CRABS CLAW (CRC) orthologues play a crucial role in floral meristem (FM) determinacy and gynoecium formation across angiosperms, the key developmental processes for ensuring successful plant reproduction and crop production. However, the mechanisms behind CRC mediated FM termination are far from fully understood. Here, we addressed the functional characterization of tomato (Solanum lycopersicum) paralogous CRC genes. Using mapping-by-sequencing, RNA interference and CRISPR/Cas9 techniques, expression analyses, protein-protein interaction assays and Arabidopsis complementation experiments, we examined their potential roles in FM determinacy and carpel formation. We revealed that the incomplete penetrance and variable expressivity of the indeterminate carpel-inside-carpel phenotype observed in fruit iterative growth (fig) mutant plants are due to the lack of function of the S. lycopersicum CRC homologue SlCRCa. Furthermore, a detailed functional analysis of tomato CRC paralogues, SlCRCa and SlCRCb, allowed us to propose that they operate as positive regulators of FM determinacy by acting in a compensatory and partially redundant manner to safeguard the proper formation of flowers and fruits. Our results uncover for the first time the physical interaction of putative CRC orthologues with members of the chromatin remodelling complex that epigenetically represses WUSCHEL expression through histone deacetylation to ensure the proper termination of floral stem cell activity.
CRABS CLAW (CRC) orthologues play a crucial role in floral meristem (FM) determinacy and gynoecium formation across angiosperms, the key developmental processes for ensuring successful plant reproduction and crop production. However, the mechanisms behind CRC mediated FM termination are far from fully understood. Here, we addressed the functional characterization of tomato (Solanum lycopersicum) paralogous CRC genes. Using mapping-by-sequencing, RNA interference and CRISPR/Cas9 techniques, expression analyses, protein-protein interaction assays and Arabidopsis complementation experiments, we examined their potential roles in FM determinacy and carpel formation. We revealed that the incomplete penetrance and variable expressivity of the indeterminate carpel-inside-carpel phenotype observed in fruit iterative growth (fig) mutant plants are due to the lack of function of the S. lycopersicum CRC homologue SlCRCa. Furthermore, a detailed functional analysis of tomato CRC paralogues, SlCRCa and SlCRCb, allowed us to propose that they operate as positive regulators of FM determinacy by acting in a compensatory and partially redundant manner to safeguard the proper formation of flowers and fruits. Our results uncover for the first time the physical interaction of putative CRC orthologues with members of the chromatin remodelling complex that epigenetically represses WUSCHEL expression through histone deacetylation to ensure the proper termination of floral stem cell activity.
From their outermost to the innermost whorls, flowers typically consist of sepals, petals, stamens and carpels that are generated from a pool of stem cells located in floral meristems (FM) (Krizek & Fletcher, 2005). Once a set number of floral organs have been initiated, stem cell activity is arrested, and the FM is thereby determined to form the gynoecium. The precise timing of this developmental event, also referred to as floral determinacy, is a pivotal process that establishes the number of floral organs arising from the FM (Sun & Ito, 2015).In Arabidopsis, the homeodomain transcription factor WUSCHEL (WUS) is responsible for maintaining stem cell activity in the FM, while the MADS‐box transcription factor AGAMOUS (AG) regulates the timing of FM termination by repressing WUS expression (Liu et al., 2011). AG turns off the stem cell maintenance programme involving transcriptional repression of WUS by different pathways: directly by a mechanism that implicates chromatin remodelling and the recruitment of the Polycomb group (PcG) protein TERMINAL FLOWER2/LIKE HETEROCHROMATIN PROTEIN1 (TFL2/LHP1) at the WUS locus (Guo et al., 2018), and indirectly through the transcriptional induction of the two key targets, KNUCKLES (KNU) and CRABS CLAW (CRC). KNU and CRC act through independent pathways to synergistically regulate WUS repression, thus ensuring FM determination (Sun et al., 2009, 2014, 2019; Yamaguchi et al., 2017, 2018). KNU encodes a C2H2 zinc‐finger protein whose expression is activated by AG, a process that requires a time‐delay induction regulated by epigenetic modification of histones at the KNU locus (Sun et al., 2014). Once induced, KNU binds to the WUS promoter, which causes the eviction of SPLAYED, a chromatin remodelling factor required for WUS activation, and mediates the subsequent deposition of H3K27me3 for stable Polycomb‐mediated repression WUS (Kwon et al., 2005; Sun et al., 2019). Furthermore, AG also positively regulates MINI ZINC FINGER2 (MIF2) expression during flower development, which acts as an adaptor protein to form a transcriptional repressor complex together with KNU, the transcriptional corepressor TOPLESS (TPL) and the chromatin remodelling protein HISTONE DEACETYLASE19 (HDA19). Within this complex, MIF2 binds to the WUS locus, leading to the epigenetic repression of WUS expression through histone deacetylation (Bollier et al., 2018). Concurrently, the YABBY transcription factor CRC, a direct target of AG, mediates auxin homeostasis and establishes auxin maxima during carpel primordium initiation by repressing TORNADO2 (TRN2) and up‐regulating the auxin synthesis gene YUCCA4 (YUC4). The proper auxin maxima mediated by CRC contribute to the termination of FM cell proliferation through WUS repression and trigger the subsequent gynoecium formation (Yamaguchi et al., 2017, 2018).In tomato (Solanum lycopersicum), the molecular mechanisms underlying SlWUS transcriptional regulation during floral development are of agronomic interest, as mutations leading to a spatial and temporal expansion of its expression domains result in flowers with extra carpels, which give rise to larger multilocular fruits (Rodríguez‐Leal et al., 2017; Yuste‐lisbona et al., 2020). Likewise, alterations in FM determinacy potentially lead to a reiterative carpel formation pattern resulting in indeterminate fruits, which makes a developmental process closely related to fruit shape and size, the two quality attributes that influence consumer's acceptance and post‐harvest handling. Recently, Bollier et al. (2018) have proposed a conserved molecular mechanism regulating FM determinacy in Arabidopsis and tomato. Thus, the interaction between tomato MIF2 and KNU orthologues, INHIBITOR OF MERISTEM ACTIVITY (SlIMA) and SlKNU, allows for the recruitment of tomato TPL and HDA19 orthologues, SlTPL1 and SlHDA1, to form a transcriptional repressor complex at the SlWUS locus. Here, we provide insights into the genetic and molecular mechanisms involved in FM determinacy and carpel development. Our results revealed that the loss of carpel determinacy observed in the fruit iterative growth (fig) mutants is due to the lack of function of the S. lycopersicum CRC homologue SlCRCa. Furthermore, functional analysis of tomato CRC paralogues, SlCRCa and SlCRCb, allowed us to uncover for the first time the role of CRC orthologues as members of the molecular network that epigenetically represses WUS through histone deacetylation to ensure the proper termination of floral stem cell activity.
Materials and Methods
Plant material and growth conditions
The fig mutant was identified from a T‐DNA insertional mutant collection generated in the genetic background cultivar P73 (Pérez‐Martín et al., 2017). However, molecular analysis showed that the fig mutation was not associated with a T‐DNA insertion (Supporting Information Fig. S2, see later). For mapping‐by‐sequencing, an F2 mapping population was generated by crossing a fig mutant to wild tomato Solanum pimpinellifolium (accession no. LA1589) and self‐fertilizing the F1 plants. Arabidopsis thaliana plants used for this study, including mutant and transgenic plants, were in the ecotype Landsberg erecta (Ler) genetic background (kindly provided by Prof. M. R. Ponce, Miguel Hernández University, Elche, Spain). The seeds of the crabs claw‐1 (crc‐1; CS3814; N3814) mutant (Alvarez & Smyth, 1999) were initially obtained from the Nottingham Arabidopsis Stock Center (NASC, Nottingham, UK) and propagated at our laboratory for further analysis. Tomato and Arabidopsis growth conditions are given in Methods S1.
Phenotypic characterization of tomato flowers and fruits
The number of floral organs was evaluated in at least 60 tomato (Solanum lycopersicum L.) flowers at anthesis stage showing wild‐type (WT)‐like, weak and severe phenotypes. A minimum of 60 mature fruits were collected and used to calculate the average fruit weight (g), width (mm), length (mm) and number of locules per phenotype.Optical microscopy and scanning electron microscopy (SEM) analyses were performed as described in Lozano et al. (1998). Sample processing and visualization techniques are described in Methods S2.
