| Literature DB >> 35174162 |
Tian Liu1, Ruojiao Li1, Liangjie Liu1, Shaoxuan Wu1, Lijing Zhang1, Yajuan Li1, Huilan Wei1, Ya Shu1, Yaxin Yang1, Shi Wang1,2,3, Qiang Xing1, Lingling Zhang1,2, Zhenmin Bao1,2,3.
Abstract
Many marine organisms are generally poikilotherms, making seawater temperature one of the most important environmental factors affecting gonadal sex differentiation. Mollusca is the second-largest animal phylum with diverse reproductive systems, but studies on the impact of temperature on sex differentiation are limited to a few sequential hermaphrodites. By combining morphological and molecular analyses, we investigated the effect of temperature on gonadal sex differentiation of a commercially important gonochoristic scallop Patinopecten yessoensis in the field and under laboratory conditions. Based on the relative expression of FoxL2 and Dmrt1L in the gonads of 6- to 12 month-old scallops, we found the scallops start to differentiate at 7 months old in September when the seawater temperature was 21°C. To eliminate the effect of factors other than temperature on sex differentiation, we compared the gonadal development of juvenile scallops at different temperatures (21, 16 and 11°C) under laboratory conditions. After 50 days of treatment, the 11°C group contain more germ cell types, and have higher sex differentiation rates than the 21°C group. But no obvious sex bias was observed. These results suggest that high temperature (21°C) inhibits sex differentiation, whereas low temperature (11°C) accelerates sex differentiation by 2 months for this cold-water species. It also supports juvenile P. yessoensis is gonochoristic rather than protandrous hermaphroditic. Our study addresses for the first time an environmental influence associated with genetic controls on scallop sex differentiation. It will facilitate a better understanding of how environmental factors affect gonadal development in poikilotherms, especially in the less studied molluscs.Entities:
Keywords: Dmrt1L; FoxL2; poikilotherm; sex differentiation; temperature
Year: 2022 PMID: 35174162 PMCID: PMC8841428 DOI: 10.3389/fcell.2021.803046
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
Sequences of the primers used for RT-qPCR assay.
| Gene name | Primer sequences (5′-3′) | Amplicon length (bp) | References |
|---|---|---|---|
| FoxL2 | F: AACTTCTGGACATTGGACCCTGCTT | 134 |
|
| R: CCGCAGTGGTTGTCAGCAAATAAGG | |||
| Dmrt1L | F: ACAGATTCCCTACAGATGCT | 128 |
|
| R: TTATTCATGGCGGCGTCTAT | |||
| EF1A | F: CCATCTGCTCTGACAACTGA | 196 |
|
| R: GGACAATAACCTGAGCCATAA |
FIGURE 1Sex differentiation ratio of 6–12 month-old scallops and the corresponding seawater temperature in each month. For each month, 12–20 individuals were examined. The pie charts show the percentages of female (red), male (blue) and undifferentiated samples (purple) in each month. The values above the pie charts are the corresponding numbers of female (red), male (blue) and undifferentiated samples (purple). The line indicates the seawater temperatures for each month.
FIGURE 2Gonad weight and gonadal index (GI) of juvenile scallops on day 0 and 50 at three different temperatures (21, 16 and 11°C). The vertical bars represent the means ± SEM (N = 5–6). One-way ANOVA followed by LSD test was performed to compare the differences among groups. Different letters indicate significant differences (p < 0.05).
FIGURE 3Histological observations of the juvenile gonads on day 0 and 50 at three different temperatures. (A) Undifferentiated gonad of a 6 month-old juvenile scallop on day 0; (B) Gonad from the 21°C group on day 50; (C) Undifferentiated gonad from the 16°C group on day 50; (D) Ovary from the 16°C group on day 50; (E) Ovary from the 11°C group on day 50; (F) Testis from the 11°C group on day 50. Six scallops were sampled for histological analysis at each stage. F, follicle; Fc, follicle cell; Ig, indistinguishable gonium; Og, oogonium; Oc, oocyte; Sg, spermatogonium; Sc, spermatocyte; St, spermatid.
FIGURE 4Relative expression of FoxL2 and Dmrt1L in the three temperature groups at day 0 and 50. Relative expression levels of FoxL2 (A) and Dmrt1L (B) in the three temperature groups (21, 16 and 11°C) at day 0 and 50. The vertical bars represent the means ± SEM (N = 7–13). Different letters indicate significant differences (p < 0.05). (C) The LOG10 (Dmrt1L/FoxL2) values and sex differentiation ratio for each group on day 0 and 50. Each dot represents a sample. The dashed lines indicate the threshold for sex differentiation, with values below 0 for ovary and values higher than two for testis. The pie charts indicate the percentages of female (red), male (blue) and undifferentiated samples (purple) in each month. The values above the pie charts are the corresponding numbers of female (red), male (blue) and undifferentiated samples (purple).