| Literature DB >> 35174158 |
Huiyue Xu1, Meng Xia1, Lian Sun1,2, Hua Wang1,2, Wei-Bing Zhang1,2,3,4.
Abstract
Mechanical stimuli control cell behaviors that are crucial for bone tissue repair. Osteocytes sense extracellular mechanical stimuli then convert them into biochemical signals to harmonize bone remodeling. However, the mechanisms underlying this process remain unclear. Autophagy, which is an evolutionarily preserved process, that occurs at a basal level when stimulated by multiple environmental stresses. We postulated that mechanical stimulation upregulates osteocyte autophagy via AMPK-associated signaling, driving osteocyte-mediated osteogenesis. Using a murine model of orthodontic tooth movement, we show that osteocyte autophagy is triggered by mechanical tension, increasing the quantity of LC3B-positive osteocytes by 4-fold in the tension side. Both in vitro mechanical tension as well as the chemical autophagy agonist enhanced osteocyte Fibroblast growth factor 23 (FGF23) secretion, which is an osteogenenic related cytokine, by 2-and 3-fold, respectively. Conditioned media collected from tensioned osteocytes enhanced osteoblast viability. These results indicate that mechanical tension drives autophagy-mediated FGF23 secretion from osteocytes and promotes osteogenesis. Our findings highlight a potential strategy for accelerating osteogenesis in orthodontic clinical settings.Entities:
Keywords: FGF23; autophagy; mechanical tension; osteocytes; osteogenesis
Year: 2022 PMID: 35174158 PMCID: PMC8841855 DOI: 10.3389/fcell.2021.782736
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
The primer sequences used in this study are listed as follows.
| Genes | Forward primer (5′–3′ ) | Reverse primer (5′–3′ ) |
|---|---|---|
| ATG4 | GCTGGTATGGATTCTGGGGAA | TGGGTTGTTCTTTTTGTCTCTCC |
| ATG5 | TGTGCTTCGAGATGTGTGGTT | GTCAAATAGCTGACTCTTGGCAA |
| ATG7 | GTTCGCCCCCTTTAATAGTGC | TGAACTCCAACGTCAAGCGG |
| LC3B | TAATCTGAGCAATGCGATTGTGG | AGATGGACGGAGTATAGCGAAAA |
| P62 | AGGATGGGGACTTGGTTGC | TCACAGATCACATTGGGGTGC |
| ULK1 | AAGTTCGAGTTCTCTCGCAAG | CGATGTTTTCGTGCTTTAGTTCC |
| RUNX2 | TTACCTACACCCCGCCAGTC | TGCTGGTCTGGAAGGGTCC |
| OCN | CTGACCTCACAGATGCCAAGC | TGGTCTGATAGCTCGTCACAAG |
| OPN | AGCAAGAAACTCTTCCAAGCAA | GTGAGATTCGTCAGATTCATCCG |
| ALP | TCCTGACCAAAAACCTCAAAGG | TGCTTCATGCAGAGCCTGC |
| FGF23 | GACCAGCTATCACCTACAGATC | GTAATCATCAGGGCACTGTAGA |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
The antibodies used in this study are listed as follows.
| Antibodies | Source | Identifier | Dilution concentration |
|---|---|---|---|
| anti-LC3B | Abcam | Cat.# ab51520 | 1/2000 for WB; 1/1000 for IF |
| anti-ATG7 | Abcam | Cat.# ab133528 | 1/1000 |
| anti-AMPKα | CST | Cat.# 5831 | 1/1000 |
| anti-P62 | CST | Cat.# 5114 | 1/1000 |
| anti-FGF23 | Abcam | Cat.# ab98000 | 1/1000 |
| anti-p-AMPKα | CST | Cat.# 2535 | 1/1000 |
| anti-CARM1 | Proteintech | Cat.# 55246-1-AP | 1/1000 |
| anti-GAPDH | Beyotime | Cat.# AG019 | 1/1000 |
FIGURE 1Orthodontic tooth movement activated osteocyte authophagy. (A) Representataive images showing the distance between the first and second maxillary molars after 7 days of orthodontic tooth movement. Yellow arrow showed the direction of tooth movement. Scale bar = 500 μm, n =5. (B–D) Micro-CT analysis of avveolar bone volume. Ration of trabecular bone volume/total volume(B-V/TV%), trabecular thickness(Tb.Th) and trabecular separation (Tb.Sp) were measured.(E) Frozen sections of the maxillary first molar were stained by ALP. The quantification of ALP + surface/B.Pm(%). Yellow arrow showed the direction of tooth movement. Scale bar = 50 μm. (F) maxillary bone adjacent frozen sections were subjected to IF staining of osteocytes with anti-LC3B. DAPI was counterstained to show the nuclei (blue). The quantification of LC3B + osteocytes/mm. White dashed lines respresented the bone surface. Scale bar = 50 μm. All data were showed as mean ± SD.*p ˂ 0.05 vs. control.
