Hanlin Liang1, Jiewen Peng1. 1. Chemotherapy Department, Zhongshan City People's Hospital, Zhongshan, Guangdong Province, People's Republic of China.
Abstract
Long noncoding RNA (LncRNA) is a new type of regulatory RNA. LncRNA HOX antisense intergenic RNA (HOTAIR), as an oncogene in non-small cell lung cancer (NSCLC), is one of the key determinants of tumor progression. However, its possible molecular mechanism and the immunomodulatory pathway involved in NSCLC are still unclear. This study aims to explore whether HOTAIR promotes proliferation, migration and invasion of the NSCLC cells by inhibiting the expression of C-C Motif Chemokine Ligand 22 (CCL22). We collected 30 clinical samples of cancer and adjacent normal tissues from the patients with NSCLC, using real-time quantitative polymerase chain reaction (RT-qPCR) to detect the LncRNA HOTAIR and CCL22 mRNA expression in tissues. Immunohistochemistry was used to detect the protein expression of CCL22 in cancer and adjacent normal tissues. Cell experiments were conducted to verify that LncRNA HOTAIR regulates the expression of CCL22 and participates in the progress of NSCLC. The antisense oligonucleotide (ASO) probe interfering with LncRNA HOTAIR and the interference fragment of CCL22 (si-CCL22) were constructed. A549 cells were co-transfected with ASO-HOTAIR and si-CCL22. We used RT-qPCR to detect the expression of LncRNA HOTAIR and CCL22 mRNA in the cells, enzyme-linked immunosorbent assay (ELISA) used to detect the CCL22 protein level in the cell supernatant. 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was applied to detect cell proliferation, the Flow cytometry to detect cell apoptosis. Finally, the Transwell test was utilized to detect cell migration and invasion. In conclusion, this study suggests that HOTAIR may promote proliferation, migration and invasion of the NSCLC cells by inhibiting CCL22 expression, which may play a key role in NSCLC cell immunity.
Long noncoding RNA (LncRNA) is a new type of regulatory RNA. LncRNA HOX antisense intergenic RNA (HOTAIR), as an oncogene in non-small cell lung cancer (NSCLC), is one of the key determinants of tumor progression. However, its possible molecular mechanism and the immunomodulatory pathway involved in NSCLC are still unclear. This study aims to explore whether HOTAIR promotes proliferation, migration and invasion of the NSCLC cells by inhibiting the expression of C-C Motif Chemokine Ligand 22 (CCL22). We collected 30 clinical samples of cancer and adjacent normal tissues from the patients with NSCLC, using real-time quantitative polymerase chain reaction (RT-qPCR) to detect the LncRNA HOTAIR and CCL22 mRNA expression in tissues. Immunohistochemistry was used to detect the protein expression of CCL22 in cancer and adjacent normal tissues. Cell experiments were conducted to verify that LncRNA HOTAIR regulates the expression of CCL22 and participates in the progress of NSCLC. The antisense oligonucleotide (ASO) probe interfering with LncRNA HOTAIR and the interference fragment of CCL22 (si-CCL22) were constructed. A549 cells were co-transfected with ASO-HOTAIR and si-CCL22. We used RT-qPCR to detect the expression of LncRNA HOTAIR and CCL22 mRNA in the cells, enzyme-linked immunosorbent assay (ELISA) used to detect the CCL22 protein level in the cell supernatant. 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was applied to detect cell proliferation, the Flow cytometry to detect cell apoptosis. Finally, the Transwell test was utilized to detect cell migration and invasion. In conclusion, this study suggests that HOTAIR may promote proliferation, migration and invasion of the NSCLC cells by inhibiting CCL22 expression, which may play a key role in NSCLC cell immunity.
