| Literature DB >> 35186944 |
Xin Kang1,2,3, Ying Chen1,2,3,4,5, Xiaohong Xin1,2,3, Menghan Liu1,2,3, Yuan Ma1,2,3, Yifei Ren1,2,3, Jing Ji1,2,3, Qi Yu1,2,3, Lei Qu1,2,3, Suxia Wang6, Gang Liu1,2,3,4,5, Chengang Xiang1,2,3,4,5, Li Yang1,2,3,4,5.
Abstract
Background: Cisplatin is a widely used chemotherapeutic drug, whereas the clinical application is greatly limited by its nephrotoxic side effect. Currently, there has been no effective treatment to prevent cisplatin-induced acute kidney injury (cisplatin-AKI). Human amniotic epithelial cells (hAECs) and their derived exosomes (EXOs) have been proven to effectively protect against ischemia reperfusion-induced AKI, yet their roles in cisplatin-AKI are still unknown.Entities:
Keywords: acute kidney injury; chemotherapy; cisplatin; exosomes; human amniotic epithelial cells (hAECs)
Year: 2022 PMID: 35186944 PMCID: PMC8851426 DOI: 10.3389/fcell.2021.752053
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
FIGURE 1Effects of hAECs or EXOs on C57BL/6J mice with cisplatin-AKI. (A) The 6-day mortality rate in mice treated with 20 mg/kg cisplatin (n = 9 or 10 mice in each group). (B) sCr levels of mice treated with 15 mg/kg cisplatin (n = 10). (C) Representative micrographs of PAS staining of kidneys from mice with 15 mg/kg cisplatin treatment. Triangle indicates renal tubular necrosis, pentagram indicates the shedding of the brush edge of renal tubules, and arrow indicates the formation of renal casts. Scale bar, 100 μm. (D) Semiquantitative renal pathological scores of mice treated with 15 mg/kg cisplatin (n = 3). (E) Representative Western blots showing protein expression of KIM-1 in kidneys from mice treated with 15 mg/kg cisplatin. (F) The relative protein expression of KIM-1 to GAPDH in different groups (n = 3). Data are shown as mean ± SEM. **p < 0.01 vs. PBS group, #p < 0.05, ##p < 0.01, and ###p < 0.001 vs. cisplatin group. hAECs, human amniotic epithelial cells; EXOs, exosomes; cisplatin-AKI, cisplatin induced acute kidney injury; sCr, serum creatinine; PAS, periodic acid-Schiff; KIM-1, anti-kidney injury molecule 1.
FIGURE 2RNA sequencing analysis of kidneys from C57BL/6J mice treated with 15 mg/kg cisplatin. (A) Venn diagram showing the numbers of significant DEGs across the four indicated groups. (B,C) The top 15 enriched GO terms and KEGG pathways of the 2,238 DEGs. (D) Heatmap showing the TNF pathway-related DEGs differentially expressed across the four groups. The colors indicate the value of log10 CPM. CPM, counts per million; cisplatin, Cis-diamminedichloroplatinum (II); DEGs, differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.
FIGURE 3Regulation of TNF-α/MAPK pathway by hAECs and EXOs in C57BL/6J mice treated with 15 mg/kg cisplatin. (A) Representative Western blots showing protein expression of TNF-α, p-ERK, ERK, p-JNK, JNK, p-p38, and p38 of kidneys in different groups as indicated. (B–E) The relative protein expression of TNF-α to GAPDH, p-ERK to ERK, p-JNK to JNK, and p-p38 to p38 in different groups (n = 3). (F) The relative mRNA expression of Il-1β, Il-6, Cxcl1, Cxcl2, and Ccl2 determined by RT-PCR. (G,I) Representative micrographs and quantification of Ly6G positive staining on kidney sections of different groups as indicated. (H,J) Representative micrographs and quantification of F4/80 positive staining on kidney sections of different groups as indicated. Scale bar, 100 μm n = 3 for each group. Data are shown as mean ± SEM. **p < 0.01 and ***p < 0.001 vs. PBS group, #p < 0.05, ##p < 0.01, and ###p < 0.001 vs. cisplatin group.
FIGURE 4Inhibition of cisplatin-induced apoptosis of renal tubular epithelial cells by hAECs and EXOs. (A) Representative micrographs of TUNEL (green) staining of kidneys from C57BL/6J mice treated with 15 mg/kg cisplatin. (B) Quantification of TUNEL-positive cells/400×. (C) Representative Western blots showing protein expressions of cleaved-caspase 3 and caspase 3 of kidneys from C57BL/6J mice treated with 15 mg/kg cisplatin. (D) The relative protein expression of cleaved-caspase 3 to caspase 3 in different groups. n = 3 for each group. (E) Representative micrographs of Ki67 (red) and Ecadherin (green) immunofluorescence staining of kidneys from C57BL/6J mice treated with 15 mg/kg cisplatin. (F) Semiquantitative analysis of intensity of Ecadherin immunofluorescence staining. IOD, integrated optical density. (G) Quantification of Ki67-positive tubular cells/400×. (H) CCK-8 assay showing the cell viability of HK2 cells with different treatments for 48 h. (I) Representative micrographs of TUNEL (green) staining of HK2 cells with different treatments for 24 h. (J) Percent of TUNEL-positive cells to all HK2 cells/200×. (K) Representative Western blots showing protein expressions of cleaved-caspase 3 and caspase 3 in HK2 cells with different treatments for 48 h. (L) The relative protein expression of cleaved-caspase 3 to caspase 3 in HK2 cells with different treatments for 48 h. Scale Bar, 100 μm n = 3 for each group. Data are shown as mean ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001 vs. PBS group, #p < 0.05, ##p < 0.01, and ###p < 0.001 vs. cisplatin group. TUNEL, terminal deoxynucleotidyl transferase mediated dUTP nick end-labeling; CCK-8, cell counting kit-8.
