| Literature DB >> 35187077 |
Nikta Nateghi1, Ehsan Karimi1, Ehsan Oskoueian2.
Abstract
The objective of this research was to develop the nanoliposome-encapsulated phenolic rich fraction from Achillea millefolium (A. millefolium) and to investigate its antibacterial and health-promoting activities in mice challenged by pathogenic foodborne Campylobacter jejuni. The A. millefolium was extracted and the ethyl acetate fraction was found to be the phenolic-rich fraction (PRF) containing 14.72 ± 2.39 mg gallic acid equivalent (GAE)/g dry weight (DM). Base on the results, the synthesized nanoliposome-loaded PRF (PRF-NLs) with the size of 187.2 nm exhibited homogeneous dispersion (PDI 0.213) and moderate stability behavior in colloidal dispersions (Zeta potential -37.45). The non-encapsulated PRF and PRF-NLs were gavaged orally in the mice for 28 days, and mice were challenged with C. jejuni on day 21. The results indicated that the dietary supplementation of non-encapsulated PRF and PRF-NLs significantly (p < 0.05) improved the average daily weight gain, food intake, liver function, antioxidant status, and morphostructural characteristics of the ileum. However, the PRF-NLs appeared to be more potent as compared to non-encapsulated PRF. The higher biological activity of PRF-NLs could be associated with the higher intestinal solubility and absorption of nanoliposome-encapsulated PRF. Thereby, the nanoliposome-encapsulated PRF could be considered as a natural antibiotic alternative called phytobiotic to prevent intestinal infection caused by enteropathogenic C. jejuni.Entities:
Keywords: antibiotic alternative; gene expression; phytobiotic; phytogenics; target delivery
Year: 2022 PMID: 35187077 PMCID: PMC8847675 DOI: 10.3389/fmolb.2021.832022
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
The primer sets characteristics used in this study.
| Gene | Forward (5′ →3′) | Reverse (5′ →3′) | References |
|---|---|---|---|
| COX2 | caagcagtggcaaaggcctcca | ggcacttgcattgatggtggct |
|
| iNOS | caccttggagttcacccagt | accactcgtacttgggatgc |
|
| SOD | gagacctgggcaatgtgact | gtttactgcgcaatcccaat |
|
| GPx | gtccaccgtgtatgccttct | tctgcagatcgttcatctcg |
|
| β-actin | cctgaaccctaaggccaacc | cagctgtggtggtgaagctg |
|
The list of the primers used for ileum microbial population analysis.
| Bacteria | Forward (5′ →3′) | Reverse (5′ →3′) | References | ||
|---|---|---|---|---|---|
|
| cgggatagttatagtattgaagtt | gaaggagcataataggatcttg |
| ||
| Total bacteria | cggcaacgagcgcaaccc | ccattgtagcacgtgtgtagcc |
| ||
FIGURE 1The zeta potential of Achillea millefolium phenolics-loaded nanoliposomes.
FIGURE 2The FESEM analysis of Achillea millefolium phenolics-loaded nanoliposomes.
Phenolic compounds presented in Achillea millefolium phenolics-loaded nanoliposomes.
| Phenolic compounds (µg/g DW) | ||||||
|---|---|---|---|---|---|---|
| GA | SY | FA | CA | EA | SA | CH |
| 132 ± 3.1 | 305 ± 4.8 | 519 ± 4.6 | 832 ± 2.7 | 248 ± 3.3 | 971 ± 1.5 | 169 ± 3.8 |
GA, gallic acid; SY, syringic acid; FA, ferulic acid; CA, caffeic acid; EA, ellagic acid; SA, salicylic acid; CH, chrysin.
The averages of mice body weight changes and feed intake upon receiving different treatments.
| Average | T1 | T2 | T3 | T4 | SEM |
|---|---|---|---|---|---|
| Average daily weight gain (g) | 0.21a | 0.13d | 0.15c | 0.17b | 0.05 |
| Average daily feed intake (g) | 3.4a | 2.7c | 3.1b | 3.3a | 0.11 |
T1: normal diet; T2: normal diet + infected by C. jejuni on day 21; T3: Normal diet enriched by PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21; T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21.
Values with diferent superscript letters in the same row are signifcantly diferent (p < 0.05).
The results of liver enzymes and lipid peroxidation.
| Liver enzymes | T1 | T2 | T3 | T4 | SEM |
|---|---|---|---|---|---|
| ALP (IU/L) | 204.8d | 258.1a | 243.0b | 228.7c | 6.89 |
| SGPT (IU/L) | 98.5d | 151.3a | 139.4b | 126.5c | 3.57 |
| SGOT (IU/L) | 139.5d | 173.5a | 143.1b | 135.6c | 4.62 |
| MDA (changes relative to control) | 100d | 132.5a | 121.4b | 116.7c | 5.12 |
T1: normal diet; T2: normal diet + infected by C. jejuni on day 21; T3: Normal diet enriched by PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21; T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21.
Values with diferent superscript letters in the same row are signifcantly diferent (p < 0.05).
FIGURE 3Histopathological analysis of liver, kidney, and ileum of the mice treated with different treatment. T1: normal diet; T2: normal diet + infected by C. jejuni on day 21; T3: Normal diet enriched by PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21; T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21.
Morphometric analysis of ileum in the mice receiving different treatments.
| Parameters | T1 | T2 | T3 | T4 | SEM |
|---|---|---|---|---|---|
| Villus Height (µm) | 423.8c | 408.7d | 435.4b | 452.6a | 7.86 |
| Villus Width (µm) | 127.4c | 101.3d | 138.2b | 145.1a | 9.34 |
| Crypt Depth (µm) | 132.5b | 152.6a | 134.3b | 114.7c | 7.66 |
| Mean number of Goblet Cells | 5.1a | 3.5b | 3.6b | 4.7a | 0.86 |
T1: normal diet; T2: normal diet + infected by C. jejuni on day 21; T3: Normal diet enriched by PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21; T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21.
Values with diferent superscript letters in the same row are signifcantly diferent (p < 0.05).
Gene expression analysis of the mice received different treatments.
| Fold changes | SEM | ||||
|---|---|---|---|---|---|
| Genes | T1 | T2 | T3 | T4 | |
| COX2 | 1.0d | +5.1a | +3.3b | +2.4c | 0.06 |
| iNOS | 1.0d | +6.8a | +4.7b | +3.3c | 0.17 |
| SOD | 1.0c | −3.89d | +1.1b | +1.8a | 0.09 |
| GPx | 1.0c | −1.93d | +1.8b | +2.1a | 0.14 |
T1: normal diet; T2: normal diet + infected by C. jejuni on day 21; T3: Normal diet enriched by PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21; T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21.
Values with diferent superscript letters in the same row are signifcantly diferent (p < 0.05).
FIGURE 4Relative fold changes of C. jejuni population in ileum digesta. T1: normal diet; T2: normal diet + infected by C. jejuni on day 21; T3: Normal diet enriched by PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21; T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by C. jejuni on day 21.