Lung cancer is a malignant tumor that seriously threatens human health and life nowadays, whose incidence is increasing in many countries [1]. Non-small cell lung cancer (NSCLC) is the most common histology in lung cancer, accounting for 80%-85% of lung cancer [2]. It is generally believed that the pathogenesis of NSCLC is the result of a combination of factors such as heredity, immunity, environment, and living habits. Although a comprehensive treatment plan such as surgery, radiotherapy, and chemotherapy is used to treat early NSCLC, a large proportion of patients eventually die of local recurrence or distant metastasis, which makes it challenging to improve their overall survival rate.A large number of studies have shown that the high expression of LncRNA HOTAIR is related to the poor prognosis of NSCLC, interference with HOTAIR expression inhibiting the proliferation and migration of the A549 cells [3]. Silencing HOTAIR can reduce EP4 protein levels and inhibit the growth of NSCLC cells, while overexpression of HOTAIR and SP1 can inhibit Xiaoji decoction (XJD)-decreased EP4 protein expression [4]. MicroRNA 221 (MiR-221) negatively regulates lncRNA HOTAIR to promote NSCLC cell apoptosis and can be used for the treatment of NSCLC [5]. HOTAIR is up-regulated in the NSCLC cells, regulating cell proliferation, migration, and invasion via miR-217/Dachshund homolog 1(DACH1) signaling pathway [6]. Simultaneously, HOTAIR inhibits the phosphorylation of ULK1 to reduce autophagy. Otherwise, silencing HOTAIR can lower the resistance of NSCLC cells to Crizotinib [7]. HOTAIR2, HOTAIR3 and HOTAIR5 promote the cell cycle through the restriction point G1-S phase by regulating the Rb-E2F pathway, affecting the proliferation, migration, and invasion in the non-small cell lung cancer cells through epithelial-mesenchymal transition (EMT) and β -Catenin pathway in vitro and in vivo [8]. In summary, these results indicate that HOTAIR promotes proliferation, migration, and invasion of the NSCLC cells, leading to poor prognosis. In addition, CCL22 and IL-37 inhibit the proliferation and EMT process of A549 cells [9]. The high expression of chemotactic factor CCL22 and CCL22 can recruit regulatory T cells (Treg) to the tumor site of NSCLC [10, 11]. These results suggest that CCL22 also inhibits the proliferation, migration, and invasion of the NSCLC cells. Therefore, this study aims to explore whether HOTAIR promotes the proliferation, migration, and invasion of the NSCLC cells by inhibiting the expression of CCL22 or not in the present study.
2 Materials and methods
2.1 Clinical verification of the correlation between LncRNA HOTAIR, CCL22 and NSCLC
We collected 30 pairs of clinical samples of cancer tissues and adjacent normal tissues acquired from NSCLC patients who underwent surgery in the Zhongshan City People’s Hospital from July 1, 2019, to October 30, 2020. Then, RT-qPCR was used to detect the expression of LncRNA HOTAIR and CCL22 mRNA expression, immunohistochemistry utilized to test the protein expression of CCL22 in the tissue samples. Finally, the differential expressions of LncRNA HOTAIR and CCL22 mRNA between the NSCLC tissues and adjacent normal tissues were analyzed.
2.2 Cell culture
The A549 cells (purchased from ATCC) were inoculated into the DMEM medium (10% FBS and 1% dual antibody), cultured in a 37°C, 5% CO2 incubator. When 70%~80% of the petri dish bottom was covered with cells, the cells were subcultured. Logarithmic stage cells were used for the follow-up tests in this study.
2.3 Cell transfection
The antisense oligonucleotide probe (ASO probe) interfering with LncRNA HOTAIR and the interference fragment of CCL22 (si-CCL22) were constructed, respectively. Logarithmic A549 cells were inoculated into 6-well plates (1.0×10 5 cells/well). After 24h culture, ASO-HOTAIR and si-CCL22 were co-transfected with Lipofectamine TM 2000 test box. The groups were listed as follows: (a) A549 cells+ASO-NC (Negative Control)+si-NC; (b) A549 cells+ASO-HOTAIR+si-NC; (c) A549 cells+ASO-HOTAIR+si-CCL22. After transfection, the expressions of HOTAIR and CCL22 in cells were detected to verify the transfection effect, the cells used for the subsequent experiments.
2.4 Immunohistochemistry
The paraffin sections with 4μm were baked at 65°C for 4h, dewaxed with xylene, then treated with alcohol. The slices were rinsed with water for 30min, the sodium citrate repair solution (PH = 6.0, o.01M) repaired by microwave with medium fire for 10min. Treated with 3% hydrogen peroxide solution for 15min, the tissues were blocked with 1% FBS for 30min. The primary anti-CCL22 antibody (1:200, ab9847, Abcam) was added to the sections, incubated at 4°C overnight. The tissues added with the corresponding secondary antibody were incubated at room temperature for 1h. The sections were colored with DAB for 5min. Dehydrated with alcohol, the slices were sealed with neutral gum. The photos were captured with the microscope. Image-pro Plus 6.0 software was used to calculate the positive expression rate of the protein.