FIGURE 5Effects of hAECs and EXOs on the tumor growth in nude mice with A549 NSCLC. (A) The gross tumor images in different groups of nude mice with A549 NSCLC on day 12 after cisplatin injection. (B) Comparison of tumor weights in different groups of nude mice with A549 NSCLC on day 12 after cisplatin injection. Data are shown as mean ± SEM. ***p < 0.05 vs. PBS group, #p < 0.05 vs. cisplatin group. NSCLC, non-small cell lung cancer.
FIGURE 6RNA sequencing analysis on tumors from A549 NSCLC nude mice collected 4 days after cisplatin injection. (A) Venn diagram showing the numbers of significant DEGs across the four groups as indicated. (B) The top 15 enriched and upregulated KEGG pathways in the 226 DEGs across the four groups as indicated in (A). (C) Venn diagram showing the numbers of significant DEGs across the two groups as indicated. (D) The top 15 enriched and upregulated KEGG pathways in the 550 DEGs across the four groups as indicated in (C).
Representative DEGs identified by RNA sequencing in cisplatin + hAECs or cisplatin + EXOs compared with cisplatin-treated tumors.
| Gene | Cisplatin + hAECs vs. cisplatin | Cisplatin + EXOs vs. cisplatin | ||
|---|---|---|---|---|
| Log2 FC |
| Log2 FC |
| |
| Adam8 | 2.9686 | 3.31 × 10–9 | 0.8359 | 3.31 × 10–9 |
| Bax | 1.5060 | 3.78 × 10–16 | 0.5605 | 3.78 × 10–18 |
| Bcl3 | 3.0509 | 1.27 × 10–32 | 2.0370 | 1.27 × 10–32 |
| Brca1 | 1.9357 | 5.31 × 10–5 | 1.7134 | 5.31 × 10–5 |
| Bzw2 | 0.5356 | 0.045483 | 0.5295 | 0.045483 |
| Cbr1 | 1.9998 | 1.67 × 10–44 | 0.5610 | 1.67 × 10–44 |
| Ccnb1 | 3.1586 | 0.017644 | 0.8020 | 0.017644 |
| Cdc6 | 1.9437 | 0.021621 | 1.6689 | 0.021621 |
| Cdca3 | 1.3727 | 0.015941 | 1.0782 | 0.015941 |
| Cdca7 | 1.8503 | 0.014304 | 0.6242 | 0.014304 |
| Cdk1 | 1.7407 | 0.000477 | 0.8007 | 0.000477 |
| Cldn4 | 2.7803 | 9.10 × 10–38 | 1.0485 | 9.14 × 10–38 |
| Clspn | 2.5574 | 0.000734 | 1.7433 | 0.000734 |
| Ddias | 3.6595 | 3.69 × 10–22 | 1.1992 | 3.69 × 10–22 |
| Dlgap5 | 2.5165 | 0.007954 | 0.9324 | 0.007954 |
| Esco2 | 2.5888 | 0.000955 | 1.9327 | 0.000955 |
| Fignl1 | 2.3678 | 0.001049 | 0.8020 | 0.001049 |
| Gins2 | 1.5373 | 0.001835 | 1.3674 | 0.001835 |
| Havcr1 | 9.3847 | 1.18 × 10–91 | 1.8328 | 1.18 × 10–91 |
| Irf7 | 4.0488 | 4.41 × 10–162 | 0.9286 | 4.41 × 10–162 |
| Lif | 5.1139 | 3.86 × 10–24 | 0.6457 | 3.86 × 10–24 |
| Mcm3 | 1.0524 | 0.001352 | 2.3359 | 0.001352 |
| Nek6 | 1.5931 | 1.73 × 10–13 | 0.7183 | 1.73 × 10–13 |
| Nupr1 | 1.0746 | 0.000120 | 0.9035 | 0.000120 |
| Psrc1 | 5.6203 | 1.56 × 10–8 | 1.6411 | 1.56 × 10–8 |
| Zbp1 | 2.6423 | 4.04 × 10–10 | 2.5706 | 4.04 × 10–10 |
| Zmat3 | 1.4787 | 4.50 × 10–19 | 1.5122 | 4.50 × 10–19 |
Note. DEGs, differentially expressed genes; cisplatin, Cis-diamminedichloroplatinum (II); hAECs, human amniotic epithelial cells; EXOs, exosomes.
| Gene | Forward primers (5′-3′) | Reverse primers (5′-3′) |
|
| TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
|
| CTGGGATTCACCTCAAGAACATC | CAGGGTCAAGGCAAGCCTC |
|
| CCAACCACCAGGCTACAGG | GCGTCACACTCAAGCTCTG |
|
| GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
|
| TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
|
| AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |