaks in the promoter regions of MyoD in both the MuSCs and myofibers (Figure 2—figure supplement 3).
Figure 2—figure supplement 3.
IGV snapshots of Myogenic Regulatory Factors (MRFs).
(A) Myogenic Factor 5 (Myf5). (B) MyoD. (C) Myogenin (Myog). (D) Myogenic factor 6 (Myf6). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Uninjured and injured myofibers and MuSCs display distinct chromatin states
To show the global differences in chromatin accessibility between MuSCs, uninjured and injured myofibers, we first performed heatmap clustering of Pearson correlation coefficients on all the replicates/samples, which shows that the biological replicates within conditions are more similar to one another than to those from the other conditions (Figure 3A). This can also be observed through Principal Component Analysis (PCA) where each condition clusters separately, with the injured and uninjured myofibers being more similar to one another than to MuSCs (Figure 3B). To test whether the differences between regenerating and resting myofibers are overshadowed by their differences with MuSCs, we performed heatmap clustering of Pearson correlation coefficients and PCA analysis for injured and uninjured myofibers only, without MuSCs (Figure 3—figure supplement 1). This further highlighted how the uninjured and injured myofibers cluster separately (Figure 3—figure supplement 1).
Figure 3.
Uninjured and injured myofibers and MuSCs display distinct chromatin states.
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of samples along the first two principal components found by PCA showing the separate clustering of different samples and the clustering of each replicate of the same condition together. (C) Heatmap clustering of Pearson correlation coefficients indicating the correlation between the replicates in the regions defined by the consensus peakset derived from the uninjured myofibers, injured myofibers and MuSCs. (D) Pile-up analysis of differentially accessible peaks between uninjured myofibers and MuSCs and between injured myofibers and uninjured myofibers. Less accessible peaks: FDR < 0.05 and LFC < 0.5. More accessible peaks: FDR < 0.05 and LFC > 2. (E) Peak annotation pie charts for the differentially accessible peaks between uninjured myofibers vs MuSCs and uninjured myofibers vs injured myofibers. (F) Venn diagram of the number of ATAC-Seq peaks that are unique or overlapping between uninjured myofibers vs MuSCs and uninjured myofibers vs injured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the injured and uninjured conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of the myofiber samples along first two principal components found by PCA showing the separate clustering of injured and uninjured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A) Troponin I2 (Tnni2) expressed in fast skeletal muscle fiber. (B) Troponin T3 (Tnnt3) expressed in fast skeletal muscle fiber. (C) Troponin T1 (Tnnt1) expressed in slow skeletal muscle fibers. (D) Myosin heavy chain 7 (Myh7) expressed in slow skeletal muscle fibers. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A Peak score distribution (calculated by MACS2 peak calling algorithm)) for each of the different conditions. Peak score = -log10 (FDR). (B) Heatmap showing the read count +/–500 bp of the center of unique peaks to MuSCs compared to uninjured myofibers. (C) Heatmap showing the read count +/–500 bp of the center of unique peaks to injured myofibers compared to uninjured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Figure 3—figure supplement 1.
Correlation analysis between uninjured and injured myofibers only.
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the injured and uninjured conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of the myofiber samples along first two principal components found by PCA showing the separate clustering of injured and uninjured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Uninjured and injured myofibers and MuSCs display distinct chromatin states.
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of samples along the first two principal components found by PCA showing the separate clustering of different samples and the clustering of each replicate of the same condition together. (C) Heatmap clustering of Pearson correlation coefficients indicating the correlation between the replicates in the regions defined by the consensus peakset derived from the uninjured myofibers, injured myofibers and MuSCs. (D) Pile-up analysis of differentially accessible peaks between uninjured myofibers and MuSCs and between injured myofibers and uninjured myofibers. Less accessible peaks: FDR < 0.05 and LFC < 0.5. More accessible peaks: FDR < 0.05 and LFC > 2. (E) Peak annotation pie charts for the differentially accessible peaks between uninjured myofibers vs MuSCs and uninjured myofibers vs injured myofibers. (F) Venn diagram of the number of ATAC-Seq peaks that are unique or overlapping between uninjured myofibers vs MuSCs and uninjured myofibers vs injured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Correlation analysis between uninjured and injured myofibers only.
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the injured and uninjured conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of the myofiber samples along first two principal components found by PCA showing the separate clustering of injured and uninjured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
IGV snapshots of genes expressed in fast and slow muscle fiber types.
(A) Troponin I2 (Tnni2) expressed in fast skeletal muscle fiber. (B) Troponin T3 (Tnnt3) expressed in fast skeletal muscle fiber. (C) Troponin T1 (Tnnt1) expressed in slow skeletal muscle fibers. (D) Myosin heavy chain 7 (Myh7) expressed in slow skeletal muscle fibers. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Unique peaks between different conditions indicate a distinct chromatin state for each cell type.
(A Peak score distribution (calculated by MACS2 peak calling algorithm)) for each of the different conditions. Peak score = -log10 (FDR). (B) Heatmap showing the read count +/–500 bp of the center of unique peaks to MuSCs compared to uninjured myofibers. (C) Heatmap showing the read count +/–500 bp of the center of unique peaks to injured myofibers compared to uninjured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).To ensure that the differences seen between myofibers were not due to differences in fiber types, we investigated the chromatin accessibility of known marker genes for slow and fast fiber types. Troponin I2 (Tnni2) and Troponin T3 (Tnnt3), markers of fast fiber types, (Mullen and Barton, 2000; Wei and Jin, 2016) had a high level of chromatin accessibility while Troponin T1 (Tnnt1) and Myosin heavy chain 7 (Myh7), which are expressed in slow fiber types displayed no chromatin accessibility (Wei and Jin, 2016; Meredith et al., 2004) (Figure 3—figure supplement 2). This data indicates that only fast fiber types were analyzed in this study and that the differences in the chromatin state between the injured and uninjured myofibers were not due to the differences in the fiber types.
Figure 3—figure supplement 2.
IGV snapshots of genes expressed in fast and slow muscle fiber types.
(A) Troponin I2 (Tnni2) expressed in fast skeletal muscle fiber. (B) Troponin T3 (Tnnt3) expressed in fast skeletal muscle fiber. (C) Troponin T1 (Tnnt1) expressed in slow skeletal muscle fibers. (D) Myosin heavy chain 7 (Myh7) expressed in slow skeletal muscle fibers. *ATAC-Seq was performed in biological replicates; (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Differential analysis was performed on the ATAC-Seq peaks based on the regions defined by the consensus peak sets derived from the uninjured and injured myofibers and MuSCs conditions. The clustering analysis based on the consensus peak set shows the overall chromatin state differences between the MuSCs and injured and unjured myofibers where the replicates within a condition are more similar to one another than to those of the other conditions (Figure 3C).The unique chromatin state in each condition can be observed through the pile-up analysis that we have performed for the peaks identified as more accessible (LFC >2) and less accessible (LFC <0.5) between uninjured myofibers and MuSCs as well as between uninjured and injured myofibers (Figure 3D). In addition, the proportion of the differential peaks corresponding to various genomic regions, such as promoters and enhancers, differs depending on whether we compare MuSCs to myofibers or compare the myofibers during regeneration and homeostasis. For instance, the differential peaks between uninjured myofibers and MuSCs were mostly found close to the promoter region ( ≤ 1 kb), whereas in the uninjured and injured myofibers comparison, a greater proportion of differential peaks were found in the intron/distal intergenic regions (i.e. enhancer regions) (Figure 3E, Table 5). This implies that MuSCs and myofibers mostly differ in their promoter accessibility, whereas myofibers during homeostasis and regeneration differ mostly at the level of distal regulatory elements.
Table 5.
Percentage of differential peaks in each genomic feature.
Uninjured myofiber vs MuSCs (%)
Uninjured vs injured myofiber (%)
WT vs MDX myofiber (%)
Promoter (±1 kb TSS)
43.07
25
29.92
Promoter (±1 kb and/or ±2 kb TSS)
3.36
7.81
3.68
Promoter (±2 kb and/or ±3 kb TSS)
3.39
3.12
4.49
5’UTR
0.37
0.78
0.46
3’UTR
1.95
3.12
2.99
First Exon
2.29
3.91
1.84
Other Exon
3.85
7.81
4.49
First Intron
9.16
13.28
14.84
Other Intron
13.34
18.75
24.86
Downstream ( ≤ 300 kb)
0.83
0.78
0.12
Distal Intergenic
18.39
15.62
12.31
Furthermore, we performed occupancy analysis (using DiffBind) in order to determine the unique and common peaks between the conditions. Since the occupancy analysis relies on the peak score, the distribution pattern of the peak scores for all the conditions was assessed and were found to be similar despite the observed differences in the total number of peaks between the conditions (Figure 3—figure supplement 3A). Occupancy analysis between uninjured myofibers and MuSCs revealed that MuSCs have 45,533 unique peaks while myofibers contain only 535 unique peaks which are not present in MuSCs (Figure 3F). There are also many common accessible regions as seen from 5,930 peaks that are common to both uninjured myofibers and MuSCs. This analysis suggests that myonuclei share a large number of open chromatin regions with their parental stem cells. On the other hand, the occupancy analysis between uninjured and injured myofibers revealed that there are 6,352 overlapping peaks between the regenerating and resting myofibers. However, this analysis also revealed that there are 15,352 unique peaks in the injured myofibers and only 83 peaks that are unique to the resting myofiber (Figure 3F). Furthermore, when comparing the read count between conditions around the center of unique peaks, it can be observed that each condition displays a unique open chromatin signature (Figure 3—figure supplement 3B,C).
Figure 3—figure supplement 3.
Unique peaks between different conditions indicate a distinct chromatin state for each cell type.
(A Peak score distribution (calculated by MACS2 peak calling algorithm)) for each of the different conditions. Peak score = -log10 (FDR). (B) Heatmap showing the read count +/–500 bp of the center of unique peaks to MuSCs compared to uninjured myofibers. (C) Heatmap showing the read count +/–500 bp of the center of unique peaks to injured myofibers compared to uninjured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Comparative analysis of the chromatin state between MuSCs and myofibers
To get a better understanding of the functional differences in chromatin accessibility between MuSCs and myofibers, we first performed Gene Ontology (GO Biological Process) analysis on the genes associated with the nearest peaks from the uninjured myofiber and on the genes associated with the nearest unique peaks in the myofiber compared to MuSCs. As expected, this revealed myofiber-specific biological processes such as myofiber structure and organization (Figure 4A and Figure 4—figure supplement 1A). On the other hand, GO term analysis on all the genes nearest to each peak and on the genes associated with the nearest unique peaks to MuSCs revealed biological processes such as adherens junction organization, membrane permeability, and regulation of notch signaling which play key roles in MuSCs quiescence and function (Bjornson et al., 2012; Mourikis and Tajbakhsh, 2014) (Figure 4B and Figure 4—figure supplement 1B). The analysis above also revealed that genomic regions that remain in an open chromatin state when MuSCs fully differentiate into myofibers correspond to genes that are involved in processes such as mitochondrial transport, regulation of transcription, and regulation of metabolites and energy (Figure 4—figure supplement 1C). The changes in the chromatin state between MuSCs and myofibers can also be observed from the volcano plots showing differential peaks between conditions labeled by their nearest gene (Figure 4D). For instance, genomic regions associated with genes such as muscle-specific titin-capping protein (Tcap), a component of the skeletal muscle z-disc, as well as genes that are involved in regulatory and structural functions in skeletal muscle such as titin gene (Ttn) are associated with more accessible chromatin regions in the myofiber compared to MuSCs (Markert et al., 2010; Hackman et al., 2002) (Figure 4D).
Figure 4.
Comparative analysis of chromatin state between uninjured myofibers and MuSCs and between uninjured myofibers and injured myofibers.
(A–C) Gene Ontology (GO Biological Process) analysis of genes associated with ATAC-Seq peaks based on association by proximity using Genomic Regions Enrichment of Annotations Tool (GREAT) (McLean et al., 2010) for all peaks present in the uninjured myofibers, MuSCs and injured myofibers, respectively. (D) Volcano plot of differentially accessible regions/peaks identified by FDR < 0.05 and LFC ≥ 1 between uninjured myofibers and MuSCs. Each dot represents a differentially accessible region/peak and the distance to the nearest gene is annotated. (E) Volcano plot of differentially accessible regions/peaks identified by FDR < 0.05 and LFC ≥ 1 between uninjured myofibers and injured myofibers. Each coloured dot represents a differentially accessible region/peak and the distance to the nearest gene is annotated. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the uninjured myofiber compared to MuSCs, based on the proximity of the peaks to the genes. (B) GO term analysis of genes associated with unique peaks in MuSCs compared to uninjured myofibers. (C) GO term analysis of genes associated with peaks that are common between MuSCs and uninjured myofibers. (D) GO term analysis of genes associated with peaks that are common between injured and uninjured myofibers. (E) GO term analysis of genes associated with unique peaks in injured myofibers compared to uninjured myofibers. (F) GO term analysis of genes associated with unique peaks in uninjured myofibers compared to injured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A) Top 10 significantly enriched motifs in the peaks that are common between uninjured and injured myofibers overlapping the promoters (±5 kb). (B) Top 10 significantly enriched motifs in the peaks that are unique to injured myofibers overlapping the promoters (±5 kb).
Figure 4—figure supplement 1.
Gene Ontology analysis of unique and common peaks between conditions.
(A) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the uninjured myofiber compared to MuSCs, based on the proximity of the peaks to the genes. (B) GO term analysis of genes associated with unique peaks in MuSCs compared to uninjured myofibers. (C) GO term analysis of genes associated with peaks that are common between MuSCs and uninjured myofibers. (D) GO term analysis of genes associated with peaks that are common between injured and uninjured myofibers. (E) GO term analysis of genes associated with unique peaks in injured myofibers compared to uninjured myofibers. (F) GO term analysis of genes associated with unique peaks in uninjured myofibers compared to injured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Comparative analysis of chromatin state between uninjured myofibers and MuSCs and between uninjured myofibers and injured myofibers.
(A–C) Gene Ontology (GO Biological Process) analysis of genes associated with ATAC-Seq peaks based on association by proximity using Genomic Regions Enrichment of Annotations Tool (GREAT) (McLean et al., 2010) for all peaks present in the uninjured myofibers, MuSCs and injured myofibers, respectively. (D) Volcano plot of differentially accessible regions/peaks identified by FDR < 0.05 and LFC ≥ 1 between uninjured myofibers and MuSCs. Each dot represents a differentially accessible region/peak and the distance to the nearest gene is annotated. (E) Volcano plot of differentially accessible regions/peaks identified by FDR < 0.05 and LFC ≥ 1 between uninjured myofibers and injured myofibers. Each coloured dot represents a differentially accessible region/peak and the distance to the nearest gene is annotated. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Gene Ontology analysis of unique and common peaks between conditions.
(A) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the uninjured myofiber compared to MuSCs, based on the proximity of the peaks to the genes. (B) GO term analysis of genes associated with unique peaks in MuSCs compared to uninjured myofibers. (C) GO term analysis of genes associated with peaks that are common between MuSCs and uninjured myofibers. (D) GO term analysis of genes associated with peaks that are common between injured and uninjured myofibers. (E) GO term analysis of genes associated with unique peaks in injured myofibers compared to uninjured myofibers. (F) GO term analysis of genes associated with unique peaks in uninjured myofibers compared to injured myofibers. *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Top enriched motifs in the ATAC-Seq peaks of uninjured and injured myofibers.
(A) Top 10 significantly enriched motifs in the peaks that are common between uninjured and injured myofibers overlapping the promoters (±5 kb). (B) Top 10 significantly enriched motifs in the peaks that are unique to injured myofibers overlapping the promoters (±5 kb).Additionally, we performed GO term analysis between uninjured and injured myofibers, which revealed that globally, the accessible regions in the resting and regenerating myofibers corresponded to genes involved in similar processes. GO term analysis on the genes associated with the nearest peaks from uninjured myofibers and from the injured myofibers as well as the genes associated with the nearest peaks which are common between uninjured and injured myofibers revealed biological processes involved in striated muscle cell development, actomyosin structure, and sarcomere organization, which are important for myofiber structural formation and for the proper function of myofibers (Figure 4A and C, Figure 4—figure supplement 1D). On the other hand, genes associated with the nearest unique peaks from the injured myofibers mostly belong to processes involved in structural components of the myofiber while the genes associated with the nearest unique peaks from uninjured myofibers correspond to genes involved in ion transport and metabolism (Figure 4—figure supplement 1E-F).Furthermore, we analyzed the enrichment of transcription factor binding motifs in the sequences under peaks common between the injured and uninjured myofibers overlapping the promoters (±5 kb of TSS) (Figure 4—figure supplement 2A) as well as in the peaks that are unique to injured and uninjured myofibers overlapping the promoters (±5 kb of TSS) (Figure 4—figure supplement 2B). The top motifs that were enriched in the sequences under peaks common to injured and uninjured myofibers include binding site for Mef2a (Figure 4—figure supplement 2A). On the other hand, the top motifs that were enriched in the sequences under peaks unique to injured myofibers included binding sites for JUN and Stat3 (Figure 4—figure supplement 2B). However, due to the low number of unique peaks in the uninjured myofibers (Figure 3F), there was no significant motif that enriched in that peak set.
Figure 4—figure supplement 2.
Top enriched motifs in the ATAC-Seq peaks of uninjured and injured myofibers.
(A) Top 10 significantly enriched motifs in the peaks that are common between uninjured and injured myofibers overlapping the promoters (±5 kb). (B) Top 10 significantly enriched motifs in the peaks that are unique to injured myofibers overlapping the promoters (±5 kb).
Identification of cell-type-specific pathways by global analysis of chromatin accessibility
To further understand the functional differences in chromatin accessibility between different cell types, we investigated the cell-type-specific pathways. To accomplish this, Gene Set Enrichment Analysis (GSEA) was performed on genes associated with differentially accessible peaks between the conditions. Importantly, the GSEA between uninjured and injured myofibers revealed that inflammatory response and Il2-Stat5 signaling, and injury related pathways are still operational even after 7 days of CTX-mediated injury to muscle (Laurence et al., 2007) (Figure 5A).
Figure 5.
Identification of cell type specific pathways by global analysis of chromatin accessibility.
(A) Gene Set Enrichment Analysis performed on genes nearest to the differentially accessible regions/peaks for uninjured myofibers compared to injured myofibers. Top 10 enriched pathways are shown although do not reach significance. (B) Gene Set Enrichment Analysis performed on genes nearest to the differentially accessible regions/peaks for uninjured fibers compared to MuSCs. Top 10 significantly enriched pathways are shown (FDR < 0.01). (C) Heatmap for genes involved in myogenesis based on read counts of MuSCs and uninjured fibers ±1 kb of the TSS of each gene in the myogenic pathway. (D) IGV snapshot of Tropomyosin 2 (Tpm2). (E) IGV snapshot of Glutathione Peroxidase 3 (Gpx3). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
(A) Heatmap showing genes involved in the Notch signalling pathway based on read counts of MuSCs, uninjured fibers and injured fibers,±1 kb of the TSS of each gene in the pathway. (B) IGV snapshot of Notch homolog 1 (Notch1). (C) IGV snapshot of Protein jagged 2 (Jag2). (D) Heatmap showing genes involved in the TGFβ signalling pathway based on read counts of MuSCs, uninjured fibers and injured fibers, ±1 kb of the TSS of each gene in the pathway. (E) IGV snapshot of Noggin (Nog). (F) IGV snapshot of Bone morphogenetic protein (Bmp4). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Identification of cell type specific pathways by global analysis of chromatin accessibility.
(A) Gene Set Enrichment Analysis performed on genes nearest to the differentially accessible regions/peaks for uninjured myofibers compared to injured myofibers. Top 10 enriched pathways are shown although do not reach significance. (B) Gene Set Enrichment Analysis performed on genes nearest to the differentially accessible regions/peaks for uninjured fibers compared to MuSCs. Top 10 significantly enriched pathways are shown (FDR < 0.01). (C) Heatmap for genes involved in myogenesis based on read counts of MuSCs and uninjured fibers ±1 kb of the TSS of each gene in the myogenic pathway. (D) IGV snapshot of Tropomyosin 2 (Tpm2). (E) IGV snapshot of Glutathione Peroxidase 3 (Gpx3). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Analysis of Notch and TGFβ signalling pathways reveal differential accessibility between MuSCS and uninjured myofibers, and injured and uninjured myofibers.
(A) Heatmap showing genes involved in the Notch signalling pathway based on read counts of MuSCs, uninjured fibers and injured fibers,±1 kb of the TSS of each gene in the pathway. (B) IGV snapshot of Notch homolog 1 (Notch1). (C) IGV snapshot of Protein jagged 2 (Jag2). (D) Heatmap showing genes involved in the TGFβ signalling pathway based on read counts of MuSCs, uninjured fibers and injured fibers, ±1 kb of the TSS of each gene in the pathway. (E) IGV snapshot of Noggin (Nog). (F) IGV snapshot of Bone morphogenetic protein (Bmp4). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).The GSEA between uninjured myofibers and MuSCs revealed that one of the significantly enriched pathways is myogenesis, where we can observe that genes associated with differentiation and myofiber function such as Myf6, Ckm,and Tropomyosin 2 (Tpm2) (Lazure et al., 2020; Tai et al., 2011; Buckingham, 1994; Jin et al., 2016) have higher accessibility in the myofiber compared to MuSCs (Figure 5B-D). On the other hand, genes associated with quiescence and MuSCs such as alpha seven integrin (Itga7) and Gpx3 are more accessible in MuSCs compared to the myofiber, as expected (El Haddad et al., 2012; Pasut et al., 2012) (Figure 5C and E).Moreover, differential chromatin accessibility between the MuSCs and their myofiber derivatives show differences in pathways that are known to be important for muscle, such as Notch and TGFβ signalling (Bjornson et al., 2012; Mourikis and Tajbakhsh, 2014; Carlson et al., 2009; Girardi et al., 2021) (Figure 5—figure supplement 1). For example, increased accessibility of Notch1 is seen in MuSCs while increased accessibility of Jagged-2 (Jag2) is observed in the myofibers regardless of whether they are regenerating or homeostatic as seen by the height of the peaks at their promoters (Figure 5—figure supplement 1A-C). On the other hand, for TGFβ signalling, Noggin (Nog) shows more accessibility in the myofibers while bone morphogenetic protein-4 (Bmp4) has increased accessibility in MuSCs (Figure 5—figure supplement 1D-F). Taken together, this data shows that smfATAC-Seq is an effective method to analyze chromatin accessibility and to identify active cis-regulatory elements in a single muscle fiber as well as to compare muscle fibers under different physiological conditions.
Figure 5—figure supplement 1.
Analysis of Notch and TGFβ signalling pathways reveal differential accessibility between MuSCS and uninjured myofibers, and injured and uninjured myofibers.
(A) Heatmap showing genes involved in the Notch signalling pathway based on read counts of MuSCs, uninjured fibers and injured fibers,±1 kb of the TSS of each gene in the pathway. (B) IGV snapshot of Notch homolog 1 (Notch1). (C) IGV snapshot of Protein jagged 2 (Jag2). (D) Heatmap showing genes involved in the TGFβ signalling pathway based on read counts of MuSCs, uninjured fibers and injured fibers, ±1 kb of the TSS of each gene in the pathway. (E) IGV snapshot of Noggin (Nog). (F) IGV snapshot of Bone morphogenetic protein (Bmp4). *ATAC-Seq was performed in biological replicates (n = 3 MuSCs, n = 3 injured myofibers, n = 2 uninjured myofibers).
Comparative analysis of the cromatin state between WT and MDX myofibers
To demonstrate the applicability of our method to a disease condition, we performed smfATAC-Seq on myofibers isolated from mdx mice, a model for Duchenne’s muscular dystrophy (DMD), and their WT C57BL/10ScSn counterparts. In order to solely assess the effect of the loss of dystrophin without the effect of regeneration, myofibers that were not actively regenerating were selected for processing from both conditions. As was performed in the previous cohort, we began by confirming the similarity between biological replicates by visualization of ATAC-Seq peaks for Ckm and housekeeping gene Rps2, as well by the Pearson correlation analysis between the biological replicates (Figure 6—figure supplement 1). After consistency of the samples within the conditions was established, the biological replicates from the same condition were pooled for further analysis. First, enrichment of the ATAC-Seq reads around the TSS from both mdx and WT myofibers was confirmed (Figure 6A). Peak annotation analysis revealed that most of the peaks were in the promoter and enhancer regions for both data sets (Figure 6B, Table 4). To further show that smf-ATAC-Seq can successfully assess the chromatin accessibility in a single myofiber of an mdx and WT EDL muscle, we looked at the presence of ATAC-seq peaks in the promoter regions of Ckm, Acta1, Myh4, and the housekeeping genes Gapdh and Rps2, whereas Pou5f1 was used as a negative control (Figure 6—figure supplement 2A-F). We also confirmed that the myofibers from mdx and WT conditions were fast type (Figure 6—figure supplement 2G-H) and that they exclusively represent the myonuclei, without the presence of confounding cell types in the muscle (Figure 6—figure supplement 2I-N).
Figure 6—figure supplement 1.
Correlation analysis between biological replicates of mdx and WT myofiber ATAC-Seq samples.
(A–I) Scatter plot showing the Pearson correlation between the replicates. (J,K) IGV snapshots of muscle creatine kinase (Ckm) and housekeeping gene Rps2 for all the replicates of each condition that were pooled together for further analysis. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
Figure 6.
Comparative analysis of chromatin state between MDX and WT myofibers.
(A) Heatmaps showing enrichment at transcription start site (TSS) for the ATAC-Seq libraries of MDX and WT myofibers respectively. (B) Peak annotation pie charts for ATAC-Seq peaks of MDX and WT myofibers respectively. (C) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (D) Projection of samples along first two principal components found by PCA showing the separate clustering of different samples and the clustering of each replicate of the same condition together. (E) Pile-up analysis of differentially accessible peaks between WT and MDX myofibers. Less accessible regions: FDR < 0.05 and LFC < 0.5. More accessible peaks: FDR < 0.05 and LFC > 2. (F) Peak annotation pie charts for the differentially accessible peaks between WT and MDX myofibers. (G) Venn diagram of the number of ATAC-Seq peaks that are unique or overlapping between WT and MDX myofibers. (H) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the MDX myofiber compared to WT myofibers, based on the proximity of the peaks to the genes. (I) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the WT myofiber compared to MDX. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 MDX myofibers, n = 4 WT myofibers).
(A–I) Scatter plot showing the Pearson correlation between the replicates. (J,K) IGV snapshots of muscle creatine kinase (Ckm) and housekeeping gene Rps2 for all the replicates of each condition that were pooled together for further analysis. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
(A–F) IGV snapshots of genes known to expressed in muscle fiber displaying accessibility on their respective TSS. (A) The muscle creatine kinase (Ckm). (B) Actin alpha 1 (Acta1). (C) Part of the myosin heavy chain (Myh) gene cluster. (D) Housekeeping gene Gapdh. (E) Housekeeping gene Rps2. (F) POU Class 5 homeobox 1 (Pou5f1) as a negative control. (G–H) IGV snapshots of marker genes for fast and slow type myofibers. (G) Troponin I2 (Tnni2) expressed in fast skeletal muscle fiber. (H) Troponin T1 (Tnnt1) expressed in slow skeletal muscle fibers. (I–N) IGV snapshots of non-myogenic genes (I) Adhesion G protein-coupled receptor E1 (ADGRE1) gene expressed in macrophages. (J) Resistin (Retn) as a marker of adipocytes. (K) CD45 expressed in hematopoietic cells. (L) Lymphocyte antigen 6 a (Ly6a) expressed in fibro/adipogenic progenitors (FAPs). (M) Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) expressed in endothelial cells. (N) CD90 (Thy1) expressed in fibroblasts. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
(A) Gene Ontology (GO Biological Process) analysis of genes associated with all peaks present in the mdx myofiber, based on the proximity of the peaks to the genes. (B) GO term analysis of genes associated with all peaks present in the WT myofiber. (C) GO term analysis of genes associated with peaks that are common between mdx and WT myofibers. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of injured myofibers as well as the mdx and WT myofibers along the first two principal components found by PCA. *ATAC-Seq was performed in biological replicates (n = 3 injured myofibers, n = 3 mdx myofibers, n = 4 WT myofibers).
(A) Top 10 significantly enriched motifs in the peaks that are common between mdx and WT myofibers overlapping the promoters (±5 kb). (B) Top 10 significantly enriched motifs in the peaks that are unique to mdx myofibers overlapping the promoters (±5 kb). (C) Top 10 significantly enriched motifs in the peaks that are unique to WT myofibers overlapping the promoters (±5 kb).
Figure 6—figure supplement 2.
IGV snapshots of myogenic and non-myogenic genes for the quality control of mdx and WT smfATAC-Seq.
(A–F) IGV snapshots of genes known to expressed in muscle fiber displaying accessibility on their respective TSS. (A) The muscle creatine kinase (Ckm). (B) Actin alpha 1 (Acta1). (C) Part of the myosin heavy chain (Myh) gene cluster. (D) Housekeeping gene Gapdh. (E) Housekeeping gene Rps2. (F) POU Class 5 homeobox 1 (Pou5f1) as a negative control. (G–H) IGV snapshots of marker genes for fast and slow type myofibers. (G) Troponin I2 (Tnni2) expressed in fast skeletal muscle fiber. (H) Troponin T1 (Tnnt1) expressed in slow skeletal muscle fibers. (I–N) IGV snapshots of non-myogenic genes (I) Adhesion G protein-coupled receptor E1 (ADGRE1) gene expressed in macrophages. (J) Resistin (Retn) as a marker of adipocytes. (K) CD45 expressed in hematopoietic cells. (L) Lymphocyte antigen 6 a (Ly6a) expressed in fibro/adipogenic progenitors (FAPs). (M) Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) expressed in endothelial cells. (N) CD90 (Thy1) expressed in fibroblasts. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
Comparative analysis of chromatin state between MDX and WT myofibers.
(A) Heatmaps showing enrichment at transcription start site (TSS) for the ATAC-Seq libraries of MDX and WT myofibers respectively. (B) Peak annotation pie charts for ATAC-Seq peaks of MDX and WT myofibers respectively. (C) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (D) Projection of samples along first two principal components found by PCA showing the separate clustering of different samples and the clustering of each replicate of the same condition together. (E) Pile-up analysis of differentially accessible peaks between WT and MDX myofibers. Less accessible regions: FDR < 0.05 and LFC < 0.5. More accessible peaks: FDR < 0.05 and LFC > 2. (F) Peak annotation pie charts for the differentially accessible peaks between WT and MDX myofibers. (G) Venn diagram of the number of ATAC-Seq peaks that are unique or overlapping between WT and MDX myofibers. (H) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the MDX myofiber compared to WT myofibers, based on the proximity of the peaks to the genes. (I) Gene Ontology (GO Biological Process) analysis of genes associated with unique peaks present in the WT myofiber compared to MDX. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 MDX myofibers, n = 4 WT myofibers).
Correlation analysis between biological replicates of mdx and WT myofiber ATAC-Seq samples.
(A–I) Scatter plot showing the Pearson correlation between the replicates. (J,K) IGV snapshots of muscle creatine kinase (Ckm) and housekeeping gene Rps2 for all the replicates of each condition that were pooled together for further analysis. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
IGV snapshots of myogenic and non-myogenic genes for the quality control of mdx and WT smfATAC-Seq.
(A–F) IGV snapshots of genes known to expressed in muscle fiber displaying accessibility on their respective TSS. (A) The muscle creatine kinase (Ckm). (B) Actin alpha 1 (Acta1). (C) Part of the myosin heavy chain (Myh) gene cluster. (D) Housekeeping gene Gapdh. (E) Housekeeping gene Rps2. (F) POU Class 5 homeobox 1 (Pou5f1) as a negative control. (G–H) IGV snapshots of marker genes for fast and slow type myofibers. (G) Troponin I2 (Tnni2) expressed in fast skeletal muscle fiber. (H) Troponin T1 (Tnnt1) expressed in slow skeletal muscle fibers. (I–N) IGV snapshots of non-myogenic genes (I) Adhesion G protein-coupled receptor E1 (ADGRE1) gene expressed in macrophages. (J) Resistin (Retn) as a marker of adipocytes. (K) CD45 expressed in hematopoietic cells. (L) Lymphocyte antigen 6 a (Ly6a) expressed in fibro/adipogenic progenitors (FAPs). (M) Platelet and Endothelial Cell Adhesion Molecule 1 (Pecam1) expressed in endothelial cells. (N) CD90 (Thy1) expressed in fibroblasts. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
Gene Ontology analysis of total mdx and WT peaks.
(A) Gene Ontology (GO Biological Process) analysis of genes associated with all peaks present in the mdx myofiber, based on the proximity of the peaks to the genes. (B) GO term analysis of genes associated with all peaks present in the WT myofiber. (C) GO term analysis of genes associated with peaks that are common between mdx and WT myofibers. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
Correlation analysis between injured, mdx and WT myofibers.
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of injured myofibers as well as the mdx and WT myofibers along the first two principal components found by PCA. *ATAC-Seq was performed in biological replicates (n = 3 injured myofibers, n = 3 mdx myofibers, n = 4 WT myofibers).
Top enriched motifs in the ATAC-Seq peaks of mdx and WT myofibers.
(A) Top 10 significantly enriched motifs in the peaks that are common between mdx and WT myofibers overlapping the promoters (±5 kb). (B) Top 10 significantly enriched motifs in the peaks that are unique to mdx myofibers overlapping the promoters (±5 kb). (C) Top 10 significantly enriched motifs in the peaks that are unique to WT myofibers overlapping the promoters (±5 kb).To investigate the differences in the chromatin state between mdx and WT, we first performed heatmap clustering of Pearson correlation coefficients and PCA (Figure 6C and D). These analyses showed that, mdx and WT myofibers cluster separately and the biological replicates for each condition generally cluster together (Figure 6C and D). We then performed differential analysis of ATAC-Seq peaks followed by pile-up analysis for the less accessible (LFC <0.5) and more accessible (LFC >2) peaks between WT and mdx myofibers (Figure 6E). The results clearly showed that mdx and WT myofibers exhibit extensive differences in their chromatin states (Figure 6E). Peak annotation analysis on the differential peaks between mdx and WT myofibers revealed that more than half of the differential peaks were found in enhancer regions, indicating that they differ mostly at the level of distal regulatory elements (Figure 6F, Table 5). In addition, occupancy analysis revealed that there are 22,967 overlapping peaks between mdx and WT myofibers, and that mdx myofibers possess 7599 unique peaks, while WT myofibers contain 2895 unique peaks (Figure 6G).Furthermore, to understand the functional differences in chromatin accessibility, we performed Gene Ontology (GO Biological Process) analysis on the genes associated with the nearest peak for all peaks in the mdx and WT myofibers, as well as on the genes associated with the nearest common peaks between them (Figure 6—figure supplement 3). These analyses revealed processes involved in mitochondrial transport, myofibril assembly, sarcomere organization, and striated muscle cell development, which are important for myofiber structure, organization, and function (Figure 6—figure supplement 3). However, GO term analysis on the unique peaks of each condition revealed that different processes are affected between mdx and WT. GO term analysis on the genes associated with the nearest unique peaks from mdx myofibers revealed processes that are important for myofiber structure and organization such as actin cytoskeleton organization and striated muscle cell differentiation (Figure 6H). On the other hand, GO term analysis on the genes associated with the nearest unique peaks from WT myofibers revealed processes mostly involved in metabolism (Figure 6I). Since the observed differential biological processes between WT and mdx myofibers were similar to those seen between injured vs uninjured myofibers, we then compared the overall differences in chromatin accessibility between mdx, WT, and injured myofibers. We performed heatmap clustering of Pearson correlation and PCA analysis between WT, mdx and injured myofibers (Figure 6—figure supplement 4). These analyses have revealed that injured myofibers were more similar to the mdx than they are to the WT C57BL/10ScSn myofibers. However, as expected due to the different genetic backgrounds of the mice between injured and the WT and mdx mice, WT and mdx myofibers were more similar to each other than they are to the injured C57BL/6 myofibers (Figure 6—figure supplement 4).