2.5 RT-qPCR
The RT-qPCR experiment was carried out in reference to the previous study [12]. The thoroughly ground tissues or cells were left for 10 min at 4°C, centrifuged at 12 000 r/ min at 4°C for 10 min. The supernatant being taken, total RNAs were extracted to determine the total concentration and purity of total RNA. The total reaction system was 20 μL, the sequence of primers shown in Table 1. The RT-qPCR procedures were as follows: ① Pre-denaturation at -95°C for 5 min; ② 40 cycles of cyclic reaction—denaturation at 95°C for 10 s, annealing at 60°C for 20 s, extension at 72°C for 40 s; (3) One cycle of the melting curve at -95°C 15 s, 60°C 60 s,95°C 15 s. Three replicates were set for each sample. The mRNA expressions of HOTAIR and CCL22 in tissues and cells were calculated and analyzed by the method of 2 -ΔΔCT.
Table 1
Primer sequences.
Primer
sequences
ASO-HOTAIR
sense
5′- GAACGGGAGUACAGAGAGA -3
si-CCL22
sense
5′- GCGUGGUGUUGCUAACCUUdTdT-3′
antisense
5′- AAGGUUAGCAACACCACGCdGdT-3′
HOTAIR
sense
5′-A GGTAGAAAAAGCAACCACGAAGC -3′
antisense
5′- ACATAAACCTCTGTCTGTGAGTGCC -3′
H-CCL22
sense
5′- GAGATCTGTGCCGATCCCAG -3′
antisense
5′- AGGGAATGCAGAGAGTTGGC -3′
2.6 Flow cytometry to detect cell apoptosis
The transfected cells were cultured in 24-well plates for 24 h, with the initial number of cells in each group 5.0×10 4 cells/well. After culture, cells in each group were collected, apoptosis detected by Annexin V-FITC/PI kit.
2.7 ELISA to detect CCL22 concentration
The concentration of CCL22 in the supernatant was tested according to the instructions of ELISA kit operation (CUSABIO, CSB-E04660h). The prepared well plate was added with 100μL per well, incubated at 37°C for 90 min. The biotin anti-human CCL22 antibody working solution of 100 μL was added to each well, reacted at 37°C for 60 min. Then, each well was added with ABC working solution 100 μ L, reacted at 37°C for 30 min. The TMB color solution was added to the well for color rendering, the OD value measured at 450nm with a microplate reader. The standard curve was performed according to the MEASURED OD, and then the level of CCL22 protein was calculated.
2.8 MTS assay
The cell proliferation was detected by MTS as previous study [13]. In short, 4000 cells/well was seeded into a 96-well plate, MTS added for 30 minutes. The OD value at 490nm was detected with three replicates for each test.
2.9 Tanswell experiment testing cell migration and invasion
Migration experiment: cells were inoculated in the upper compartment of Transwell, with the initial number 5.0×10 4 cells/well. 500 μL complete medium was added to the lower chamber. After 24 h culture, the medium was abandoned, the upper chamber removed. The lower chamber cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet. The cells were observed, counted under the microscope. Invasion test: The invasion procedure was consistent with the migration experiment except that Matrigel glue was pre-applied to the upper chamber of Transwell.
2.10 Statistical analysis
The data were expressed as mean ± standard deviation (SD), analyzed by SPSS 21.0 software. GraphPad Prism 6.0 was utilized to make the statistic charts. Comparison between the two groups was performed using the T-test of two independent samples. Univariate one-way analysis of variance (ANOVA) was used for comparison among the three groups, LST-t test used for pairwise comparison between groups. The correlation analysis between quantitative data is carried out by Person correlation analysis. P <0.05 is considered statistically significant.