Whole‐genome sequencing and candidate gene identification
Mapping‐by‐sequencing was performed as described previously (Yuste‐Lisbona et al., 2021). The F2 mapping population was generated by crossing fig to wild tomato S. pimpinellifolium (accession no. LA1589) and self‐fertilizing the F1 plants. Two DNA pools of contrasting phenotype were sequenced using Illumina 100‐bp paired‐end reads. The resulting reads were deposited in the Sequence Read Archive (SRA) database (http://www.ncbi.nlm.nih.gov/sra) under BioProject accession no. PRJNA685617. Reads were aligned to the tomato genome reference sequence v.4.0 (ITAG4.0) using Bowtie2 (Langmead & Salzberg, 2012). The allele frequency ratio for biallelic variants was calculated as nonreference allele counts/total allele counts using a custom script in R v.4.0.1 (R Development Core Team, 2020). The average allele frequencies were plotted along each chromosome using a sliding window and step size of 1000 and 100 variants, respectively. Once the candidate gene was determined, SlCRCa locus was genotyped using the SlCRCa‐Fg and SlCRCa‐Rg primers in the F2 population (primer sequences in Table S1).
Quantitative real‐time PCR
The quantitative real‐time PCR (qRT‐PCR) analysis was carried out using three biological and two technical replicates. One microgram of RNA was used for cDNA synthesis with a ML‐MLV reverse transcriptase (Invitrogen, San Diego, CA, USA) with a mixture of random hexamer and oligo‐(dT)18 primers. Specific primer pairs (sequences listed in Table S2) were used in each qRT‐PCR with the SYBR Green PCR Master Mix Kit (Applied Biosystems, Foster City, CA, USA) on the 7300 Real‐Time PCR System (Applied Biosystems). The housekeeping gene Ubiquitin3 (Solyc01g056940) was used as a control. Gene expression was quantified using the ΔΔCt calculation method (Winer et al., 1999).
Generation of tomato transgenic lines
To generate the RNA interference (RNAi) SlCRCa construct, a 118‐bp fragment of the Solyc01g0104120 first exon was amplified using the SlCRCa‐Fi and SlCRCa‐Ri primers and cloned in sense and antisense orientation into the pKannibal vector (Wesley et al., 2001). The modified pKannibal vector was digested with NotI, and the resulting restriction fragment was cloned into the pART27 vector (Gleave, 1992). SlCRCa and SlCRCb CRISPR/Cas9 lines were obtained following the protocol described by Vazquez‐Vilar et al. (2016). The breaking‐cas software (Oliveros et al., 2016) was used to design the single‐guide RNA (sgRNA) target sequences within the coding region of SlCRCa (GTATCCAACAACTTCTTGCA) and SlCRCb (GTATCCATTAGCCTCTTGTA). Primers used in the generation of RNAi and CRISPR/Cas9 constructs are shown in Table S1. Genetic transformation experiments were developed as described in Ellul et al. (2003), using Agrobacterium tumefaciens LBA4404 strain. CR‐slcrca:slcrcb double‐mutant plants were generated using standard crossing between single slcrcb and slcrca T0 CRISPR null mutants and were confirmed by genotyping from F1 progeny plants.
In situ hybridization analysis
Tissue preparation, sectioning and transcript detection for in situ hybridization experiments were carried out as described in Lozano et al. (1998). SlCRCa (Solyc01g0104120), SlCRCb (Solyc05g012050) and SlWUS (Solyc02g083950) probes were synthesized using cDNA as a template by using the primers SlCRCa‐Fz/SlCRCa‐Rz, SlCRCb‐Fz/SlCRCb‐Rz and SlWUS‐Fz/SlWUS‐Rz (sequences are reported in Table S2), respectively. The antisense probe was synthesized using the DIG RNA labelling mix (Roche Applied Science, Indianapolis, IN, USA). As a negative control, sense RNA probes were synthesized and hybridized to sections of tomato floral buds.
RNA sequencing
Three biological replicates per genotype were sequenced, each with at least 30 floral buds at developmental stages 0–6. RNA‐sequencing (RNA‐seq) libraries were prepared from total RNA according to the Illumina TruSeq RNA protocol and sequenced using Illumina 150‐bp paired‐end reads. The resulting reads were deposited in the SRA database under BioProject accession no. PRJNA686085. Reads were aligned to the tomato genome reference sequence v.4.0 (ITAG4.0) using TopHat v.2.0.6 (Kim et al., 2013). The raw number of reads per transcript was counted using the Bioconductor packages GenomicFeatures and GenomicAlignments (Lawrence et al., 2013). Differentially expressed genes (DEGs) were determined using the Wald test in the DEseq2 package (Love et al., 2014). Genes with a false discovery rate (FDR)‐adjusted P‐value < 0.05 were defined as significantly deregulated. Gene Ontology (GO) term enrichment analysis of DEGs was performed using agriGO v.2.0 (Tian et al., 2017).
Molecular complementation of the Arabidopsis crc‐1 mutant
The crc‐1 mutant (Alvarez & Smyth, 1999) in the ecotype Landsberg erecta (Ler) genetic background was obtained from the Nottingham Arabidopsis Stock Center (NASC ID: N3814). crc‐1 was complemented with two different constructs, each carrying a 3860‐bp fragment from upstream of the Arabidopsis CRC start codon representing its promoter region (pCRC), fused to the coding sequences of either the tomato SlCRCa (pCRC::SlCRCa) or SlCRCb (pCRC::SlCRCb) genes. PCR products were purified and cloned into the pGEM‐T vector (Promega). pCRC and each gene coding fragment were linked by a double digestion with XhoI and a specific restriction enzyme, which cuts within the pGEM‐T polylinker (AatII or SacI depending on the pCRC and coding sequence orientation in the pGEM‐T) and subsequent ligation conducted by T4 DNA ligase. The complete sequences of the pCRC fused to the corresponding gene coding sequence were obtained by amplifying with pCRC‐Fac/SlCRCa‐Rac or pCRC‐Fac/SlCRCb‐Rac primers, then cloned into the pENTR/D‐TOPO vector (Invitrogen), and finally subcloned into the Gateway vector pGWB401 (Nakagawa et al., 2007). The primers used in the generation of constructs are shown in Table S3. Plasmids were transformed into an A. tumefaciens C58C1 strain. The plants of Ler and crc‐1 were transformed by the floral dip method described by Clough & Bent (1998). At least 30 flowers and siliques from Ler, crc‐1 and T1 transgenic plants, resulting from the transformation of Ler and crc‐1 plants with either pCRC::SlCRCa or pCRC::SlCRCb constructs, were evaluated under a Leica DMS1000 digital microscope.
Sequence alignment and microsynteny analysis
The amino acid sequences of SlCRCa (XP_004228849), SlCRCb (XP_004239032) and CRC (NP_177078) were downloaded from the GenBank database (http://www.ncbi.nlm.nih.gov) and pairwise aligned using blastp (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Microsynteny between the genomic regions harbouring the Arabidopsis CRC gene and either the tomato SlCRCa or SlCRCb genes was analysed with the GEvo tool (https://genomevolution.org/coge/GEvo.pl).
Subcellular localization and bimolecular fluorescence complementation assays
SlCRCa and SlCRCb subcellular localizations were assessed by fusing each protein to the green fluorescent protein (GFP). Thus, coding sequences for SlCRCa and SlCRCb proteins were cloned into the pENTR/D‐TOPO vector and recombined into the Gateway vector pGWB6 (Nakagawa et al., 2007) to integrate GFP at the N‐terminus of the proteins of interest. To test for bimolecular fluorescence complementation (BiFC)‐based protein–protein interaction, coding sequences of SlCRCa, SlCRCb, SlKNU, SlIMA, SlHDA1 and SlTPL1 proteins were cloned into the pENTR/D‐TOPO vector and subcloned into the Gateway vectors containing the N‐ or C‐terminal fragments of the yellow fluorescent protein (YFP) (pYFN43 and pYFC43 vectors, respectively). The β‐glucuronidase (GUS) enzyme, encoded by the uidA gene from Escherichia coli, fused to N‐ or C‐terminal fragments of YFP was used as negative control. Constructs were transformed in A. tumefaciens GV3101 strain and infiltrated into Nicothiana benthamiana leaves from 2‐ to 3‐wk‐old plants. Plants were kept in long‐day (16 h : 8 h, light : dark) conditions at 22°C. Samples were observed 3 d post‐infiltration using a Nikon Eclipse Ti confocal microscope. The sequences of primers used for subcellular localization and BiFC assays are shown in Table S4.