Figure 6—figure supplement 3.
Gene Ontology analysis of total mdx and WT peaks.
(A) Gene Ontology (GO Biological Process) analysis of genes associated with all peaks present in the mdx myofiber, based on the proximity of the peaks to the genes. (B) GO term analysis of genes associated with all peaks present in the WT myofiber. (C) GO term analysis of genes associated with peaks that are common between mdx and WT myofibers. *ATAC-Seq on the myofibers were performed in biological replicates (n = 3 mdx myofibers, n = 4 WT myofibers).
Figure 6—figure supplement 4.
Correlation analysis between injured, mdx and WT myofibers.
(A) Heatmap clustering of Pearson correlation coefficients showing the correlation between the replicates of the conditions in the regions defined by the union peakset (merged peaks of all replicates/samples). (B) Projection of injured myofibers as well as the mdx and WT myofibers along the first two principal components found by PCA. *ATAC-Seq was performed in biological replicates (n = 3 injured myofibers, n = 3 mdx myofibers, n = 4 WT myofibers).
Finally, we determined the top motifs that are enriched in the sequences under the peaks that are common between the mdx and WT myofibers overlapping the promoters (±5 kb of TSS) (Figure 6—figure supplement 5A) as well as the sequences under peaks that are unique to mdx and WT overlapping the promoters (±5 kb of TSS) (Figure 6—figure supplement 5B-C). The top significantly enriched motifs in the peaks common between mdx and WT included Mef2a and JUN (Figure 6—figure supplement 5A) while the top motifs enriched in the peaks unique to mdx included transcription factors such as Foxo1 (Figure 6—figure supplement 5B).
Figure 6—figure supplement 5.
Top enriched motifs in the ATAC-Seq peaks of mdx and WT myofibers.
(A) Top 10 significantly enriched motifs in the peaks that are common between mdx and WT myofibers overlapping the promoters (±5 kb). (B) Top 10 significantly enriched motifs in the peaks that are unique to mdx myofibers overlapping the promoters (±5 kb). (C) Top 10 significantly enriched motifs in the peaks that are unique to WT myofibers overlapping the promoters (±5 kb).
Overall, this data shows that smfATAC-Seq can be reliably used to study myofibers in disease conditions, revealing that there are substantial differences in the chromatin accessibility of myofibers in the mdx mice compared to their WT counterparts.
Discussion
Analysis of the myofiber-specific chromatin state and gene expression profile is very limited due to the heterogenous nature of muscle with the presence of numerous non-myogenic cells in the tissue. Whole muscle or muscle biopsies represent a pooled result of numerous cell types which are present in the muscle tissue. To overcome this limitation, single nucleus RNA-Seq (snRNA-Seq) and single nucleus ATAC-Seq (snATAC-Seq) have been developed and performed on myonuclei to allow for the computational removal of other cell types (Petrany et al., 2020; Dos Santos et al., 2020; Kim et al., 2020). However, these methods still sequence all myonuclei present in the muscle and cannot distinguish between different myofibers within a muscle. Although snATAC-Seq provides high dimensionality, it is limited in sequencing depth due to the generation of sparse reads. Although computational pseudo bulking of snATAC-Seq can increase read numbers for comparative analysis between samples and conditions, the pooled reads represent the average of all myonuclei within the sample.In this study, we have introduced a highly effective protocol based on the adaption of OMNI ATAC-Seq (Corces et al., 2017) to quantify chromatin accessibility of a single EDL myofiber with high resolution and sequencing depth. This method allows for comparative analysis of chromatin accessibility within and between muscle types with a potential for wide-spread use in future studies to investigate myofiber-specific epigenetic alterations in skeletal muscle.The smfATAC-Seq protocol that we introduce in this study investigates the open chromatin state of myofibers at a single myofiber resolution, and with a high sequencing depth that allows for peak calling and differential peak analysis. Using this method, we have demonstrated that accessible chromatin regions of myonuclei contained within a single EDL myofiber can be tagmented and that high-quality sequencing ready libraries can be generated from these fragments. Sequencing of these libraries allow for sufficient depth and peak calling that can be used for genome-wide analysis of chromatin accessibility between myofibers. In this study, we have also demonstrated that smfATAC-Seq strictly investigates a single myofiber without the confounding presence of muscle resident non-myogenic cell types. Additionally, application of trypsin to the isolated myofibers effectively removes MuSCs that are associated with myofibers (Blackburn et al., 2019) and was confirmed by the absence of peaks at the promoters of known genes associated with muscle stem and niche cells. Although all the smfATAC-Seq samples sequenced in this study were fast type myofibers, this protocol can be used to distinguish between different fiber types which could be applied to study myofiber heterogeneity under various physiological conditions. smfATAC-Seq peaks associated with genes involved in muscle structure and function such as Acta1, Ckm and the myosin heavy chain cluster, indicates that our smfATAC-Seq is a robust technique to investigate genome-wide chromatin accessibility of a single myofiber.A key implication of this technique is its applicability to the study of changes in chromatin accessibility between myofibers in different contexts. As a demonstration of this, we have performed smfATAC-Seq on uninjured myofibers as well as injured myofibers isolated 7 days post-injury to investigate the changes in chromatin accessibility that occurs during regeneration. Through Pearson correlations and PCA analysis, we showed resting and injured myofibers cluster separately, indicating the power of smfATAC-Seq to determine chromatin signature from even the minute starting material of a single myofiber. In addition, through occupancy analysis, we showed that there is a large difference in the number of unique peaks present in the injured myofibers compared to uninjured myofibers. This indicates that there are major modifications to chromatin accessibility in the context of regeneration. However, GO term analysis of genes associated with the accessible chromatin regions in both injured and uninjured fibers are very similar in the biological processes and pathways that are enriched such as striated muscle cell development, actomyosin structure and sarcomere organization, which are key factors for the proper structure and function of muscle. Despite these similarities, there are certain trends in which uninjured myofibers have increased accessibility in genes involved in energy metabolism, while injured myofibers have greater accessibility in genes involved in myogenesis and inflammatory response which is what would be expected in the case of an injury and regeneration (Tidball, 2011). Despite the increase in chromatin accessibility during injury, the accessible chromatin regions in both injured and uninjured fibers are associated with genes involved in similar biological processes. This similarity at the gene network despite differences in chromatin profile may suggest activation of multiple enhancers on core muscle structural genes in the case of injury. Another possible reason could be the length of the recovery time where at 7 days post injury, a number of genes activated early in the regeneration process may have returned to levels seen in the steady state. Previously, a study investigating the changes in the transcriptional profile of MuSCs and various muscle resident cells throughout different time points of muscle injury using single cell RNA-Seq, revealed that after seven days of regeneration most cell types returned to a state that was similar to homeostasis (De Micheli et al., 2020a). Therefore, it is possible that harvesting the injured EDL myofibers 7 days post injury allowed these myofibers to return to a state reminiscent of homeostatic myofibers. Further, our analyses of the myofibers in this study indicates that this technique can effectively compare samples between conditions and could see future use in the study of chromatin accessibility of myofibers under different biologically relevant conditions.We have also used smfATAC-Seq to compare changes in chromatin accessibility between MuSCs and myofibers. Our data shows that the regions of open chromatin in the myofibers correspond to genes involved in structural components of the muscle, such as the z-disc, which are important for the proper functioning of the muscle. On the other hand, open regions of chromatin in the MuSCs mostly correspond to genes involved in membrane permeability, adherens junction organization and signalling pathways implicated in the regulation of MuSC function (Relaix et al., 2021). The analysis also revealed that chromatin regions that are accessible in both MuSCs and myofibers correspond to genes that are crucial for the general function of cells such as those involved in mitochondrial transport, regulation of transcription, and regulation of metabolites and energy.Lastly, we performed smfATAC-Seq on non-regenerating myofibers isolated from the mouse model of DMD (McGreevy et al., 2015) and their WT counterparts. DMD is a type of muscular dystrophy caused by a loss-of-function mutation in the Dystrophin (DMD) gene that encodes for a protein that has a crucial role in muscle structure (Gao and McNally, 2015). Lack of functional dystrophin in DMD leads to unstable and fragile myofibers that continuously need to be regenerated, in turn leading to progressive muscle degeneration (Gao and McNally, 2015). We have not only shown that smfATAC-Seq can reliably investigate the chromatin accessibility from a single myofiber of mdx and WT EDL muscle, but through Pearson correlations, PCA and differential peak analysis we have also shown that DMD is associated with substantial alterations in chromatin accessibility in myonuclei. Through occupancy and GO term analyses, we have shown that a great proportion of peaks that are common between the mdx and WT myofibers are mostly associated with processes involved in muscle structure and organization. However, we have shown that mdx myofibers have more unique peaks compared to the WT, suggesting that chromatin accessibility of myonuclei is increased in the mdx disease model. Our analyses have shown that the unique peaks in mdx are associated with biological processes involved in myofiber structure and organization. On the other hand, unique peaks in the WT myofibers are associated with processes mostly involved in energy and metabolism. It is possible that the progressive muscle degeneration due to loss of muscle fiber integrity and stability causes mdx myofibers to compensate by increasing the activity of processes involved in muscle structure and organization while WT myofibers retain their activity in metabolism. It should be noted that the differences in chromatin accessibility that we have observed between resting and regenerating myofibers and between the mdx and WT myofibers are similar, which could be explained by the degeneration and continuous round of regeneration in the mdx myofibers.Studies in the future could utilize smfATAC-Seq to further investigate the changes in chromatin accessibility in the mdx myofibers and investigate the changes associated with DMD at the level of chromatin to potentially investigate therapeutic avenues for this disease, as well as other muscle wasting diseases.Overall, smfATAC-Seq is a robust molecular tool that can be used to analyze genome-wide chromatin accessibility of a single myofiber. The sequencing depth from this approach, allows for in-depth analysis, peak calling, quantitative analysis of chromatin accessibility and to identify active enhancers and promoters in a single muscle fiber. smfATAC-Seq can be used to study the epigenetic alterations that occur in muscle fibers during development, diseases, and in response to exercise.
Materials and methods
ATAC-Seq on a single myofiber
Isolation of Extensor Digitorum Longus (EDL) from cardiotoxin-induced injured muscle
The Extensor Digitorum Longus (EDL) muscle was injured by intramuscular injection of 50 µL of 5 µM cardiotoxin (CTX) (Sigma, 11061-96-4). Mice were treated with carprofen 20 minutes prior to CTX injection and were injected with CTX under anesthesia by isoflurane. Mice were sacrificed 7 days post injury and the EDL was collected from the hind limb of each mouse with the contra lateral EDL being used for the isolation of uninjured myofibers.
Dissection of EDL muscle
The EDL muscle was dissected as previously described (Blackburn et al., 2019). Briefly, the skin of the hindlimb was removed and the tibialis anterior (TA) muscle was excised with a pair of dissection scissors. The tendons of the EDL were exposed and the EDL was cut from tendon to tendon with scissors.
Isolation of a single EDL myofiber
Individual myofibers were isolated from the EDL muscle as previously described (Blackburn et al., 2019). Briefly, the intact EDL muscle was placed in a 1.5 mL eppendorf tube with 800 µL of myofiber digestion buffer containing 1000 U/mL of collagenase from Clostridium histolyticum (Sigma, C0130) in un-supplemented DMEM (Gibco, 11995–065) for 1 hr. Trypsin was added to the myofiber digestion buffer at a final concentration of 0.25% to remove the myofiber associated muscle stem cells. The EDL myofibers were then transferred into 2 mL of 1 X PBS (Wisent, 311–425 CL) in a six well-plate that had previously been coated with DMEM supplemented with 10% horse serum (HS) (Wisent, 065250). The EDL was then gently pipetted up and down with a large-bore glass pipette to disassociate the myofibers.