3 Results
3.1 The correlation between LncRNA HOTAIR, CCL22 in NSCLC
The RT-qPCR results showed that, the expression of LncRNA HOTAIR was up-regulated, while the expression of CCL22 mRNA was down-regulated in the non-small cell lung cancer clinical samples compared with adjacent normal tissues (Fig 1A and 1B). Pearson correlation analysis presented a strong negative correlation between LncRNA HOTAIR expression and CCL22 mRNA expression in the clinical samples of NSCLC (r = -0.7047, P<0.0001) (Fig 1C). Immunohistochemical results (Fig 1D) showed that the CCL22 protein expression was significantly decreased in NSCLC tissues compared with adjacent normal tissues (P<0.0001).
Fig 1
Clinical correlation between LncRNA HOTAIR and CCL22 in NSCLC examined.
A, B: HOTAIR and CCL22 mRNA expression detected by RT-qPCR. C: The Pearson correlation analysis performed to explore the correlation between HOTAIR and CCL22 in NSCLC. D: The protein expression of CCL22 detected by immunohistochemistry in Cancer tissue and adjacent normal tissue of NSCLC. ****, P<0.001.
Clinical correlation between LncRNA HOTAIR and CCL22 in NSCLC examined.
A, B: HOTAIR and CCL22 mRNA expression detected by RT-qPCR. C: The Pearson correlation analysis performed to explore the correlation between HOTAIR and CCL22 in NSCLC. D: The protein expression of CCL22 detected by immunohistochemistry in Cancer tissue and adjacent normal tissue of NSCLC. ****, P<0.001.
3.2 Both ASO-HOTAIR and si-CCL22 had interference effects
The RT-qPCR results showed that the mRNA expression of HOTAIR of the ASO-HOTAIR group was significantly lower than that of the ASO-NC group (Fig 2A). The mRNA expression of CCL22 of the si-CCL22 group was significantly reduced than that of the si-NC group (Fig 2B) (P<0.001). Compared with the si-NC group, The protein concentration of CCL22 in supernatant decreased significantly (P<0.001) in the si-CCL22 group (Fig 3C). This indicated that the cell models constructed in this study were achieved.
Fig 2
ASO-HOTAIR suppressing the HOTAIR expression and Si-CCL22 interferring the CCL22 expression.
A, B: the expression of HOTAIR and CCL22 mRNA were detected by RT-qPCR. C: CCL22 protein analyzed by ELISA assay. ****, P<0.001.
Fig 3
The inhibition of LncRNA HOTAIR and interference with CCL22 showing the changes in cell function among the ASO-NC+si-NC, ASO-HOTAIR+si-NC and ASO-HOTAIR+si-CCL22 groups.
A: The HOTAIR and CCL22 mRNA expression examined by RT-qPCR B: Cell apoptosis detected by Flow cytometry. C: The cell proliferation tested by MTS assay. D: The CCL22 protein expression tested by ELISA. E: The cell migration and invasion detected by Transwell assay. **, P<0.05; ***, P<0.01; ****, P<0.001;ns, no significance.
ASO-HOTAIR suppressing the HOTAIR expression and Si-CCL22 interferring the CCL22 expression.
A, B: the expression of HOTAIR and CCL22 mRNA were detected by RT-qPCR. C: CCL22 protein analyzed by ELISA assay. ****, P<0.001.
The inhibition of LncRNA HOTAIR and interference with CCL22 showing the changes in cell function among the ASO-NC+si-NC, ASO-HOTAIR+si-NC and ASO-HOTAIR+si-CCL22 groups.
A: The HOTAIR and CCL22 mRNA expression examined by RT-qPCR B: Cell apoptosis detected by Flow cytometry. C: The cell proliferation tested by MTS assay. D: The CCL22 protein expression tested by ELISA. E: The cell migration and invasion detected by Transwell assay. **, P<0.05; ***, P<0.01; ****, P<0.001;ns, no significance.