Co‐immunoprecipitation assays
The leaves of N. benthamiana were transiently co‐transfected with A. tumefaciens GV3101 strain cultures expressing either GFP‐tagged SlCRCa (SlCRCaGFP) or SlCRCb (SlCRCbGFP) and the different hemagglutinin (HA)‐tagged members of the chromatin remodelling complex (SlKUNHA, SlIMAHA, SlHDA1HA or SlTPL1HA). Likewise, the SlCRCbGFP was co‐transfected with HA‐tagged SlCRCa (SlCRCaHA). For this purpose, pENTR/D‐TOPO vectors containing full open reading frame sequences of the recombinant fusion proteins of interest were recombined into the Gateway vectors pGWB6 and pGWB15 (Nakagawa et al., 2007), containing GFP and HA tags, respectively. These vectors were co‐infiltrated in N. benthamiana leaves from 2‐ to 3‐wk‐old plants. Plants were kept under long‐day (16 h : 8 h, light : dark ) conditions at 22°C. Subsequent protein extraction was performed from the leaves harvested 2 d after infiltration. Plant material was ground in liquid nitrogen and homogenized in protein extraction buffer (25 mM Tris–HCl, pH 7.4, 75 mM NaCl, 0.5% Nonidet P‐40, 0.05% sodium deoxycholate, 10 mM β‐mercaptoethanol, 1 mM PMSF and cOmplete, EDTA‐free Protease Inhibitor Cocktail (Roche Applied Science)). Protein extracts were centrifuged twice at 14 000
for 10 min at 4°C. After cell lysis, GFP‐tagged proteins were magnetically labelled and subsequently isolated using a µMACS Isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany). The resulting samples were analysed by SDS‐PAGE and immunoblotted using anti‐GFP‐HPR (Miltenyi Biotec) and anti‐HA‐peroxidase (Roche Applied Science) antibodies.
Results
fig mutation impairs carpel determinacy
The fruit iterative growth (fig) mutant was isolated from the screening of a collection of T1‐segregating T‐DNA lines generated from the tomato cultivar P73 (Pérez‐Martín et al., 2017). Vegetative development of fig plants was indistinguishable from that of WT ones, whereas significant differences were observed during flower and fruit development (Fig. 1a–c; Table S5). fig flowers developed an elevated number of organs in all whorls, this increase being more evident in carpels. Thus, carpel formation occurs repeatedly in the gynoecium of fig flowers leading to anomalous fruits, that show secondary fruit structures growing in an indeterminate way that appeared from the inside of the principal fruit (Fig. 1a–c; Table S5).
Fig. 1
Phenotypic characterization of the tomato (Solanum lycopersicum) fig mutant. (a–c) Representative fig flowers, pistils, closed fruits and longitudinal open fruits (from left to right) showing WT‐like (identical to wild‐type, WT) (a), weak (b) and severe (c) phenotypes. (d) Percentage of different types of fruits (WT‐like, weak or severe) produced by WT (cv P73) and fig plants. N, number of plants evaluated; n, number of fruits harvested. (e–g) Scanning electron microscopy images of flowers at stages 5 and 8 of floral development, and histological sections of flowers at anthesis day (AD) stage exhibiting WT‐like (e), weak (f) and severe (g) phenotypes. Sepals were removed in samples at stage 5, whereas only the carpels were maintained in developing flowers at stage 8. Petals are coloured in yellow, stamens in orange and carpels in blue.
Phenotypic characterization of the tomato (Solanum lycopersicum) fig mutant. (a–c) Representative fig flowers, pistils, closed fruits and longitudinal open fruits (from left to right) showing WT‐like (identical to wild‐type, WT) (a), weak (b) and severe (c) phenotypes. (d) Percentage of different types of fruits (WT‐like, weak or severe) produced by WT (cv P73) and fig plants. N, number of plants evaluated; n, number of fruits harvested. (e–g) Scanning electron microscopy images of flowers at stages 5 and 8 of floral development, and histological sections of flowers at anthesis day (AD) stage exhibiting WT‐like (e), weak (f) and severe (g) phenotypes. Sepals were removed in samples at stage 5, whereas only the carpels were maintained in developing flowers at stage 8. Petals are coloured in yellow, stamens in orange and carpels in blue.The observed phenotypic segregation (39 WT: 15 fig) was consistent with a monogenic recessive inheritance of the fig mutation (χ
2 = 0.22; P = 0.64). However, the fig phenotype showed incomplete penetrance and variable expressivity, as a gradation of phenotypes was displayed within the same mutant plant, even within the same inflorescence. Therefore, variable flower and fruit phenotypes were observed in fig plants, which were classified as WT‐like (indistinguishable from WT), weak and severe indeterminate phenotypes (Figs 1a–c, S1), the average production of fruits with severe phenotype being close to 50% per fig plant (Fig. 1d).A SEM study in developing flowers revealed that the first visible anomalies could be detected at floral stage 5 (Brukhin et al., 2003). At this stage, carpels emerge, and ovary cavities become visible showing abnormal carpel structures in both weak and severe fig flowers (Fig. 1f,g). At stage 8, WT pistils are formed by 3–4 carpels (Fig. 1e), whereas an increased number of carpels are observed in fig flowers resulting in incomplete fused pistils (Figs 1f,g, S1). Histological sections of flowers at anthesis day showed that fig pistils have shorter and thicker styles and are composed of numerous carpels that grow one inside another, which strongly suggests that fig mutation affects carpel determinacy. These differences were more accentuated in severe fig flowers (Fig. 1c,g), producing ovaries 3‐fold bigger than the WT ones at anthesis day stage (Fig. 1a,e). As a result of this variable range of fig flower phenotypes, we observed both weak fig fruits producing secondary fruit structures only visible inside the fruit (Fig. 1b), and severe fig fruits where these secondary fruit structures emerged from inside and were visible outside the fruit (Figs 1c, S1). Despite such abnormalities and although more extreme fig fruits produced fewer seeds, fig mutants gave rise to viable seeds.Molecular analyses revealed that the fig mutation was not associated with a T‐DNA insertion (Fig. S2), suggesting that a somaclonal variation produced during the in vitro culture process is responsible for the mutant phenotype. To identify the causative mutation underlying the fig phenotype, we performed a mapping‐by‐sequencing strategy using an F2 population derived from crossing fig to the wild tomato S. pimpinellifolium (accession no. LA1589). A total of 783 F2 plants were scored for ovary and fruit development, from which 212 plants produced fused carpels and indeterminate fruits. The phenotypic segregation observed in this F2 progeny (571 WT: 212 fig) was consistent with a monogenic recessive inheritance of the fig mutation (χ
2 = 1.80, P = 0.18). We then conducted genome sequencing of two DNA pools containing 50 WT and 25 fig F2 plants with the most strongly indeterminate phenotype. Genome‐wide analysis of the allele frequencies revealed a region encompassing the centromere of chromosome 1 (2.4–70 Mb) with a strong bias towards tomato reference alleles (Fig. 2a). Variant analysis in this candidate region identified three SNPs mapping at the fourth intron of the Solyc01g010240 gene, which also showed a marked decrease in the sequence coverage of the mutant pool compared with other coding and noncoding regions of this gene. PCR analyses with primers flanking the region containing these SNPs in WT and fig plants showed that the PCR product from fig genomic DNA was larger than expected. Sequence analysis verified that a DNA fragment of 367 bp was inserted at position 5053 687 on the chromosome 1 of the mutant genome (Assembly SL4.0), interrupting the intron sequence between the Solyc01g010240 exons 4 and 5 (Fig. 2b). This insertion shares a sequence identity of 86% with the long terminal repeat (LTR) copy placed between 6336 872 and 6337 201 positions on the chromosome 10, which may have acted as a transposable element. Co‐segregation analysis performed in the F2 population showed that all 212 fig mutant plants were homozygous for the 367‐bp LTR insertion, whereas 393 and 178 phenotypically WT plants were hemizygous or lacked the LTR insertion, respectively, indicating that the fig phenotype co‐segregated with the LTR insertion at the Solyc01g010240 gene.