Selection of injured and uninjured myofibers
Live myofibers in the six-well plate were stained with 2 µL of 5 mg/mL of Hoechst (Molecular Probes, H1399) in 2 mL of 1 X PBS for 5 minutes in a 37 °C with 5% CO2 incubator. The myofibers were then visualized under a microscope in DAPI channel and selected based on the myonuclei location, where myofibers with a pattern of centrally located nuclei were determined to be regenerating and picked for the injury condition. Individual myofibers were then transferred to 0.2 mL microtubes using a small-bore glass pipette coated with HS.
Lysis and permeabilization of the myofiber
Residual media was removed with a pipette under a microscope. Individual myofibers in 0.2 mL microtubes were put in 10 µL of ddH2O for 5 min on ice. The ddH2O was removed with a pipette under a microscope, ensuring that the myofiber remained in the tube. The myofiber was then permeabilized with 20 µL of 0.5% Triton X-100 (Sigma, T9284) in PBS for 15 min at room temperature (RT). The permeabilization buffer was removed with a pipette under a microscope and the myofiber was washed twice with 200 µL of 1 X PBS.
Tagmentation of the myofiber by Tn5 transposase
Transposition and ATAC-seq library preparation for a single myofiber was adapted from previously described OMNI ATAC-Seq protocol (Corces et al., 2017). The permeabilized myonuclei were tagmented with tagmentation mixture optimized for use on a myofiber (20 µL Tagment DNA Buffer (TD Buffer) (Illumina, 20034197), 13.3 µL PBS, 0.2% Tween-20 (Sigma, P1379-1L), 0.02% Digitonin (Promega, G9441), 1.39 µL Tn5 (Illumina, 20034197) and 4.61 µL water). Each single myofiber was incubated with 6 µL of the tagmentation mixture at 37 °C for 56 minutes with periodic shaking of the tubes every 5–7 minutes. Following the transposition with Tn5, DNA was purified using a QIAquick PCR Purification Kit (Qiagen, 28104) according to the manufacturer’s guidelines.
Library preparation
The purified DNA was PCR amplified for 15 cycles using Q5 High Fidelity DNA polymerase (New England Biolabs, M0491S) with the incorporation of Illumina Nextera XT adaptors (Illumina, FC-131–1001). The libraries were then size selected with AmpureXP Beads (Beckman, Cat# A63880) at a 1: 0.85 ratio (v/v). The size selected libraries were verified for quality control by bioanalyzer as well as verification of the library size via visualization on an agarose gel stained with GelGreen dye (Biotium, 41005). Libraries were then sequenced on NovaSeq6000 Sprime Paired End (PE) 150 bp.
ATAC-Seq on MuSCs
Isolation of MuSCs by fluorescence-activated cell sorting (FACS) for ATAC-Seq
MuSCs were isolated by Fluorescence Activated Cell Sorting (FACS) as previously described (Tichy et al., 2018). Briefly, hindlimb muscles from Pax7/GFP+ mice were dissected and chopped. The minced muscles were then transferred into a 15 mL Falcon tube and digested in un-supplemented F10 media (Gibco, 11550043) with 2.4 U/mL Collagenase D (Roche, 11088882001), 12 U/mL Dispase II (Roche, 39307800), and 0.5 mM CaCl2. Digestion was performed on a shaker in an incubator at 37 °C with 5% CO2 for 30 min. Following the first digestion, digested muscles were centrifuged at 600 g for 20 s and the supernatant was transferred to a 50 mL Falcon tube with 9 mL FBS (Wisent, 080450) and was kept on ice. The remaining pellet was triturated and was digested for another 15 min with additional digestion buffer added. After the final digestion, the digested muscle mixture was transferred to the 50 ml Falcon tube containing the previously digested mixture. The digested muscle mixture was then filtered through a 40-µm cell strainer (Falcon, C352340) and was centrifuged at 600 g for 18 min at 4 °C. The pelleted cells were then resuspended in 800 μL FACS buffer that is composed of 2% FBS/ PBS (v:v), 0.5 mM EDTA (Invitrogen, AM9261) and with 0.5 μL DAPI (5 mg/mL) (Invitrogen, D3671). Resuspended cells were then filtered through 40-µm cell strainer and were transferred into polypropylene round-bottom FACS compatible tubes (Falcon, 352063). MuSCs were sorted with a FACSAria Fusion cytometer (BD Biosciences) based on negative selection for DAPI and positive selection for GFP.
Lysis and transposition of MuSCs
ATAC-Seq on MuSCs was performed based on the previously established OMNI-ATAC-Seq protocol (Corces et al., 2017). Briefly, five thousand MuSCs were sorted by FACS into 30 μL of the ATAC lysis buffer containing 10 mM Tris-HCl (pH 7.5), 10 mM NaCl (Bioshop, 7647-14-5), 3 mM MgCl2 (Sigma, 7786-30-3), 0.1% Tween-20 (Sigma, P1379-1L), 0.1% NP-40 (Sigma, 74385), and 0.01% Digitonin (Promega, G9441) in a 0.2 mL microtube. Cells were incubated in the lysis buffer for 5 min on ice and then 3 min at room temperature (RT). Cells were then washed with 100 µL of wash buffer composed of 10 mM Tris-HCl (pH 7.5), 10 Mm NaCl, 3 mM MgCl2 and 0.1% Tween-20, and were centrifuged at 800 g for 10 min. The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20, 0.01% Digitonin and 0.75 µL nuclease free water). Transposition was performed for 20 min at 37 °C while shaking the tubes every 5–7 min. The DNA was then purified using a QIAquick PCR Purification Kit according to the manufacturer’s guidelines.
Library preparation for MuSCs ATAC-Seq
The eluted tagmented DNA was PCR amplified for 12 cycles with the incorporation of Illumina Nextera XT adapters using Q5 High Fidelity DNA polymerase. The libraries were then size selected with AmpureXP Beads at a 1: 0.85 ratio (v/v). The libraries were then verified by bioanalyzer and agarose gel visualization. Finally, the samples were sequenced on NovaSeq6000 Sprime Paired End (PE) 150 bp.
ATAC-Seq data processing
The sequencing data was processed using the GenPipes pipeline v.3.1.5 (Bourgey et al., 2019). The raw reads were trimmed using Trimmomatic v.0.36 (Bolger et al., 2014) and aligned to the mm10 genome assembly using the Burrows-Wheeler Aligner v.0.7.12 (Li and Durbin, 2009). Reads were filtered to keep only high quality alignments (MAPQ score >20) and duplicates were removed using SAMtools v.1.3.1 (Li et al., 2009). Peak calling was performed with MACS2 v.2.1.1 (Zhang et al., 2008) using piling up of paired-end fragment mode (--format BAMPE). The peak files (bed) were filtered by removing the ENCODE black listed regions (https://www.encodeproject.org/files/ENCFF547MET) using BEDTools v2.29.1 (Quinlan, 2014). Mitochondrial reads were also removed before the analysis.
Correlation analysis between the biological replicates and clustering
In order to perform a quantitative comparison of the read counts within accessible regions, the overlapping peaks of all replicates were merged using BEDTools v2.29.1 (Quinlan, 2014). This set of merged peaks and the BAM alignment files were used as input for the featureCounts function of Rsubread v.2.2.6 (Liao et al., 2014) to generate a raw-count matrix. The raw counts were normalized by rlog transformation using DESeq2 (Love et al., 2014) with respect to library size. Pearson correlation coefficients were calculated based on the normalized counts for each pairwise comparison. Principal component analysis (PCA) and hierarchical clustering were also performed to evaluate the similarity between the replicates.
Peak annotation analysis
For each condition, the BAM alignment files of the replicates were merged and peak calling was performed with MACS2 v.2.1.1 (Zhang et al., 2008). Peak sets for each condition were annotated using the ChIPseaker v.1.24.0 (Yu et al., 2015) annotatePeak function, and the UCSC Genome Browser knownGene (mm10) table.
Obtaining coverage tracks
The BAM alignment files were converted to bigWig format and normalized by scaling factor (--scaleFactor) with the deepTools v.2.5.0.1 (Ramírez et al., 2014) bamCoverage function.
Enrichment of genomic signal around TSS
The bigWig files and the TSS coordinates obtained from the UCSC Genome Browser knownGene (mm10) table were used as input for the computeMatrix function of deepTools v.2.5.0.1 (Ramírez et al., 2014). This matrix was used for plotHeatmap function to generate the heatmap.
Identification of overlapping/unique accessible regions
For each comparison between the conditions, overlapping and unique accessible regions were identified with DiffBind v.2.16.2 (Stark, 2011) based on the measure of confidence in the peak call by MACS2 v.2.1.1 (Zhang et al., 2008).
Analysis of differentially accessible regions
The identification of differentially accessible regions (DARs) between the conditions was done using DiffBind v.2.16.2 (Stark, 2011) and edgeR v.3.30.1 (Robinson et al., 2010). Log fold changes were calculated, and their associated p-values were corrected for multiple hypothesis testing via the Benjamini–Hochberg procedure to obtain adjusted p-values. The DARs were annotated by their nearest gene using the annotatePeaks.pl function of Homer v.4.11 (Heinz et al., 2010).
Gene set enrichment analysis
Genes nearby the DARs were ranked based on the log-fold change calculated with edgeR v.3.30.1 (Robinson et al., 2010). This ranked list of genes was used as input to perform gene set enrichment analysis with the fgseaMultilevel function of the R package fgsea v.1.14.0 (Korotkevich et al., 2021). The FGSEA-multilevel method is based on an adaptive multi-level split Monte Carlo scheme, which allows the estimation of very low p-values. The Hallmark gene sets collection from the Molecular Signatures Database (MSigDB) (Korotkevich et al., 2021) was used as a reference to identify the biological processes that were significantly enriched.
Motif enrichment analysis
The identification of known TF motifs found in peaks overlapping the promoter region (±5 kb of TSS) was done using the findMotifsGenome.pl function from HOMER v.4.9.1 (Heinz et al., 2010). The -size parameter was set to given to use the exact peak region as target sequence. Following the screening of HOMER’s reliable motifs library against the target sequences, the motifs enriched with a p-value less than 0.05 are returned.