3.3 The effect of interference with LncRNA HOTAIR and CCL22 on cell function
As shown in Fig 3A, the HOTAIR expression decreased statistically in the ASO-HOTAIR+si-NC group compared with the ASO-NC+si-NC group (P<0.01). There was no statistical difference between the ASO-HOTAIR+si-NC group and the ASO-HOTAIR+si-CCL22 group (P = 0.0621). Compared with the ASO-NC+si-NC, The CCL22 mRNA expression. Increased significantly in the ASO-HOTAIR+si-NC group (P<0.001). The expression of CCL22 mRNA was reduced significantly in the group of ASO-HOTAIR +si-CCL22 compared to ASO-HOTAIR+si-NC (P<0.001) (Fig 3A).As shown in Fig 3B, the total apoptosis ratio of the ASO-HOTAIR+si-NC group was higher than that of the ASO-NC+si-NC group (6.80% vs. 2.88%). Compared with the ASO-HOTAIR+si-NC group, the total apoptosis ratio decreased in the ASO-HOTAIR+si-CCL22 group (5.41% vs. 6.80%).From 24h to 72h, cell proliferation increased in all three groups (Fig 3C). At 24h and 48h, there were no significant differences in cell proliferation among the three groups. At 72h, cell proliferation was significantly reduced in the ASO-HOTAIR+si-NC group compared with the group of ASO-NC+si-NC (P<0.01). Then, compared with the group of ASO-HOTAIR+si-NC, cell proliferation increased significantly in the ASO-HOTAIR+si-CCL22 group (P<0.0001).The CCL22 concentration detected by ELISA is displayed in Fig 3D. Compared with the ASO-NC+si-NC group, the CCL22 protein level increased significantly (P<0.001) in the ASO-HOTAIR+si-NC group. The CCL22 concentration of the ASO-HOTAIR+si-CCL22 group was lower than that of the ASO-HOTAIR+si-NC group (P<0.001).Pathological images and quantitative analysis results of migration and invasion are shown in Fig 3E. Compared with the ASO-NC+si-NC group, The number of migrating and invading cancer cells was significantly reduced in the ASO-HOTAIR+si-NC group (P<0.05). The number of migrating and invading cancer cells of the ASO-HOTAIR+si-CCL22 group increased significantly than that of the ASO-HOTAIR+si-NC group (P<0.05).
4 Discussion
Immune evasion is one of the important reasons for the occurrence, development, and recurrence of NSCLC. Tumor cells evade the recognition and attack of the body’s immune system by modifying their surface antigens and changing the tissue microenvironment. Specifically, the balance between immune cells and cytokines in the tumor and peripheral blood is disrupted. Some researchers believe that several marker levels of circulatory inflammation, including chemokines and pro-inflammatory factors, are related to the prospective risk of NSCLC [14]. Chemokines, the ligands of chemokine receptors, are a family of interactive chemotactic cytokines, used to coordinate cell migration and home in the body CCL22 is the ligand of CCR4 transmembrane protein, which is mostly produced by tumor cells and tumor-infiltrating macrophages [15]. However, some researchers have found that in pancreatic and liver cancer, CCL22 is produced by dendritic cells in the tumor, while the cancer cells themselves do not secrete CCL22 in vitro or in vivo [16]. In addition, CCL22 can also be induced in tumor infiltrating immune cells by interleukin-1 (IL-1α) derived from cancer cells [17]. The regulatory T cells (Tregs) can be attracted by CCL22 into the tumor microenvironment, to reduce anti-cancer immunity [18], which are widely expressed in many cancers, including glioma, gastric cancer, and breast cancer [19-21].In this study, the expression of CCL22 and LncRNA HOTAIR mRNA in cancer tissues and adjacent normal tissues of NSCLC patients showed significant differences. Compared with adjacent normal tissues, LncRNA HOTAIR was upregulated in NSCLC tissues, while CCL22 mRNA was down-regulated. The immunohistochemical results of CCL22 were consistent with those of RT-QPCR. LncRNA HOTAIR was negatively correlated with CCL22 mRNA expression. CCL22 attracts Treg cells, playing an essential role in the pathogenesis of NSCLC. It was reported that the deregulation of chemokines was associated with the development and progression of many human cancers, including lung cancer. However, the relationships between the survival checkpoint of NSCLC cells and genetic polymorphisms of chemical factors are unclear [22].In cell experiments, after only interfering with LncRNA HOTAIR, the expression of HOTAIR decreased compared with the control group, while the expression of CCL22 increased in both cells and supernatant, resulting in increased apoptosis, decreased proliferation, and weakened invasion and migration ability. After simultaneous interference with LncRNA HOTAIR and CCL22, the expression of HOTAIR in cells increased compared with that in the LncRNA HOTAIR group, while the expression of CCL22 in cells and supernatant decreased, resulting in decreased apoptosis, increased proliferation, and enhanced invasion and migration. LncRNA HOTAIR, as one kind of LncRNAs, is an oncogene in non-small cell lung cancer. Its possible molecular mechanism and immune regulation pathways