FIGURE 2In vitro mechanical tension induces autophagy in osteocytes (A) The mRNA expression of ATG4 ATG5 ATG7 LC3B ULK1 were detected by realtime RT-PCR. GAPDH was used for normalization. (B) The protein expression of ATG7 P62 and LC3B were measured by western blot. The quantification of ATG7 P62 and LC3BII. GAPDH was used for normalization. (C) Immunofluorescence staining was used to visualize autophagosomes (respresented by LC3 positive spots). Scale bar = 10 μm. All cell experiments were repeated 3 times and each time they were performed in at least 3 replicate wells. All data were showed as mean ± SD. *p ˂ 0.05 vs. control.
FIGURE 3Mechanical tension promotes osteocyte-mediated osteogenesis. (A) ALP staining of 3T3-E1 after induction of differenation with CM from MLO-Y4. (B) The quantification of ALP+ surface/B.Pm(%) of 3T3-EI after induction of differentiation with CM from MLO-Y4. (C) Cellular ALP activity (U/gprot) of 3T3-E1 after induction of differentiation with CMfrom MLO-Y4. (D) The expression level of osteoblastic markers as ALP OPN RUNX2 of 3T3-E1 was detected by RT-PCR. GAPDH was used for normalization. (E) ALP staining of primary osteoblast precursor cells after induction of differenation with conditioned medium (CM) from MLO-Y4. (F) The quantification of ALP + sueface/B.Pm(%) of primary osteoblast precursor cells after induction of differentiation with CM from MLO-Y4. (G) Cellular ALP activity (U/gprot) of primary osteoblast precursor cells after induction of differentiation with CM from MLO-Y4. (H) The expression level of osteoclastic markers of as ALP OPN RUNX2 of primary osteoblast precursor cells was detected by RT-PCR. GAPDH was used for normalization. (I) The protein expression of ALP OPN and RUNX2 of 3T3-E1 were measured by western blot. The quantification of ALP OPN and RUNX2. GAPDH was used for normalizatio. (J) The protein exoression of ALP OPN and RUNX2 of primary osteoblast precursor cell were measured by western blot. The quantification of ALP OPN and RUNX2. GAPDH was used for normalization. All cell experiment were repeated 3 times and each time they were performed at least 3.
FIGURE 4Autophagy up regulated osteocyte-associated osteogenesis. (A) The cells were incubated with Rapamycin for 6 h before subjected to mechanical tension. LC3B ATG7 and P62 were detected by western Blot. GAPDH was used for normalization. (B) ALP staining of 3T3-E1 after induction of differentiation with CM from MLO-Y4 in the indicated groups. (C) The quantification of ALP + surface/B.Pm(%) of 3T3-E1 after induction of differentiation with CM from MLO-Y4 in the indicated groups. (D) Cellular ALP activity (U/gprot) of 3T3-E1 after induction of differentiation with CM from MLO-Y4 in the indicated groups. (E) ALP staining of primary osteoblast precursor cells after indiction of differentiation with CM from MLO-Y4 in the indicated groups.(F) The quantification of ALP + surface/B.Pm(%) of primary osteoblast precursor cells after induction of differentiation with CM from MLO-Y4 in indicated groups. (H) The expression level of osteoblastic markers of 3T3-E1 was detected by RT-PCR. GAPDH was used for normalization. (I) The expression level of osteoblastic markers of primary osteoblast precursor cells was detected by RT-PCR GAPDH was used for normalization. All cell experiments were repeated 3 times and each time they were performed in at least 3 replicate wells. All data were showed as mean ± SD. *p ˂ 0.05 vs. control.
FIGURE 5Mechanical tension-iniated autophagy promotes FGF23 secretion. (A) The mRNA expression level of FGF23 MLO-Y4 after mechanical tension was measured by RT-PCR. GAPDH was used for normalization. (B) The expression of soluble FGF23 in the supernatant of MLO-Y4 after mechanical tension was detected by ELISA. (C) Western blot analysis of total protein expression of FGF23. GAPDH was used for normalization. All cell experiments were repeated 3 time and each time they were performed in at least 3 replicate wells. All data were showed as means ± SD. *p ˂ 0.05 vs. control.
FIGURE 6Mechanical tension tiggers MLO-Y4 autophagy via AMPK signaling. (A) The expression of the signaling molecules as AMPLα, p-AMPKα, CARM1 were detected by western blot. (B) Western blot analysis of AMPLα, p-AMPKα, CARM1 ATG7, P62, and LC3B in MLO-Y4 after the treatment of tension, compound C or both. All cell experiments were repeated 3 time and each time they were performed in at least 3 replicated wells.