Animal care
All procedures that were performed on animals were approved by the McGill University Animal Care Committee (UACC), protocol #7512.The authors have described an innovative application of ATAC-Seq for genome-wide analysis of the chromatin state at single myofiber resolution.Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Decision letter after peer review:Thank you for submitting your article "Application of ATAC-Seq for genome-wide analysis of the chromatin state at single myofiber resolution" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Y M Dennis Lo as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Nora Yucel (Reviewer #3).The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. The majority opinion of the group is that the article would potentially be suitable as a Tools and Resources article in eLife.Essential revisions:1) The authors state multiple times that this technique gives good sequencing depth. As such, information should be provided regarding number of high quality reads per sample, and whether replicates were downsampled before peak calling.2) In Figure 1—figure supplement 1A, the x-axis label is not showing the correct size of the library.3) Can the authors provide the smfATAC-Seq genome tracks for Myod1 and Myog loci to illustrate the chromatin accessibility changes in uninjured and injured myofibers since these two genes are essential for muscle regeneration?4) In Line 169, remove redundant "can be" in the sentence.5) The gene names in Figure 5C are not shown clearly.6) The authors should consider a deeper analysis of the differential chromatin accessibility peaks (subdivided as promoters and distal regions), including prediction of TFs binding sites and integration with other appropriate datasets exploring epigenetic mechanisms (such as histone marks). In addition, the differential ATAC-seq peaks (mainly the ones overlapping putative promoters) should be combined with similar datasets exploring transcriptional changes and used to better infer gene networks characterizing the experimental groups. For example, by generating smfATAC-seq data from a slow-twitching muscle (Soleus), they could take advantage of available transcriptomic (https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0016807) and proteomic (https://www.embopress.org/doi/full/10.15252/embr.201439757) datasets.7) Chromatin accessibility analysis in satellite cells was performed by isolating cells from the mouse hindlimb. However, these data were compared to the smfTAC-seq from EDL myofibers. The authors should acknowledge the limitation of this comparison.8) If the authors intend for smfATACSeq to be performed broadly, it might be helpful to put it on a resource like https://www.protocols.io/ for other researchers to easily use and add notes.9) It would be valuable to systematically compare enrichment at non-myogenic promoters to emphasize the myonuclear enrichment. This could be shown by overlaying TSS enrichment plots for genes that are characteristic of myogenic, vs immune vs vascular cells.10) Total skeletal muscle ATAC-Seq has been previously published (Ramachandran, et al., PLoS Biology, 2019) in a variety of skeletal muscle types (including EDL vs soleus). How does smfATAC data compare to this ATACSeq data-- in particular are EDL-specific peaks also observed?11) The authors should include motif analysis of differential chromatin regions (uninjured vs injured, mdx vs WT, using unchanged regions as background). The authors state (line 341) that "Despite the increase in chromatin accessibility during injury, the accessible chromatin regions in both injured and uninjured fibers are associated with genes involved in similar biological processes." Motif analyses may in this case more be informative than GO, and could identify transcription factors with differential activity in the various experimental conditions.Reviewer #1 (Recommendations for the authors):1) The authors claim that the smfATAC-seq provides a high sequencing depth that allows for peak calling and differential peak analysis. Can the authors provide the exact sequencing depth in the method section?2) In Figure 1—figure supplement 1A, the x-axis label is not showing the correct size of the library.3) The concordance of the smfATAC-Seq data does not seem very good. In Figure 3, only 2 replicates are provided for uninjured fibers and they seem entirely separate. In Figure 6D, WT fibers also do not cluster very well. The authors should provide more replicates for the same condition to show the reproducibility of the approach.4) In Figure 3F, there are very few unique peaks in uninjured fibers compared with MuSCs. Does it mean the uninjured fibers are less accessible than MuSCs, or is it due to the different nuclei number input for ATAC-seq? This comparison is not simple and the authors should use the same nuclei number input for different samples.5) Can the authors provide the smfATAC-Seq genome tracks for Myod1 and Myog loci to illustrate the chromatin accessibility changes in uninjured and injured myofibers since these two genes are essential for muscle regeneration?6) In MDX mice, the myofibers undergo regeneration and degeneration cycles. Currently, the authors only compare the uninjured WT myofibers and the MDX myofibers. Can the authors also provide a detailed comparison between the CTX injured myofibers and the MDX myofibers to illustrate the difference in the chromatin accessibility profiles of the two conditions, if any? Alternatively, when is the peak of regeneration and degeneration cycles during the life of an MDX mouse? Again, the current study lacks depth and shows no biological insight.7) In Line 169, remove redundant "can be" in the sentence.8) The gene names in Figure 5C are not shown clearly.Reviewer #2 (Recommendations for the authors):The authors should consider a deeper analysis of the differential chromatin accessibility peaks (subdivided as promoters and distal regions), including prediction of TFs binding sites and integration with other appropriate datasets exploring epigenetic mechanisms (such as histone marks).In addition, the differential ATAC-seq peaks (mainly the ones overlapping putative promoters) should be combined with similar datasets exploring transcriptional changes and used to better infer gene networks characterizing the experimental groups. For example, by generating smfATAC-seq data from a slow-twitching muscle (Soleus), they could take advantage of available transcriptomic (https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0016807) and proteomic (https://www.embopress.org/doi/full/10.15252/embr.201439757) datasets.Reviewer #3 (Recommendations for the authors):The authors have done a good job in demonstrating data quality, and making it available through GEO. The methods are also quite clear. If the authors intend for smfATACSeq to be performed broadly, it might be helpful to put it on a resource like https://www.protocols.io/ for other researchers to easily use and add notes. Other specific points in no particular order:– In Figure 3B PCA is done on MuSCs vs uninjured vs injured fibers. It looks like the MuSCs are driving the differences in PC1, perhaps compressing the differences in fibers. Does injury segregate samples by PCA when the MuSCs are removed? On a similar note, in figure 6D, if injured fibers are included in the PCA along with mdx fibers (normalizing for what I assume are different sequencing preparations), are they intermediate to the mdx fibers, as stated in lines 384-386?– It would be valuable to systematically compare enrichment at non-myogenic promoters to emphasize the myonuclear enrichment. This could be shown by overlaying TSS enrichment plots for genes that are characteristic of myogenic, vs immune vs vascular cells.– Total skeletal muscle ATAC-Seq has been previously published (Ramachandran, et al., PLoS Biology, 2019) in a variety of skeletal muscle types (including EDL vs soleus). How does smfATAC data compare to this ATACSeq data-- in particular are EDL-specific peaks also observed?– The authors should include motif analysis of differential chromatin regions (uninjured vs injured, mdx vs WT, using unchanged regions as background). The authors state (line 341) that "Despite the increase in chromatin accessibility during injury, the accessible chromatin regions in both injured and uninjured fibers are associated with genes involved in similar biological processes." Motif analyses may in this case more be informative than GO, and could identify transcription factors with differential activity in the various experimental conditions.– The authors state multiple times that this technique gives good sequencing depth. As such, information should be provided regarding number of high quality reads per sample, and whether replicates were downsampled before peak calling.Essential revisions:1) The authors state multiple times that this technique gives good sequencing depth. As such, information should be provided regarding number of high quality reads per sample, and whether replicates were downsampled before peak calling.The detailed sequencing specifications were provided in Table 1. However, we have edited the text to refer to the number of reads when the sequencing depth is mentioned.For instance, the text on the lines 86-87 reads as:“The smfATAC-Seq has a sequencing depth of approximately 6 million final reads aligned that provides approximately 30 000 peaks called”As well as the text on the lines 109-111:“Following the removal of mitochondrial reads, there were approximately 6 million final reads aligned and 30 000 peaks called, demonstrating a sufficient sequencing depth for downstream analysis (Table 1).”2) In Figure 1—figure supplement 1A, the x-axis label is not showing the correct size of the library.We thank the reviewer for their careful observation. The labelling for the 300 bp was not placed correctly on the x-axis during the editing process. We have now placed the labels in the correct positions on the x-axis. The correct library size can now be accurately visualized on Figure 1—figure supplement 1A where the bioanalyzer peaks correspond to approximately 200 bp, 400 bp and 600 bp representing regions with mono-, di- and tri-nucleosomes respectively.3) Can the authors provide the smfATAC-Seq genome tracks for Myod1 and Myog loci to illustrate the chromatin accessibility changes in uninjured and injured myofibers since these two genes are essential for muscle regeneration?We have now included IGV tracks for all the Myogenic Regulatory Factors (MRFs) in Figure 2 —figure supplement 3. We have included these results in the text on lines 211-217 which reads as follows:“Muscle regeneration and repair rely on the temporal expression of Myogenic Regulatory factors (MRFs), Myf5, MyoD, Myog and Myf6/MRF4 (1-3). Therefore, we assessed the chromatin accessibility of the MRFs in MuSCs and in the myofibers under homeostasis and regeneration (Figure 2—figure supplement 3). We observed peaks in the promoter regions of Myf5 only in the MuSCs but not in the myofibers and peaks in the promoters of Myog and Myf6/MRF4 were solely observed in the myofibers (Figure 2—figure supplement 3). However, we observed peaks in the promoter regions of MyoD in both the MuSCs and myofibers (Figure 2—figure supplement 3).”4) In Line 169, remove redundant "can be" in the sentence.We have now removed the redundant wording in the revised text, please see line 242.5) The gene names in Figure 5C are not shown clearly.We have now edited the figure to make the gene names clearer and readable.6) The authors should consider a deeper analysis of the differential chromatin accessibility peaks (subdivided as promoters and distal regions), including prediction of TFs binding sites and integration with other appropriate datasets exploring epigenetic mechanisms (such as histone marks). In addition, the differential ATAC-seq peaks (mainly the ones overlapping putative promoters) should be combined with similar datasets exploring transcriptional changes and used to better infer gene networks characterizing the experimental groups. For example, by generating smfATAC-seq data from a slow-twitching muscle (Soleus), they could take advantage of available transcriptomic (https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0016807) and proteomic (https://www.embopress.org/doi/full/10.15252/embr.201439757) datasets.We have now performed comparative analysis between our smfATAC-Seq and ChIPSeq performed on EDL muscle for H3K27ac by Ramachandran, et al., 2019. The figure for this analysis can be found in Figure 2 —figure supplement 2K. We now discuss the results of this analysis in the lines 184- 191 which reads as follows:“Accessible chromatin regions are associated with various histone marks such as H3K27ac and H3K4me3 (4-6). Thus, we compared the smfATAC-Seq to publicly available datasets on ChIP-Seq on H3K27ac in EDL muscle that was previously performed by Ramachandran, et al., 2019 (GSM3515022, GSM3515023) (7). The comparative analysis has revealed that there were only 97 peaks in the smfATAC-Seq that did not overlap with the H3K27ac peaks, while the majority of the peaks, 6090 peaks, were common to the H3K27ac peaks present in the entire EDL muscle (Figure 2—figure supplement 2K). This demonstrates that the accessible regions that are assessed by smfATAC-Seq correspond to the regions of the chromatin marked by histones that are associated with open chromatin such as H3K27ac.”7) Chromatin accessibility analysis in satellite cells was performed by isolating cells from the mouse hindlimb. However, these data were compared to the smfTAC-seq from EDL myofibers. The authors should acknowledge the limitation of this comparison.We do understand the reviewers comment that MuSCs and myofibers are different. However, since muscle fibers are derived from fusion of muscle stem cells during development and regeneration, we find it interesting to compare the