involved in NSCLC are still unknown. The tumor microenvironment is a key determinant of tumor progression, which regulates basic cellular processes through different mechanisms [23].In conclusion, we verified the differential expression of HOTAIR and CCL22 in cancer tissues and adjacent normal tissues in NSCLC patients, and there was a strong negative correlation between HOTAIR and CCL22 mRNA expression. Moreover, the cell experiments demonstrated that LncRNA HOTAIR might promote the proliferation, migration and invasion of the NSCLC cells by inhibiting CCL22 expression. This study is mainly to verify the action mechanism of HOTAIR on NSCLC progression by inhibiting CCL22 expression at the cellular level. Moreover, it needs to be confirmed in the overall models in the future. This is also the direction of future research.(ZIP)Click here for additional data file.3 Jan 2022
PONE-D-21-21513
Exploring the mechanisms of the immune regulation by LncRNA HOTAIR and CCL22 signaling pathways about non-small cell lung cancerPLOS ONEDear Dr. Liang ,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by February 9,2022. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Suhwan ChangAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. In your Methods section, please provide additional details regarding the cell lines used in your study and ensure you have described the source. For more information regarding PLOS' policy on materials sharing and reporting, see https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-materials, and for more information on PLOS ONE's guidelines for research using cell lines, see https://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines.3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.4. Please remove all personal information, ensure that the data shared are in accordance with participant consent, and re-upload a fully anonymized data set.Note: spreadsheet columns with personal information must be removed and not hidden as all hidden columns will appear in the published file.Additional guidance on preparing raw data for publication can be found in our Data Policy (https://journals.plos.org/plosone/s/data-availability#loc-human-research-participant-data-and-other-sensitive-data) and in the following article: http://www.bmj.com/content/340/bmj.c181.long.5. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.We will update your Data Availability statement to reflect the information you provide in your cover letter.6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.7. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: NoReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Reviewer commentsThe authors aimed to explore the mechanism of immune regulation of the long noncoding RNA and CCL22 and their role in the proliferation, migration, and invasion of non-small cell lung cancer. They build upon the existing knowledge and roles of these LncRNA and CCL22 by investigating their expression patterns as well as their effect on apoptosis and migration of NSCLC. Although their experimental procedures used for the various assays are effective, there are a few concerns about the organization of the manuscriptConcerns:Materials and methods;The oligonucleotides used in the study and their descriptions should be presented in a tabular form.The procedure for transfection and maintenance of the cell cultures should be provided in this section.The experimental procedures for immunohistochemistry, qPCR, and flow cytometry must be detailed in different paragraphs or sub-sections.The section needs to be revised grammatically and formatted according to the journal's submission requirements to make it an easier read.Results:Although the figures and statical analysis are provided in the supporting documents, the authors can state the P-values with the statistical significance on the figures.Figure 3A can be labeled as 3Ai and 3Aii instead of left and right in the results section.The font theme and font sizes are not uniform in the manuscript.The results section is poorly written and undermines the quality of the figures provided in the manuscripts. The results section should be revised.Minor concerns:There are numerous grammatical errors in the manuscript that require revisions to make the manuscript easier to read.Reviewer #2: The manuscript entiltled "Exploring the mechanisms of the immune regulation by LncRNA HOTAIR and CCL22signaling pathways about non-small cell lung cancer" are well documented. The results are clear abnd well presented.materials and method are well elaborated.The following issues need to be addressed.1. The English need to be improved throughout the manuscript.2. There are several typing erros. please revise the whole manuscript.3. The tiltle of manuscript need to improve4. The existing keywords should be replaced with suitable words, which are not repeated in the title of manuscript5. In introduction section "Especially, non small cell lung cancer (NSCLC) is the most common histology in lungcancer, accounting for 80%-85% of the total number of lung cancer". Please put the reference if possible6. In discussion section, please improve the discussion section with logics.7. in figures 2 B. please recheck about standared errors8. please ensure the style of manuscript according to journal standared.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: Yes: Muhammad Anwar[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