Fig. 2
Tomato FIG gene encodes a homologue of the Arabidopsis CRC gene. (a) Distribution of the average allele frequency of wild‐type (WT; blue line) and fig (red line) pools grouped by chromosomes. (b) Schematic representation of the SlCRCa gene (introns are represented by black lines, and coding and UTRs are in black and grey boxes, respectively) and the 367‐bp sequence inserted at the fourth intron in fig mutants. (c) Relative expression of SlCRCa in WT and fig flowers at different stages of floral development. FB0‐6, floral buds from stages 0 to 6; FB7‐12, floral buds from stages 7 to 12; PA, flowers at pre‐anthesis stage; AD, flowers at anthesis stage; AD+10, flowers 10 d after anthesis stage. (d) SlCRCa transcripts quantification of flowers at stage FB0‐6 from RNAi SlCRCa and WT lines. (e) Representative RNAi SlCRCa flowers, pistils and fruits displaying WT‐like, weak and severe mutant phenotypes. (f) Percentage of different types of fruits harvested from WT and T0 RNAi SlCRCa plants. (g) CRISPR/Cas9‐slcrca (CR‐slcrca) alleles identified by cloning and sequencing PCR products from the SlCRCa‐targeted region from four T0 CRISPR/Cas9 plants. Black bold and underlined letters indicate protospacer adjacent motif (PAM) sequences, blue dashed lines show InDel mutations, and blue letter and arrow indicate an insertion sequence. (h) Representative CR‐slcrca flowers, pistils and fruits exhibiting WT‐like, weak and severe phenotypes. (i) Percentage of different types of fruits harvested from WT and T0 CR‐slcrca plants. In (f, i), n value indicates the number of fruits harvested per plant. In (c, d), data are means ± SD of three biological and two technical replicates. A two‐tailed, two‐sample Student t‐test was performed, and significant differences are represented by asterisks: *, P < 0.01; **, P < 0.001; ns, no statistically significant differences.
Tomato FIG gene encodes a homologue of the Arabidopsis CRC gene. (a) Distribution of the average allele frequency of wild‐type (WT; blue line) and fig (red line) pools grouped by chromosomes. (b) Schematic representation of the SlCRCa gene (introns are represented by black lines, and coding and UTRs are in black and grey boxes, respectively) and the 367‐bp sequence inserted at the fourth intron in fig mutants. (c) Relative expression of SlCRCa in WT and fig flowers at different stages of floral development. FB0‐6, floral buds from stages 0 to 6; FB7‐12, floral buds from stages 7 to 12; PA, flowers at pre‐anthesis stage; AD, flowers at anthesis stage; AD+10, flowers 10 d after anthesis stage. (d) SlCRCa transcripts quantification of flowers at stage FB0‐6 from RNAi SlCRCa and WT lines. (e) Representative RNAi SlCRCa flowers, pistils and fruits displaying WT‐like, weak and severe mutant phenotypes. (f) Percentage of different types of fruits harvested from WT and T0 RNAi SlCRCa plants. (g) CRISPR/Cas9‐slcrca (CR‐slcrca) alleles identified by cloning and sequencing PCR products from the SlCRCa‐targeted region from four T0 CRISPR/Cas9 plants. Black bold and underlined letters indicate protospacer adjacent motif (PAM) sequences, blue dashed lines show InDel mutations, and blue letter and arrow indicate an insertion sequence. (h) Representative CR‐slcrca flowers, pistils and fruits exhibiting WT‐like, weak and severe phenotypes. (i) Percentage of different types of fruits harvested from WT and T0 CR‐slcrca plants. In (f, i), n value indicates the number of fruits harvested per plant. In (c, d), data are means ± SD of three biological and two technical replicates. A two‐tailed, two‐sample Student t‐test was performed, and significant differences are represented by asterisks: *, P < 0.01; **, P < 0.001; ns, no statistically significant differences.Notwithstanding that the 367‐bp insertion occurs at a noncoding region, we considered the Solyc01g010240 gene as a strong candidate to be responsible for the fig phenotype, since it is the homologue of the Arabidopsis CRC gene, SlCRCa, a putative transcription factor of the YABBY gene family previously described as involved in carpel and nectary development and FM determination (Alvarez & Smyth, 1999; Bowman & Smyth, 1999). To determine the effects of the LTR insertion on SlCRCa expression, cDNA cloning and qRT‐PCR analyses were performed. The sequences of WT and mutant cDNAs were identical, but SICRCa expression was significantly reduced in floral buds of the fig mutant, at stages 0–6 and 7–12 (Fig. 2c). Thus, the 367‐bp insertion reduced SlCRCa transcript level to > 2‐fold but still allowed the production of WT SlCRCa mRNA, suggesting that the fourth SlCRCa intron may contain a transcriptional regulatory element critical for the maintenance of the SlCRCa spatio‐temporal expression pattern.To corroborate whether the lack of SlCRCa function is responsible for the fig phenotype, we generated RNAi‐mediated knockdown lines with reduced levels of SlCRCa transcripts. Four independent first‐generation (T0) RNAi SlCRCa diploid lines were evaluated, which showed > 2‐fold decrease in SlCRCa expression in floral buds at stages 0–6 (Fig. 2d). As happened with the fig mutation, RNAi SlCRCa lines displayed a variable range of flower phenotypes, resulting in the development of fruits with WT‐like, weak and severe indeterminate phenotypes (Fig. 2e,f). Furthermore, we engineered knockout mutations using the CRISPR/Cas9 system with a sgRNA targeting the second exon of SlCRCa (Fig. 2g). We assessed four independent T0 diploid lines (CR‐slcrca) that were biallelic for edited knockout alleles (Fig. 2g). CR‐slcrca lines developed flowers and fruits, which undoubtedly resembled the phenotype observed in fig mutants, and they also produced a wide diversity of flower and indeterminate fruit phenotypes, most of them classified as severe (Fig. 2f,h). Therefore, although there were differences in the percentages of fruits with the severe mutant phenotype, both knockdown (RNAi) and knockout (CRISPR/Cas9) alleles resulted in the similar phenotypes with incomplete penetrance and variable expressivity, indicating that any deficiency in SlCRCa function might lead to a loss of FM determinacy.
SlCRCa expression is restricted to carpels
As expected from the fig phenotype, SlCRCa expression was mainly restricted to flowers at early developmental stages. The higher SlCRCa expression was found in floral buds at stages 0–6 (Fig. 3a). RNA in situ hybridization analysis revealed that SlCRCa transcripts were accumulated specifically in carpel primordia when they were initiated at floral stage 3 (Fig. 3b), and persisted in these primordia at floral stage 6, when carpels were growing up and the primordium of placenta emerged (Fig. 3c). At floral stage 8, SlCRCa expression was located at the adaxial surface on the base of the ovary walls, as well as in the most distal cells of the developing gynoecium, which would produce the style and the stigma (Fig. 3d). However, SlCRCa mRNA was not detected in the ovary walls at floral stage 9, and its expression remained in the distal part of the gynoecium (Fig. 3e). At later stages of floral development, there was no evidence of detectable SlCRCa transcripts.
Fig. 3
Dynamic expression of tomato SlCRCa and SlCRCb genes. (a) Relative expression of SlCRCa determined by qRT‐PCR in different developmental tissues and stages of wild‐type (WT) flowers. (b–e) In situ mRNA hybridization of SlCRCa using antisense or sense probes in histological sections of WT flowers at different developmental stages: stage 3 (b), stage 6 (c), stage 8 (d) and stage 9 (e). (f) Relative expression of SlCRCb determined by qRT‐PCR in different developmental tissues and stages of WT flowers. (g–j) In situ mRNA hybridization of SlCRCb using antisense or sense probes in histological sections of WT flowers at different developmental stages: stage 3 (g), stage 6 (h), stage 8 (i) and stage 9 (j). In (a, f), data are means ± SD of three biological and two technical replicates. FB0‐6, floral buds from stages 0 to 6; FB7‐12, floral buds from stages 7 to 12; PA, flowers at pre‐anthesis stage; AD, flowers at anthesis stages; AD+10, flowers 10 d after anthesis stage; IG; immature green fruit; MG, mature green fruit; BR, breaker fruit; and RR, mature red fruit. Bars, 100 μm; the floral organ primordia of sepal (se), petal (pe), stamen (st) and carpel (ca), as well as ovules (ov) in the carpel cavities, are indicated.