chromatin states between these different cell types.Since our manuscript is a “tools and resource” article, our main aim in inclusion of the MuSCs ATAC-Seq data was to compare the quality of the conventional OMNI ATAC-Seq on 5000 cells to our new protocol on a single myofiber that contains only about 200-300 myonuclei. Through this comparison, we show that smfATAC-Seq can also provide high resolution assessment of chromatin accessibility a single muscle fiber8) If the authors intend for smfATACSeq to be performed broadly, it might be helpful to put it on a resource like https://www.protocols.io/ for other researchers to easily use and add notes.We agree with the reviewer, and we are preparing a step-by-step protocol to be submitted to Bio-protocol.9) It would be valuable to systematically compare enrichment at non-myogenic promoters to emphasize the myonuclear enrichment. This could be shown by overlaying TSS enrichment plots for genes that are characteristic of myogenic, vs immune vs vascular cells.In addition to the figure that we presented in the initial submission (Figure 2—figure supplement 1), we have now looked at the enrichment of non- myogenic genes more globally. First, we compared the enrichment of ATAC-Seq peaks on non-myogenic genes in our smfATAC-Seq with an independent ATAC-Seq performed on whole EDL muscle by Ramachandran et al., 2019 (GSM3981673) (7) (Table 2) which contains non myogenic muscle resident cells in addition to the myogenic cells as it is representative of the whole muscle. The results of this comparison can be seen in Table 2.We have discussed the results of this analysis in the lines 127-143 which reads as follows:“Given that the whole muscle contains non-myogenic cell types, we first compared smfATAC-Seq to an ATAC-Seq performed on whole EDL muscle from Ramachandran, et al., 2019 (GSM3981673) (7) for the enrichment of ATAC-Seq peaks on the genes of non-myogenic cells. We obtained the list of genes that are solely expressed in the whole muscle (RPM of at least 10) but not in the myofibers (RPM of 0) by using an RNA-Seq dataset performed on whole muscle and a single myofiber by Blackburn, et al., 2019 (GSE138591) (8). This list represents genes that are only expressed by the muscle resident non-myogenic cell types, designated as non-fiber muscle genes. We determined the number of peaks in smfATAC-Seq that overlap with non-fiber muscle genes which revealed that only 0.1% of the peaks overlapped with the top 100 non-fiber muscle genes (Table 2). In comparison, 0.33% of the peaks in the whole EDL muscle ATAC-Seq(GSM3981673) (7) overlapped with the top 100 non-fiber muscle genes (Table 2). The significant difference in the overlap with the non-fiber muscle genes between the whole muscle ATAC-Seq and smfATAC-Seq suggest that the whole muscle ATAC-Seq has enrichment of peaks associated with non-myogenic genes when compared to the smfATAC-Seq which implies that smfATAC-Seq can successfully exclude the non-myogenic cell types. In contrast, number of overlapping peaks with all the genes expressed in whole muscle in the EDL ATAC-Seq and smfATAC-Seq were similar (Table 2).”10) Total skeletal muscle ATAC-Seq has been previously published (Ramachandran, et al., PLoS Biology, 2019) in a variety of skeletal muscle types (including EDL vs soleus). How does smfATAC data compare to this ATACSeq data-- in particular are EDL-specific peaks also observed?We have now compared our smfATAC-Seq on the uninjured myofiber to the whole EDL muscle ATAC-Seq that was mentioned by the reviewer (Ramachandran, et al., 2019). We have determined that 65% of the peaks in the smfATAC-Seq overlap with the ATAC-Seq of the whole muscle by at least 1 bp. We have included a detailed table on the overlap between the two datasets (Table 3).We discuss the results of this comparison in the lines 179-182:“We also analyzed the overlap between the smfATAC-Seq on single EDL myofibers with the ATAC-Seq performed on the whole EDL muscle by Ramachandran, et al., 2019 (GSM3981673) (7). This analysis revealed that 65% of the smfATAC-Seq peaks in the single uninjured myofibers overlap with the whole EDL muscle ATAC-Seq (Table 3).”11) The authors should include motif analysis of differential chromatin regions (uninjured vs injured, mdx vs WT, using unchanged regions as background). The authors state (line 341) that "Despite the increase in chromatin accessibility during injury, the accessible chromatin regions in both injured and uninjured fibers are associated with genes involved in similar biological processes." Motif analyses may in this case more be informative than GO, and could identify transcription factors with differential activity in the various experimental conditions.We have now performed motif analysis and presented the new data in new Figure 4 —figure supplement 4. This data is included in the text in the lines 298-306 which reads as follows:“Furthermore, we analyzed the enrichment of transcription factor binding motifs in the sequences under peaks common between the injured and uninjured myofibers overlapping the promoters (+/- 5kb of TSS) (Figure 4—figure supplement 2A) as well as in the peaks that are unique to injured and uninjured myofibers overlapping the promoters (+/- 5kb of TSS) (Figure 4—figure supplement 2B). The top motifs that were enriched in the sequences under peaks common to injured and uninjured myofibers include binding site for Mef2a (Figure 4—figure supplement 2A). On the other hand, the top motifs that were enriched in the sequences under peaks unique to injured myofibers included binding sites for JUN and Stat3 (Figure 4—figure supplement 2B). However, due to the low number of unique peaks in the uninjured myofibers(Figure 3F), there was no significant motif that enriched in that peak set.”We have also performed motif analysis for WT and MDX myofibers in Figure 6 —figure supplement 5, in lines 384-390:“Finally, we determined the top motifs that are enriched in the sequences under the peaks that are common between the mdx and WT myofibers overlapping the promoters (+/- 5 kb of TSS) (Figure 6—figure supplement 5A) as well as the sequences under peaks that are unique to mdx and WT overlapping the promoters (+/- 5 kb of TSS) (Figure 6—figure supplement 5B-C). The top significantly enriched motifs in the peaks common between mdx and WT included Mef2a and JUN (Figure 6—figure supplement 5A) while the top motifs enriched in the peaks unique to mdx included transcription factors such as Foxo1 (Figure 6—figure supplement 5B).”Reviewer #1 (Recommendations for the authors):1) The authors claim that the smfATAC-seq provides a high sequencing depth that allows for peak calling and differential peak analysis. Can the authors provide the exact sequencing depth in the method section?The detailed sequencing specifications were provided in Table 1. However, we have edited the text to refer to the number of reads when the sequencing depth is mentioned.For instance, the text on the lines 86-87 reads as: “The smfATAC-Seq has a sequencing depth of approximately 6 million final reads aligned that provides approximately 30 000 peaks called” as well as the text on the lines 109-111:“Following the removal of mitochondrial reads, there were approximately 6 million final reads aligned and 30 000 peaks called, demonstrating a sufficient sequencing depth for downstream analysis (Table 1).”2) In Figure 1—figure supplement 1A, the x-axis label is not showing the correct size of the library.We thank the reviewer for their careful observation. The labelling for the 300 bp was not placed correctly on the x-axis during the editing process. We have now placed the labels in the correct positions on the x-axis. The correct library size can now be accurately visualized on Figure 1—figure supplement 1A where the bioanalyzer peaks correspond to approximately 200 bp, 400 bp and 600 bp representing regions with mono-, di- and tri-nucleosomes respectively.3) The concordance of the smfATAC-Seq data does not seem very good. In Figure 3, only 2 replicates are provided for uninjured fibers and they seem entirely separate. In Figure 6D, WT fibers also do not cluster very well. The authors should provide more replicates for the same condition to show the reproducibility of the approach.It is well established that there is a high degree of variation between the myofibers of skeletal muscles. A recent study of RNA-seq on a single myofiber exhibited variations between the individual myofibers within the same condition (8). In addition, another recent study using snRNA-seq found great variation in the transcriptome of myonuclei from the same myofibers (9). In our smfATAC-Seq, while the two uninjured fibers are not identical, they are still very similar as they vary only along the principal component 2 which represents a variation of only 10%. Similarly, while the WT myofibers in Figure 6D also display heterogeneity, they are still more closely associated to the other WT myofibers than to the mdx myofibers.4) In Figure 3F, there are very few unique peaks in uninjured fibers compared with MuSCs. Does it mean the uninjured fibers are less accessible than MuSCs, or is it due to the different nuclei number input for ATAC-seq? This comparison is not simple and the authors should use the same nuclei number input for different samples.The difference in the number of unique peaks between uninjured myofibers and MuSCs are possibly due to the difference in the number of input nuclei. OMNI ATAC-Seq was performed on 5000 MuSCs while the smfATAC-Seq was performed on a single myofiber that contains 200-300 myonuclei. The reason for the inclusion of the MuSC ATAC-Seq data in this manuscript was for the purpose of quality control comparison.5) Can the authors provide the smfATAC-Seq genome tracks for Myod1 and Myog loci to illustrate the chromatin accessibility changes in uninjured and injured myofibers since these two genes are essential for muscle regeneration?We have now included IGV tracks for all the Myogenic Regulatory Factors (MRFs) in Figure 2 —figure supplement 3. We have included these results in the text on lines 211-217 which reads as follows:“Muscle regeneration and repair rely on the temporal expression of Myogenic Regulatory factors (MRFs), Myf5, MyoD, Myog and Myf6/MRF4 (1-3). Therefore, we assessed the chromatin accessibility of the MRFs in MuSCs and in the myofibers under homeostasis and regeneration (Figure 2—figure supplement 3). We observed peaks in the promoter regions of Myf5 only in the MuSCs but not in the myofibers and peaks in the promoters of Myog and Myf6/MRF4 were solely observed in the myofibers (Figure 2—figure supplement 3). However, we observed peaks in the promoter regions of MyoD in both the MuSCs and myofibers (Figure 2—figure supplement 3).”6) In MDX mice, the myofibers undergo regeneration and degeneration cycles. Currently, the authors only compare the uninjured WT myofibers and the MDX myofibers. Can the authors also provide a detailed comparison between the CTX injured myofibers and the MDX myofibers to illustrate the difference in the chromatin accessibility profiles of the two conditions, if any? Alternatively, when is the peak of regeneration and degeneration cycles during the life of an MDX mouse? Again, the current study lacks depth and shows no biological insight.The focus of a “Tools and Resource” paper is to validate a new method and not necessarily provide novel biological insights or discoveries. Due to the difference in the genetic background of the mice of injured (C57/BL6) and mdx (C57BL/10ScSn-Dmdmdx/J), the comparison between them might not be appropriate and informative. However, since GO term analysis revealed similar processes between injured and mdx myofibers, we assessed the overall difference in chromatin accessibility by performing heatmap clustering of Pearson correlation coefficients and the PCA analysis on mdx, WT and injured myofibers (Figure 6 —figure supplement 4). Figure 6 —figure supplement 4B shows that while mdx and WT myofibers are more similar to each other than they are to the injured myofibers. However the injured myofibers were more similar to mdx than they are to the WT myofibers. In the future, it would be interesting to perform smfATAC-Seq on mdx and WT mice that are injured in order to compare the myofiber chromatin accessibility during regeneration in a diseased context.7) In Line 169, remove redundant "can be" in the sentence.We have now removed the redundant wording in the revised text, please see line 242.8) The gene names in Figure 5C are not shown clearly.We have now edited the figure to make the gene names clearer and readable.Reviewer #2 (Recommendations for the authors):The authors should consider a deeper analysis of the differential chromatin accessibility peaks (subdivided as promoters and distal regions), including prediction of TFs binding sites and integration with other appropriate datasets exploring epigenetic mechanisms (such as histone marks).In addition, the differential ATAC-seq peaks (mainly the ones overlapping putative promoters) should be combined with similar datasets exploring transcriptional changes and used to better infer gene networks characterizing the experimental groups. For example, by generating smfATAC-seq data from a slow-twitching muscle (Soleus), they could take advantage of available transcriptomic (https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0016807) and proteomic (https://www.embopress.org/doi/full/10.15252/embr.201439757) datasets.We have now performed comparative analysis between our smfATAC-Seq and ChIPSeq performed on EDL muscle for H3K27ac by Ramachandran, et al., 2019. The figure for this analysis can be found in Figure 2 —figure supplement 2K. We now discuss the results of this analysis in the lines 184-191 which reads as follows:“Accessible chromatin regions are associated with various histone marks such as H3K27ac and H3K4me3 (4-6). Thus, we compared the smfATAC-Seq