29 Jan 2022Reply: We've tabulated primer sequences (Table 1).The procedure for transfection and maintenance of the cell cultures should be provided in this section.Reply: We have added this sections (Page 5, line 100-113).The experimental procedures for immunohistochemistry, qPCR, and flow cytometry must be detailed in different paragraphs or sub-sections.Reply: We have refined the method again (Page 6-8, line 115-163).The section needs to be revised grammatically and formatted according to the journal's submission requirements to make it an easier read.Reply: We have asked a professional English teacher to proofread the manuscript in the language. The format of the manuscript was also modified according to the journal.Results:Although the figures and statical analysis are provided in the supporting documents, the authors can state the P-values with the statistical significance on the figures.Reply: We have re-marked the P value in the manuscript.Figure 3A can be labeled as 3Ai and 3Aii instead of left and right in the results section.Reply: We have restated the results (Page 9-10, line 186-192). Thank you for your comments!The font theme and font sizes are not uniform in the manuscript.Reply: They were done.The results section is poorly written and undermines the quality of the figures provided in the manuscripts. The results section should be revised.Reply: We have restated the result sections. Thank you for your comments.Minor concerns:There are numerous grammatical errors in the manuscript that require revisions to make the manuscript easier to read.Reply: We have invited professional teachers to polish the manuscript.Reviewer #2: The manuscript entiltled "Exploring the mechanisms of the immune regulation by LncRNA HOTAIR and CCL22signaling pathways about non-small cell lung cancer" are well documented. The results are clear abnd well presented.materials and method are well elaborated.The following issues need to be addressed.1. The English need to be improved throughout the manuscript.Reply: We have invited professional teachers to polish the manuscript.2. There are several typing erros. please revise the whole manuscript.Reply: We have asked the full manuscript to be proofread in the language.3. The tiltle of manuscript need to improveReply: We have rewritten the title (Page 1, line 1-2).4. The existing keywords should be replaced with suitable words, which are not repeated in the title of manuscriptReply: The key words have been partially replaced (Page 3, line 47-48).5. In introduction section "Especially, non small cell lung cancer (NSCLC) is the most common histology in lungcancer, accounting for 80%-85% of the total number of lung cancer". Please put the reference if possibleReply: We have added (Page 3, line 54).6. In discussion section, please improve the discussion section with logics.Reply: We have added more detail to the discussion section (Page 12, line 250-255; Page 13, line 261-268; Page 13-14, line 273-281).7. in figures 2 B. please recheck about standared errorsReply: we have rechecked and revised. Thank you for your comments!8. please ensure the style of manuscript according to journal standared.Reply: We have revised the manuscript according to the journal's requirements.Submitted filename: Response to Reviewers.docClick here for additional data file.2 Feb 2022LncRNA HOTAIR promotes proliferation, invasion and migration in NSCLC cells via the CCL22 signaling pathwayPONE-D-21-21513R1Dear Dr. Hanlin Liang ,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Suhwan ChangAcademic EditorPLOS ONEAdditional Editor Comments (optional):No further commentsReviewers' comments:7 Feb 2022PONE-D-21-21513R1LncRNA HOTAIR promotes proliferation, invasion and migration in NSCLC cells via the CCL22 signaling pathwayDear Dr. Liang:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Suhwan ChangAcademic EditorPLOS ONE
Authors: Rinat Zaynagetdinov; Taylor P Sherrill; Linda A Gleaves; Allyson G McLoed; Jamie A Saxon; Arun C Habermann; Linda Connelly; Daniel Dulek; R Stokes Peebles; Barbara Fingleton; Fiona E Yull; Georgios T Stathopoulos; Timothy S Blackwell Journal: Cancer Res Date: 2015-02-17 Impact factor: 12.701
Authors: Yan Yang; Caiyu Jiang; Yang Yang; Lu Guo; Jiang Huang; Xingren Liu; Chi Wu; Jun Zou Journal: Biochem Biophys Res Commun Date: 2018-02-19 Impact factor: 3.575
Authors: Mi Zhou; Paige M Bracci; Lucie S McCoy; George Hsuang; Joseph L Wiemels; Terri Rice; Shichun Zheng; Karl T Kelsey; Margaret R Wrensch; John K Wiencke Journal: Int J Cancer Date: 2015-02-02 Impact factor: 7.316