Dynamic expression of tomato SlCRCa and SlCRCb genes. (a) Relative expression of SlCRCa determined by qRT‐PCR in different developmental tissues and stages of wild‐type (WT) flowers. (b–e) In situ mRNA hybridization of SlCRCa using antisense or sense probes in histological sections of WT flowers at different developmental stages: stage 3 (b), stage 6 (c), stage 8 (d) and stage 9 (e). (f) Relative expression of SlCRCb determined by qRT‐PCR in different developmental tissues and stages of WT flowers. (g–j) In situ mRNA hybridization of SlCRCb using antisense or sense probes in histological sections of WT flowers at different developmental stages: stage 3 (g), stage 6 (h), stage 8 (i) and stage 9 (j). In (a, f), data are means ± SD of three biological and two technical replicates. FB0‐6, floral buds from stages 0 to 6; FB7‐12, floral buds from stages 7 to 12; PA, flowers at pre‐anthesis stage; AD, flowers at anthesis stages; AD+10, flowers 10 d after anthesis stage; IG; immature green fruit; MG, mature green fruit; BR, breaker fruit; and RR, mature red fruit. Bars, 100 μm; the floral organ primordia of sepal (se), petal (pe), stamen (st) and carpel (ca), as well as ovules (ov) in the carpel cavities, are indicated.RNA‐seq was next performed on WT and fig floral buds at developmental stages 0–6 to gain insight into the functional role of SlCRCa. This analysis identified 2115 DEGs in fig as compared to WT, of which 978 were up‐regulated and 1137 were down‐regulated (Table S6). To investigate the functions of DEGs, we applied a GO enrichment analysis, which revealed 29 and 36 overrepresented GO terms for up‐ and down‐regulated DEGs, respectively (Table S7). For biological process, GO terms belonging to response to stimulus (GO: 0050896) were enriched in both groups of DEGs. However, biological processes related to reproduction (GO: 0000003), reproductive process (GO: 0022414), developmental process involved in reproduction (GO: 0003006), reproductive structure development (GO: 0048608) and flower development (GO: 0009908) were enriched among up‐regulated DEGs. Regarding molecular function, GO terms involved in protein binding (GO: 0005515) were enriched in both up‐ and down‐regulated DEGs. In addition, transporter activity (GO: 0005215) and transcription factor activity of sequence‐specific DNA binding (GO : 0003700) terms were enriched in up‐regulated DEGs (Table S7; Fig. S3).Among the up‐regulated DEGs annotated with the reproductive structure development (GO: 0003700) and flower development (GO: 0009908) terms, we found the homologues of the Arabidopsis PIN‐FORMED auxin efflux carrier (Solyc03g118740, Solyc04g007690 and Solyc05g008060) and the AUXIN RESPONSE FACTOR transcription factor (Solyc09g007810 and Solyc12g042070) families, as well as the homologues of the floral homeotic genes APETALA2 (Solyc02g064960), APETALA3 (Solyc04g081000), FRUITFULL (Solyc03g114830) and SEPALLATA4 (Solyc03g114840), the latter of which is also involved in the determination of FM (Ditta et al., 2004). Within this group of genes, we also found the homologue of the Arabidopsis HECATE3 (Solyc11g005780), whose overexpression causes the production of ectopic stigmatic tissue (Gremski et al., 2007). Remarkably, a second homologue of the Arabidopsis CRC gene (SlCRCb, Solyc05g012050) was moreover included in this group of up‐regulated DEGs.
Knockout mutations in SlCRCb mimic fig mutant phenotype
While the Arabidopsis genome carries one copy of the CRC gene, an ancestral duplication in Solanaceae generated two paralogues, CRCa and CRCb, whose retention across Solanaceae genomes suggests functional relevance (Phukela et al., 2020). Sequence analysis of the Arabidopsis CRC (181 aa) and the tomato SlCRCa (173 aa) and SlCRCb (160 aa) amino acid sequences displayed that CRC has an identity of 64 and 68% to SlCRCa and SlCRCb, respectively; while SlCRCa shows 73% identity to SlCRCb. Microsynteny study between genomic blocks harbouring CRC genes in Arabidopsis and tomato showed that the Arabidopsis genomic region containing CRC was more closely related to that in tomato, which bears SlCRCb rather than SlCRCa (Fig. S4). To gain further insight into the role of SlCRCb, we examined its spatio‐temporal expression. As with SlCRCa, a specific expression in reproductive tissues was observed for SlCRCb (Fig. 3a,f), although SlCRCb transcripts were detected throughout all floral development stages, from floral buds at developmental stages 0–6 to flowers at 10 d post‐anthesis (Fig. 3f), whereas SlCRCa expression was mainly detected at first stages of floral bud development (Fig. 3a). Even though SlCRCa and SlCRCb showed differential temporal expression patterns, in situ hybridization studies in developing flowers revealed that SlCRCb shows an identical spatial expression profile to SlCRCa. Thus, SlCRCb transcript accumulation was first localized at floral stage 3 in carpel primordia (Fig. 3g), where it continued until floral stage 6 (Fig. 3h). As the development progressed to floral stage 8, SlCRCb expression was detected in the ovary walls and the distal regions of the developing gynoecium (Fig. 3i), where its expression remained restricted at floral stage 9 (Fig. 3j).The incomplete penetrance and variable expressivity of mutations at the SlCRCa locus, as well as the overlapping SlCRCa and SlCRCb spatial expression patterns at the initiation of gynoecium development, led to a hypothesis that a partial redundancy of tomato CRC paralogues may exist. To test this hypothesis, we generated knockout mutations using CRISPR/Cas9 system with a sgRNA targeting the second exon of SlCRCb (Fig. 4a). We evaluated four independent T0 diploid lines (CR‐slcrcb) homozygous or biallelic for edited knockout alleles (Fig. 4a). CR‐slcrcb lines produced flowers with ovaries composed of numerous carpels growing inside one another, which led to anomalous fruits similar to those observed in fig mutants, RNAi SlCRCa and CR‐slcrca lines (Fig. 4b). CR‐slcrcb lines also produced a wide diversity of flower and indeterminate fruit phenotypes, although the presence of fruits with weak or severe mutant phenotypes did not exceed 50%, the percentages of fruits with the severe mutant phenotype close to 15% (Fig. 4c). These results revealed that SlCRCa and SlCRCb could have partially redundant roles in FM determinacy.
Fig. 4
Characterization of tomato CRISPR/Cas9‐slcrcb (CR‐slcrcb) and double‐mutant CR‐slcrca:slcrcb lines. (a) CR‐slcrcb alleles identified by cloning and sequencing PCR products from the SlCRCb‐targeted region from four T0 CRISPR plants. Black bold and underlined letters indicate protospacer adjacent motif (PAM) sequences, blue dashed lines show InDel mutations, and blue letter and arrow indicate an insertion sequence. (b) Representative CR‐slcrcb flowers, pistils and fruits exhibiting WT‐like (identical to wild‐type, WT), weak and severe phenotypes. (c) Percentage of different types of fruits harvested from WT and T0 CR‐slcrcb plants. (d) Relative expression of SlCRCa and SlCRCb in CR‐slcrcb and CR‐slcrca lines, respectively, at different floral developmental stages. FB0‐6, floral buds from stages 0 to 6; FB7‐12, floral buds from stages 7 to 12; PA, flowers at pre‐anthesis stage; AD, flowers at anthesis stage; and AD+10, flowers 10 d after anthesis stage. Data are means ± SD of three biological and two technical replicates. A two‐tailed, two‐sample Student t‐test was performed, and significant differences are represented by asterisks: *, P < 0.01; **, P < 0.001; ns, no statistically significant differences. (e, f) Representative flower, pistil and fruits developed by CR‐slcrca:slcrcb double mutants. (e) Detail of the fourth floral whorl organs and morphological features of their epidermal cells in a flower at anthesis stage. (f) Immature green and mature red fruits. (g) Percentage of different types of fruits harvested from WT and T0 CR‐slcrca:slcrcb plants. In (c, g), n value indicates the number of fruits harvested per plant.