to publicly available datasets on ChIP-Seq on H3K27ac in EDL muscle that was previously performed by Ramachandran, et al., 2019 (GSM3515022, GSM3515023) (7). The comparative analysis has revealed that there were only 97 peaks in the smfATAC-Seq that did not overlap with the H3K27ac peaks, while the majority of the peaks, 6090 peaks, were common to the H3K27ac peaks present in the entire EDL muscle (Figure 2—figure supplement 2K). This demonstrates that the accessible regions that are assessed by smfATAC-Seq correspond to the regions of the chromatin marked by histones that are associated with open chromatin such as H3K27ac.”Reviewer #3 (Recommendations for the authors):The authors have done a good job in demonstrating data quality, and making it available through GEO. The methods are also quite clear. If the authors intend for smfATACSeq to be performed broadly, it might be helpful to put it on a resource like https://www.protocols.io/ for other researchers to easily use and add notes.We agree with the reviewer, and we are preparing a manuscript detailing step-by-step protocol to be submitted to Bio-protocol.Other specific points in no particular order:– In Figure 3B PCA is done on MuSCs vs uninjured vs injured fibers. It looks like the MuSCs are driving the differences in PC1, perhaps compressing the differences in fibers. Does injury segregate samples by PCA when the MuSCs are removed? On a similar note, in figure 6D, if injured fibers are included in the PCA along with mdx fibers (normalizing for what I assume are different sequencing preparations), are they intermediate to the mdx fibers, as stated in lines 384-386?We have now performed the PCA analysis solely with uninjured and injured myofibers, without the MuSC samples (Figure 3 —figure supplement 1). The injured and uninjured myofibers cluster separately, showing their overall difference.Findings of this analysis is discussed in the lines 225-229 which reads as follows:“To test whether the differences between regenerating and resting myofibers are overshadowed by their differences with MuSCs, we performed heatmap clustering of Pearson correlation coefficients and PCA analysis for injured and uninjured myofibers only, without MuSCs (Figure 3—figure supplement 1). This further highlighted how the uninjured and injured myofibers cluster separately (Figure 3—figure supplement 1).”Furthermore, we have also performed the PCA analysis with mdx, WT and injured myofibers in new Figure 6 —figure supplement 4. Findings of this analysis is discussed in the lines 374-382 which reads as:“Since the observed differential biological processes between WT and mdx myofibers were similar to those seen between injured vs uninjured myofibers, we then compared the overall differences in chromatin accessibility between mdx, WT, and injured myofibers. We performed heatmap clustering of Pearson correlation and PCA analysis between WT, mdx and injured myofibers (Figure 6—figure supplement 4). These analyses have revealed that injured myofibers were more similar to the mdx than they are to the WT C57BL/10ScSn myofibers. However, as expected due to the different backgrounds of the mice between injured and the WT and mdx mice, WT and mdx myofibers were more similar to each other than they are to the injured C57BL/6 myofibers (Figure 6—figure supplement 4).”– It would be valuable to systematically compare enrichment at non-myogenic promoters to emphasize the myonuclear enrichment. This could be shown by overlaying TSS enrichment plots for genes that are characteristic of myogenic, vs immune vs vascular cells.In addition to the figure that we presented in the initial submission (Figure 2—figure supplement 1), we have now looked at the enrichment of non-myogenic genes more globally. First, we compared the enrichment of ATAC-Seq peaks on non-myogenic genes in our smfATAC-Seq with an independent ATAC-Seq performed on whole EDL muscle by Ramachandran et, al. 2019 (GSM3981673) (7) (Table 2) which contains non myogenic muscle resident cells in addition to the myogenic cells as it is representative of the whole muscle. The results of this comparison can be seen in Table 2.We have discussed the results of this analysis in the lines 127-143 which reads as follows:“Given that the whole muscle contains non-myogenic cell types, we first compared smfATACSeq to an ATAC-Seq performed on whole EDL muscle from Ramachandran, et al., 2019 (GSM3981673) (7) for the enrichment of ATAC-Seq peaks on the genes of non-myogenic cells. We obtained the list of genes that are solely expressed in the whole muscle (RPM of at least 10) but not in the myofibers (RPM of 0) by using an RNA-Seq dataset performed on whole muscle and a single myofiber by Blackburn, et al., 2019 (GSE138591) (8). This list represents genes that are only expressed by the muscle resident non-myogenic cell types, designated as non-fiber muscle genes. We determined the number of peaks in smfATAC-Seq that overlap with non-fiber muscle genes which revealed that only 0.1% of the peaks overlapped with the top 100 non-fiber muscle genes (Table 2). In comparison, 0.33% of the peaks in the whole EDL muscle ATAC-Seq(GSM3981673) (7) overlapped with the top 100 non-fiber muscle genes (Table 2). The significant difference in the overlap with the non-fiber muscle genes between the whole muscle ATAC-Seq and smfATAC-Seq suggest that the whole muscle ATAC-Seq has enrichment of peaks associated with non-myogenic genes when compared to the smfATAC-Seq which implies that smfATAC-Seq can successfully exclude the non-myogenic cell types. In contrast, number of overlapping peaks with all the genes expressed in whole muscle in the EDL ATAC-Seq and smfATAC-Seq were similar (Table2).”– Total skeletal muscle ATAC-Seq has been previously published (Ramachandran, et al., PLoS Biology, 2019) in a variety of skeletal muscle types (including EDL vs soleus). How does smfATAC data compare to this ATACSeq data-- in particular are EDL-specific peaks also observed?We have now compared our smfATAC-Seq on the uninjured myofiber to the whole EDL muscle ATAC-Seq that was mentioned by the reviewer (Ramachandran, et al., 2019). We have determined that 65% of the peaks in the smfATAC-Seq overlap with the ATAC-Seq of the whole muscle by at least 1 bp. We have included a detailed table on the overlap between the two datasets (Table 3).We discuss the results of this comparison in the lines 179-182:“We also analyzed the overlap between the smfATAC-Seq on single EDL myofibers with the ATAC-Seq performed on the whole EDL muscle by Ramachandran, et al., 2019 (GSM3981673) (7). This analysis revealed that 65% of the smfATAC-Seq peaks in the uninjured myofiber overlap with the whole EDL muscle ATAC-Seq (Table 3).”– The authors should include motif analysis of differential chromatin regions (uninjured vs injured, mdx vs WT, using unchanged regions as background). The authors state (line 341) that "Despite the increase in chromatin accessibility during injury, the accessible chromatin regions in both injured and uninjured fibers are associated with genes involved in similar biological processes." Motif analyses may in this case more be informative than GO, and could identify transcription factors with differential activity in the various experimental conditions.We have now performed motif analysis and presented the new data in new Figure 4 —figure supplement 4. This data is included in the text in the lines 298-306 which reads as follows:“Furthermore, we analyzed the enrichment of transcription factor binding motifs in the sequences under peaks common between the injured and uninjured myofibers overlapping the promoters (+/- 5kb of TSS) (Figure 4—figure supplement 2A) as well as in the peaks that are unique to injured and uninjured myofibers overlapping the promoters (+/- 5kb of TSS) (Figure 4—figure supplement 2B). The top motifs that were enriched in the sequences under peaks common to injured and uninjured myofibers include binding site for Mef2a (Figure 4—figure supplement 2A). On the other hand, the top motifs that were enriched in the sequences under peaks unique to injured myofibers included binding sites for JUN and Stat3 (Figure 4—figure supplement 4B). However, due to the low number of unique peaks in the uninjured myofibers(Figure 3F), there was no significant motif that enriched in that peak set.”We have also performed motif analysis for WT and mdx myofibers in Figure 6 —figure supplement 5, in lines 384-390:“Finally, we determined the top motifs that are enriched in the sequences under the peaks that are common between the mdx and WT myofibers overlapping the promoters (+/- 5 kb of TSS) (Figure 6—figure supplement 5A) as well as the sequences under peaks that are unique to mdx and WT overlapping the promoters (+/- 5 kb of TSS) (Figure 6—figure supplement 5B-C). The top significantly enriched motifs in the peaks common between mdx and WT included Mef2a and JUN (Figure 6—figure supplement 5A) while the top motifs enriched in the peaks unique to mdx included transcription factors such as Foxo1 (Figure 6—figure supplement 5B).”– The authors state multiple times that this technique gives good sequencing depth. As such, information should be provided regarding number of high quality reads per sample, and whether replicates were downsampled before peak calling.The detailed sequencing specifications were provided in Table 1. However, we have edited the text to refer to the number of reads when the sequencing depth is mentioned.For instance, the text on the lines 86-87 reads as:“The smfATAC-Seq has a sequencing depth of approximately 6 million final reads aligned that provides approximately 30 000 peaks called” as well as the text on the lines 109-111: “Following the removal of mitochondrial reads, there were approximately 6 million final reads aligned and 30 000 peaks called, demonstrating a sufficient sequencing depth for downstream analysis (Table 1).”References:1. Hernandez-Hernandez, J. M., Garcia-Gonzalez, E. G., Brun, C. E., and Rudnicki, M. A. (2017) The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin Cell Dev Biol 72, 10-182. Montarras, D., Chelly, J., Bober, E., Arnold, H., Ott, M. O., Gros, F., and Pinset, C. (1991) Developmental patterns in the expression of Myf5, MyoD, myogenin, and MRF4 during myogenesis. New Biol 3, 592-6003. Asfour, H. A., Allouh, M. Z., and Said, R. S. (2018) Myogenic regulatory factors: The orchestrators of myogenesis after 30 years of discovery. Exp Biol Med (Maywood) 243, 118-1284. Zhang, T., Cooper, S., and Brockdorff, N. (2015) The interplay of histone modifications – writers that read. EMBO Rep 16, 1467-14815. Berger, S. L. (2007) The complex language of chromatin regulation during transcription. Nature 447, 407-4126. Barrera, L. O., Li, Z., Smith, A. D., Arden, K. C., Cavenee, W. K., Zhang, M. Q., Green, R. D., and Ren, B. (2008) Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs. Genome Res 18, 46-597. Ramachandran, K., Senagolage, M. D., Sommars, M. A., Futtner, C. R., Omura, Y., Allred, A. L., and Barish, G. D. (2019) Dynamic enhancers control skeletal muscle identity and reprogramming. PLoS Biol 17, e30004678. Blackburn, D. M., Lazure, F., Corchado, A. H., Perkins, T. J., Najafabadi, H. S., and Soleimani, V. D. (2019) High-resolution genome-wide expression analysis of single myofibers using SMART-Seq. J Biol Chem 294, 20097-201089. Petrany, M. J., Swoboda, C. O., Sun, C., Chetal, K., Chen, X., Weirauch, M. T., Salomonis, N., and Millay, D. P. (2020) Single-nucleus RNA-seq identifies transcriptional heterogeneity in multinucleated skeletal myofibers. Nat Commun 11, 6374
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Genetic reagent (M. musculus)
C57BL/6 J
The Jackson Laboratory
Stock #: 000664
Genetic reagent (M. musculus)
C57BL/10ScSnJ
The Jackson Laboratory
Stock #: 000476
Genetic reagent (M. musculus)
C57BL/10ScSn-Dmdmdx/J
The Jackson Laboratory
Stock #: 001801
Genetic reagent (M. musculus)
Tg(Pax7-EGFE)#Tagb (Pax7-nGFP)
Sambasivan, R. et al. Distinct Regulatory Cascades Govern Extraocular and Pharyngeal Arch Muscle Progenitor Cell Fates. Developmental Cell, (2009). (Sambasivan et al., 2009)
PMID:19531352
Dr. Shahragim Tajbakhsh (Institut Pasteur)
Commercial kit or assay
Tn5 transposase
Illumina
Cat #: 20034197
Commercial kit or assay
Nextera XT adaptors
Illumina
Cat #: FC-131–1001
Commercial kit or assay
QIAquick PCR purification kit
Qiagen
Cat #: 28,104
Chemical compound, drug
Triton X –100
Sigma-Aldrich
Cat #: T9284
Chemical compound, drug
Tween-20
Sigma-Aldrich
Cat #: P1379-1L
Chemical compound, drug
Digitonin
Promega
Cat #: G9441
Chemical compound, drug
Collagenase D
Roche
Cat #: 11088882001
2.4 U/mL
Chemical compound, drug
Collagenase
Sigma-Aldrich
Cat #: C0130
1000 U/mL
Chemical compound, drug
Dispase II
Roche
Cat #: 39307800
12 U/mL
Chemical compound, drug
Cardiotoxin
Sigma Aldrich
Cat #: 11061-96-4
Sequence-based reagent
MyoD_L
This paper
PCR primers
TGCTCCTTTGAGACAGCAGA
Sequence-based reagent
MyoD_R
This paper
PCR primers
AGTAGGGAAGTGTGCGTGCT
Other
Q5 High Fidelity DNA polymerase
New England Biolabs
Cat #: M0491S
For amplification of DNA post Tn5 tagmentation (see Library Preparation)
Chemical compound
DAPI stain
Invitrogen
Cat #: D3671
(5 mg/mL)
Other
Ampure XP beads
Beckman
Cat #: A63880
For library size selection at a concentration of 0.85 x (see Library Preparation)
Authors: Rachel Nilwik; Tim Snijders; Marika Leenders; Bart B L Groen; Janneau van Kranenburg; Lex B Verdijk; Luc J C van Loon Journal: Exp Gerontol Date: 2013-02-17 Impact factor: 4.032
Authors: Aaron W B Joe; Lin Yi; Anuradha Natarajan; Fabien Le Grand; Leslie So; Joy Wang; Michael A Rudnicki; Fabio M V Rossi Journal: Nat Cell Biol Date: 2010-01-17 Impact factor: 28.824
Authors: Alexandro E Trevino; Nasa Sinnott-Armstrong; Jimena Andersen; Se-Jin Yoon; Nina Huber; Jonathan K Pritchard; Howard Y Chang; William J Greenleaf; Sergiu P Pașca Journal: Science Date: 2020-01-24 Impact factor: 47.728