Characterization of tomato CRISPR/Cas9‐slcrcb (CR‐slcrcb) and double‐mutant CR‐slcrca:slcrcb lines. (a) CR‐slcrcb alleles identified by cloning and sequencing PCR products from the SlCRCb‐targeted region from four T0 CRISPR plants. Black bold and underlined letters indicate protospacer adjacent motif (PAM) sequences, blue dashed lines show InDel mutations, and blue letter and arrow indicate an insertion sequence. (b) Representative CR‐slcrcb flowers, pistils and fruits exhibiting WT‐like (identical to wild‐type, WT), weak and severe phenotypes. (c) Percentage of different types of fruits harvested from WT and T0 CR‐slcrcb plants. (d) Relative expression of SlCRCa and SlCRCb in CR‐slcrcb and CR‐slcrca lines, respectively, at different floral developmental stages. FB0‐6, floral buds from stages 0 to 6; FB7‐12, floral buds from stages 7 to 12; PA, flowers at pre‐anthesis stage; AD, flowers at anthesis stage; and AD+10, flowers 10 d after anthesis stage. Data are means ± SD of three biological and two technical replicates. A two‐tailed, two‐sample Student t‐test was performed, and significant differences are represented by asterisks: *, P < 0.01; **, P < 0.001; ns, no statistically significant differences. (e, f) Representative flower, pistil and fruits developed by CR‐slcrca:slcrcb double mutants. (e) Detail of the fourth floral whorl organs and morphological features of their epidermal cells in a flower at anthesis stage. (f) Immature green and mature red fruits. (g) Percentage of different types of fruits harvested from WT and T0 CR‐slcrca:slcrcb plants. In (c, g), n value indicates the number of fruits harvested per plant.Taking into account that RNA‐seq results showed that SlCRCb was up‐regulated in fig floral buds, the question arose as to whether a compensatory mechanism between tomato CRC paralogues may be involved in gynoecium determination. For that purpose, SlCRCa and SlCRCb expression was quantified in reproductive tissues of slcrcb and slcrca CRISPR/Cas9 null mutants, respectively. SlCRCb was differentially up‐regulated in CR‐slcrca floral buds at developmental stages 0–6 (Fig. 4d). SlCRCb was also up‐regulated in CR‐slcrca from floral buds to anthesis day during floral development, whereas SlCRCa transcripts were up‐regulated in CR‐slcrcb floral buds at developmental stages 0–6 (Fig. 4d). Additionally, we generated CR‐slcrca:slcrcb double‐mutant plants to further dissect the relationship between tomato CRC paralogues. Remarkably, the simultaneous loss of function of SlCRCa and SlCRCb resulted in homeotic alterations affecting carpel development as the shape of some of its cells attained a stamen‐like nature (Figs 4e, S5). CR‐slcrca:slcrcb flowers produced stamen‐like carpels in a reiterating pattern exclusively affecting the fourth whorl, thus forming fruits with a severe indeterminate phenotype (Fig. 4f,g), which in all cases was considerably more severe than in either CR‐slcrca or CR‐slcrcb single mutants. Hence, complete penetrance and invariable expressivity were found when both tomato paralogues lost their functions.
Tomato CRC paralogues bind to the chromatin remodelling complex members repressing SlWUS expression
Floral determinacy requires the repression of the stem cell identity gene SlWUS (Bollier et al., 2018); therefore, we further investigated the function of tomato CRC paralogues in FM determination by examining the spatio‐temporal expression of SlWUS. In WT flowers, SlWUS expression in the organizing centre was detected from early FM developmental stages (Chu et al., 2019), until stem cell activity was arrested in floral buds at stages 4–5, when the carpel primordia started to emerge (Fig. 5a). From stage 6 onwards, SlWUS signal was completely abolished in WT developing carpels. However, SlWUS transcripts were detected, between the growing but still unfused carpel primordia, in both CR‐slcrca and CR‐slcrcb floral buds at stage 6. SlWUS expression was even observed at later stages in a small group of cells in the placenta, where the initiation of new carpel primordia probably occurs (Fig. 5a). An enlarged SlWUS expression domain was observed in CR‐slcrca:slcrcb flowers leading to an increased FM size, which agrees with the severe indeterminacy found in double‐mutant carpels (Fig. 5a). Hence, the extended expression of SlWUS correlates with the floral indeterminacy phenotype of CR‐slcrc lines, suggesting that tomato CRC paralogues might participate in the regulation of SlWUS transcription limiting FM activity and promoting floral determinacy.
Fig. 5
Tomato CRC paralogues interact with the chromatin remodelling complex members repressing SlWUS expression. (a) In situ mRNA hybridization of SlWUS in histological sections of wild‐type (WT), CR‐slcrca, CR‐slcrcb and CR‐slcrca:slcrcb flowers at developmental stages 4, 6 and 8. (b) Subcellular localization of SlCRCa and SlCRCb. The entire SlCRCa and SlCRCb coding sequences were N‐terminally fused to green fluorescent protein (GFP) and transiently expressed in Nicotiana benthamiana leaves. (c) Bimolecular fluorescence complementation confocal images showing in vivo interactions in N. benthamiana leaves between either the yellow fluorescent protein (YFP) C‐terminal region fused to SlCRCa (SlCRCa‐cYFP) or SlCRCb (SlCRCb‐cYFP), and fusions of the YFP N‐terminal region fused to SlKNU (nYFP‐SlKNU), SlIMA (nYFP‐SlIMA), SlHDA1 (nYFP‐SlHDA1) or SlTPL1 (nYFP‐SlTPL1). The SlCRCa‐cYFP fusion was also examined with SlCRCb fused to the YFP N‐terminal region (nYFP‐SlCRCb). As negative control, each protein under study was co‐infiltrated with the nonplant β‐glucuronidase (GUS) enzyme fused to cYFP or nYFP. No YFP signal was observed in negative controls (Supporting Information Fig. S6). (d) Co‐immunoprecipitation studies of N. benthamiana leaves expressing either GFP‐tagged SlCRCa (SlCRCaGFP) or SlCRCb (SlCRCbGFP) and the different hemagglutinin (HA)‐tagged members of the chromatin remodelling complex (SlKUNHA, SlIMAHA, SlHDA1HA or SlTPL1HA). SlCRCbGFP was also tested with HA‐tagged SlCRCa (SlCRCaHA). The input total protein extracts were immunoprecipitated with anti‐GFP beads, and the unbound and recovered fractions (CoIP) were incubated with anti‐GFP (AbGFP) and anti‐HA (AbHA) antibodies to detect precipitated and co‐purified proteins, respectively. In (a), the floral organ primordia of sepal (se), petal (pe), stamen (st) and carpel (ca) are indicated. Bars, 100 μm.
Tomato CRC paralogues interact with the chromatin remodelling complex members repressing SlWUS expression. (a) In situ mRNA hybridization of SlWUS in histological sections of wild‐type (WT), CR‐slcrca, CR‐slcrcb and CR‐slcrca:slcrcb flowers at developmental stages 4, 6 and 8. (b) Subcellular localization of SlCRCa and SlCRCb. The entire SlCRCa and SlCRCb coding sequences were N‐terminally fused to green fluorescent protein (GFP) and transiently expressed in Nicotiana benthamiana leaves. (c) Bimolecular fluorescence complementation confocal images showing in vivo interactions in N. benthamiana leaves between either the yellow fluorescent protein (YFP) C‐terminal region fused to SlCRCa (SlCRCa‐cYFP) or SlCRCb (SlCRCb‐cYFP), and fusions of the YFP N‐terminal region fused to SlKNU (nYFP‐SlKNU), SlIMA (nYFP‐SlIMA), SlHDA1 (nYFP‐SlHDA1) or SlTPL1 (nYFP‐SlTPL1). The SlCRCa‐cYFP fusion was also examined with SlCRCb fused to the YFP N‐terminal region (nYFP‐SlCRCb). As negative control, each protein under study was co‐infiltrated with the nonplant β‐glucuronidase (GUS) enzyme fused to cYFP or nYFP. No YFP signal was observed in negative controls (Supporting Information Fig. S6). (d) Co‐immunoprecipitation studies of N. benthamiana leaves expressing either GFP‐tagged SlCRCa (SlCRCaGFP) or SlCRCb (SlCRCbGFP) and the different hemagglutinin (HA)‐tagged members of the chromatin remodelling complex (SlKUNHA, SlIMAHA, SlHDA1HA or SlTPL1HA). SlCRCbGFP was also tested with HA‐tagged SlCRCa (SlCRCaHA). The input total protein extracts were immunoprecipitated with anti‐GFP beads, and the unbound and recovered fractions (CoIP) were incubated with anti‐GFP (AbGFP) and anti‐HA (AbHA) antibodies to detect precipitated and co‐purified proteins, respectively. In (a), the floral organ primordia of sepal (se), petal (pe), stamen (st) and carpel (ca) are indicated. Bars, 100 μm.A complete termination of floral stem cell activity in tomato is mediated by a chromatin remodelling complex consisting of SlIMA (Solyc02g087970), SlKNU (Solyc02g160370), SlTPL (Solyc01g100050) and SlHDA1 (Solyc09g091440), which enables the repression of SlWUS (Bollier et al., 2018). As SlWUS expression was misregulated in CR‐slcrca and CR‐slcrcb indeterminate flowers, we wondered whether tomato CRC paralogues might be part of this regulatory pathway. Since SlKNU, SlIMA, SlTPL1 and SlHDA1 show nuclear localization, we first evaluated SlCRCa and SlCRCb subcellular localization by transient expression of N‐terminal GFP‐tagged versions of SlCRCa and SlCRCb. A confocal microscopy analysis revealed an exclusive nuclear localization for both proteins (Fig. 5b). Next, we conducted BiFC assays to evaluate whether tomato CRC paralogues might physically interact in planta with the chromatin remodelling complex members including SlKNU, SlIMA, SlTPL1 and SlHDA1. As noted by the YFP signal observed at the nucleus of epidermal cells, SlCRCa and SlCRCb were able to physically interact with each other and each of them in turn with SlKNU, SlIMA and SlHDA1. In addition, SlCRCb, but not SlCRCa, was found to bind to SlTPL1 (Fig. 5c). The lack of interaction between SlCRCa and SlTPL1 was also confirmed by BiFC experiments in the opposite orientation (Fig. S6). The interactions described above were furthermore corroborated by co‐immunoprecipitation (CoIP) studies (Fig. 5d), evidencing that SlCRCa and SlCRCb can physically bind to the chromatin remodelling complex members, which in turn repress SlWUS expression to promote FM determinacy.
Tomato CRC paralogues partially rescue the loss of function of the Arabidopsis CRC gene
In Arabidopsis, mutations in CRC affect gynoecium development, which fails to fuse at the apex, making it wider and shorter than the WT one (Alvarez & Smyth, 1999; Bowman & Smyth, 1999). As tomato CRC paralogues seem to have partially redundant functions, we next questioned whether they may be able to complement the phenotypic defects of Arabidopsis crc mutants. Thus, the crc‐1 mutant, a strong hypomorphic allele in the Ler genetic background, was genetically transformed with either SlCRCa or SlCRCb coding sequences under the control of the Arabidopsis CRC promoter (pCRC::SlCRCa and pCRC::SlCRCb). For these experiments, a 3860‐bp fragment from upstream of the Arabidopsis CRC start codon was used as promoter sequence since its functionality has been previously demonstrated (Fourquin et al., 2007). In comparison with WT Ler plants, crc‐1 exhibited unfused carpels and the abolition of nectary development, as well as considerably shorter and wider siliques (Fig. 6). The pCRC::SlCRCa and pCRC::SlCRCb transgenes were able to fully restore carpel fusion (Fig. 6c) and slightly increased silique length (Fig. 6a,b). In agreement with the lack of nectaries in tomato flowers, SlCRCa and SlCRCb did not rescue nectary development in crc‐1 (Fig. 6d). As a control, WT Ler plants were also transformed with either pCRC::SlCRCa or pCRC::SlCRCb, which exhibited no significant differences with respect to untransformed Ler plants (Fig. S7). Overall, our results denote that tomato CRC paralogues are capable of partially restoring a WT phenotype when transformed into crc‐1 plants.
Fig. 6
Complementation of the Arabidopsis crc‐1 mutation by transformation with tomato CRC paralogues. (a–d) Fully elongated siliques (a), silique length (b), silique apices showing different degrees of carpel fusion (c) and development of nectaries (arrows) at the base of the third floral whorl in the Ler wild‐type, which are absent in crc‐1 mutant and transgenic pCRC::SlCRCa and pCRC::SlCRCb plants (d). In (b), pairwise comparisons of means using the least significant difference test were performed. Values followed by the same lower‐case letter are not statistically different (P < 0.05). Error bars represent the SD of the mean values.
Complementation of the Arabidopsis crc‐1 mutation by transformation with tomato CRC paralogues. (a–d) Fully elongated siliques (a), silique length (b), silique apices showing different degrees of carpel fusion (c) and development of nectaries (arrows) at the base of the third floral whorl in the Ler wild‐type, which are absent in crc‐1 mutant and transgenic pCRC::SlCRCa and pCRC::SlCRCb plants (d). In (b), pairwise comparisons of means using the least significant difference test were performed. Values followed by the same lower‐case letter are not statistically different (P < 0.05). Error bars represent the SD of the mean values.
Discussion
Tomato CRC paralogues safeguard floral determinacy by acting in a partially redundant and compensatory manner
We have addressed the functional characterization of tomato paralogous CRC genes and examined their potential roles in FM determinacy and carpel formation. Our results revealed that a 367‐bp insertion in the fourth intron of the SlCRCa gene causes the carpel‐inside‐carpel phenotype observed in fig plants. Loss‐of‐function analyses of SlCRCa, involving either knockdown or knockout approaches, allowed for the generation of an allelic series at this locus, which resulted in analogous mutant phenotypes with incomplete penetrance and variable expressivity. Indeed, variable floral and fruit phenotypes were observed even in the same individual, ranging from indistinguishable from WT to severe developmental defects. Consequently, these results denoted that any impairment of SlCRCa function would give rise to a loss of FM determinacy characterized by the proliferation of additional carpels within the unfused primary carpels. Our results also suggested that there is not a direct correlation between SlCRCa mRNA levels and the severity of the mutant phenotypes, which agrees with the hypothesis that proposes a nonlinear gene dosage response for developmental regulators involved in complex transcriptional regulatory networks (Birchler et al., 2016). The lack of predictability between gene dosage and phenotypic alterations has been also reported for other tomato meristem genes. Thus, through creating a series of cis‐regulatory alleles by genome editing, Rodríguez‐Leal et al. (2017) demonstrated that variations in fruit size are not predicted by changes in gene expression levels of the CLAVATA‐WUSCHEL pathway.Incomplete penetrance and variable expressivity of mutant phenotypes were also observed among knockout mutant lines for SlCRCb, whereas all flowers developed by double‐mutant plants for SlCRCa and SlCRCb loci showed a severe indeterminate phenotype. Based on these results, we conclude that tomato CRC paralogues operate as positive regulators of floral determinacy by acting in a partially redundant manner to safeguard normal determination of FM and carpel development. Indeed, the loss of carpel identity in the CR‐slcrca:slcrcb double mutant supports the role of tomato CRC paralogues in establishing carpel identity for proper completion of gynoecium and fruit developmental programmes. Furthermore, SlCRCa was differentially up‐regulated in tomato floral buds lacking SlCRCb function, and vice versa, SlCRCb expression significantly increased in the absence of SlCRCa activity. Therefore, an active compensation mechanism of SlCRCa and SlCRCb functions may participate in the regulation of FM determinacy. In support of this hypothesis, transcriptional compensation has been recently described as a means to control meristematic activity in tomato, where the CLV3/embryo‐surrounding region (CLE) ligand paralogues operate to buffer stem cell homeostasis (Rodríguez‐Leal et al., 2019). Hence, the absence of SlCRCa or SlCRCb gene function would trigger an active compensation mechanism involving the up‐regulation of SlCRCb or SlCRCa, respectively, which help to buffer the severity of flower developmental alterations. However, environmental or other genetic factors could lead to a partially compensatory response influencing penetrance and expressivity of phenotypes associated with single mutations at either SlCRCa or SlCRCb loci. Altogether, our results indicate that tomato CRC paralogues operate as positive regulators of FM determinacy by acting in a partially redundant and compensatory manner to ensure normal floral development.
Evolutionary conservation and divergence of CRC gene function in tomato
The role of putative CRC orthologues in FM determinacy and gynoecium development seems to have been conserved across angiosperms (Bowman & Smyth, 1999; Yamaguchi et al., 2004; Fourquin et al., 2005, 2007, 2014; Lee et al., 2005a,b; Nakayama et al., 2010; Bartholmes et al., 2012; Sun et al., 2013; Morel et al., 2018). Nevertheless, specialized functions of CRC‐like genes have been acquired after the evolutionary divergence of their respective plant lineages. Thus, in monocot species such as rice, the CRC orthologue DROOPING LEAF (DL) is also involved in carpel organ identity and plays an essential role in leaf midrib formation, functions that are shared by CRC orthologues from other monocot species (Yamaguchi et al., 2004; Ishikawa et al., 2009; Wang et al., 2009; Nakayama et al., 2010; Strable et al., 2017). Likewise, novel functions in stigmatic cavity formation and ovule initiation have been proposed for the paralogous CRC genes PeDL1 and PeDL2 of the orchid Phalaenopsis equestris (Chen et al., 2021). Within the Solanaceae family, the functional role of CRC paralogues has also been addressed in petunia, where PhCRC1 and PhCRC2 genes, in addition to regulating floral determinacy and carpel development, are required for nectary development acting in a redundant manner to trigger its formation (Morel et al., 2018). PhCRC1 and PhCRC2 showed quasi‐identical expression profiles, which displayed an accumulation of their transcripts in carpel primordia, ovary walls, and style and stigma (Morel et al., 2018), similar to the pattern observed for the tomato CRC paralogues at the beginning of flower development. However, although tomato CRC paralogues play partially redundant roles to ensure normal floral development, they were differentially expressed during flower ontogenesis. Thus, SlCRCa was mainly expressed at the first stage of the flower bud formation, whereas SlCRCb transcripts were detected from young floral buds to flowers at 10 d post‐anthesis, suggesting that their regulatory elements may have diverged. In summary, although fine‐tuning gene regulation events may have favoured gene paralogue speciation, flower and fruit phenotypes of tomato plants lacking SlCRCa and SlCRCb, together with gene expression analyses, provide sufficient evidence about the conserved function of these genes in regulating carpel development and floral determinacy. Indeed, the heterologous expression of either SlCRCa or SlCRCb genes in Arabidopsis crc‐1 background was capable of partially restoring a WT phenotype, supporting the evolutionary ancestral role of CRC‐like genes in promoting floral stem cell termination and carpel formation. However, tomato CRC paralogues were not able to rescue the proper formation of nectaries. Previous studies have reported that CRC gene functions in nectary development appear to be conserved in several core eudicot species, whereas CRC‐like genes are not required for nectary formation in basal angiosperms, which would support the hypothesis that CRC function in nectary specification may be the consequence of CRC neofunctionalization within diverse lineages of core eudicots (Fourquin et al., 2005, 2014; Lee et al., 2005b; Yamada et al., 2011).In Arabidopsis and rice, CRC orthologue genes have also been found to act antagonistically with class B genes in promoting carpel development (Alvarez & Smyth, 1999; Bowman & Smyth, 1999; Yamaguchi et al., 2004). Here, we found that double mutant plants for SlCRCa and SlCRCb loci develop flowers with stamen‐like carpels growing in a reiterating pattern inside the fourth whorl, which strongly hints that tomato CRC paralogues seem to have common functions with the Arabidopsis and rice counterparts as negative regulators of class B genes. Accordingly, a recent research in the Solanaceae family member Physalis floridana has revealed regulatory and genetic interactions between B‐class MADS‐box and CRC genes in a context‐dependent manner during flower development (Gong et al., 2021).
Tomato CRC paralogues are part of the chromatin remodelling complex that represses SlWUS in floral meristems
A complex regulatory network involving signalling cascades, transcriptional regulation, epigenetic mechanisms and hormonal control for FM determinacy has been described in Arabidopsis (Shang et al., 2019). Thus, the function of CRC as regulator of floral determinacy has hitherto been limited to modulate auxin homeostasis by both activating YUC4 and repressing TRN2 gene expression (Yamaguchi et al., 2017, 2018). Our findings reveal a new role for tomato CRC paralogues in balancing floral stem cell proliferation and differentiation, as they can physically bind to the members of the chromatin remodelling complex that drives the epigenetic regulation of SlWUS expression. In this epigenetic silencing mechanism, SlIMA acts as an adaptor protein engaging SlKNU in a complex that involves SlTPL and SlHDA1 leading to SlWUS repression (Bollier et al., 2018). Based on the SlWUS expression profiles in flowers of single and double mutants for SlCRCa and SlCRCb, as well as protein interaction data hereby reported, it seems reasonable to propose a model by which SlCRCa and SlCRCb would act in specifying floral determinacy by binding to the chromatin remodelling complex that ensures the proper spatio‐temporal repression of SlWUS during flower development (Fig. 7). A future challenge will be to assess the role of tomato CRC paralogues in regulating auxin homeostasis, as well as to determine whether CRC interactions are conserved in angiosperm species. Further studies on the degree of conservation or divergence in the molecular mechanism triggering floral determinacy will provide valuable information for crop yield improvement, as the number of carpels in a flower, and consequently the final number of locules forming the mature fruit, plays a key role in regulating fruit size and external fruit quality, important traits in breeding programmes. In conclusion, this research contributes to the ever‐increasing understanding of meristem regulatory pathways that will allow for the development of new knowledge‐driven breeding strategies, whose implementation will in turn significantly contribute to the sustainability of agriculture in the coming decades.
Fig. 7
Proposed model for the function of tomato CRC paralogues in SlWUS repression and the floral meristem determinacy. Tomato CRC paralogues (SlCRCa and SlCRCb), SlIMA and SlKNU interact with SlHDA1 and SlTPL1 to form a chromatin remodelling complex that represses SlWUS expression to terminate floral stem cell activity once carpel primordia are initiated. The blunt‐ended arrow indicates regulatory repression of gene expression. se, sepal; pe, petal; st, stamen; and ca, carpel.
Proposed model for the function of tomato CRC paralogues in SlWUS repression and the floral meristem determinacy. Tomato CRC paralogues (SlCRCa and SlCRCb), SlIMA and SlKNU interact with SlHDA1 and SlTPL1 to form a chromatin remodelling complex that represses SlWUS expression to terminate floral stem cell activity once carpel primordia are initiated. The blunt‐ended arrow indicates regulatory repression of gene expression. se, sepal; pe, petal; st, stamen; and ca, carpel.
Author contributions
LC performed most experimental procedures, prepared figures and co‐wrote the manuscript. EG, BP, BG‐S, AO‐A and RM‐P participated in the experimental research. TA, JC, VM, FJY‐L and RL contributed materials and genetic resources and analysed data. FJY‐L and RL conceived and supervised research and co‐wrote the paper.Fig. S1 Phenotypic details of fig pistils and fruits.Fig. S2 Southern blot and PCR assays of fig plants.Fig. S3 Gene ontology term enrichment analysis.Fig. S4 Microsynteny conservation analyses between genomic blocks containing CRC genes in Arabidopsis and tomato.Fig. S5 Scanning electron micrograph images showing homeotic alterations in flower development of CR‐slcrca:slcrcb double mutant plants.Fig. S6 Bimolecular fluorescence complementation assays on Nicotiana benthamiana leaves.Fig. S7 Transformation of Arabidopsis wild‐type Ler plants with tomato CRC paralogues.Methods S1 Plant material and growth conditions.Methods S2 Optical microscopy and scanning electron microscopy analyses.Table S1 Primer sequences used for SlCRCa genotyping, RNAi and CRISPR/Cas9 assays.Table S2 Primer sequences used for expression analyses.Table S3 Primer sequences used for Arabidopsis thaliana mutant complementation constructs.Table S4 Primer sequences used for cloning into the entry vector pENTR/D‐TOPO the coding sequences of genes tested for subcellular localization and protein–protein interaction assays.Table S5 Floral organ number and fruit characteristics of fig mutant plants.Click here for additional data file.Table S6 Significantly differentially expressed gene list (P
adj < 0.05) for fig floral buds compared to wild‐type ones.Click here for additional data file.Table S7 Functional GO enrichment analysis of differentially expressed genes for fig floral buds compared to wild‐type ones.Please note: Wiley Blackwell are not responsible for the content or functionality of any Supporting Information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.Click here for additional data file.
Authors: Daniel Rodriguez-Leal; Cao Xu; Choon-Tak Kwon; Cara Soyars; Edgar Demesa-Arevalo; Jarrett Man; Lei Liu; Zachary H Lemmon; Daniel S Jones; Joyce Van Eck; David P Jackson; Madelaine E Bartlett; Zachary L Nimchuk; Zachary B Lippman Journal: Nat Genet Date: 2019-04-15 Impact factor: 38.330
Authors: Marta Vazquez-Vilar; Joan Miquel Bernabé-Orts; Asun Fernandez-Del-Carmen; Pello Ziarsolo; Jose Blanca; Antonio Granell; Diego Orzaez Journal: Plant Methods Date: 2016-02-01 Impact factor: 4.993