| Literature DB >> 35154246 |
Ming-Zhong Chen1,2, Xu-Mei Zhong2, Hai-Sheng Lin1, Xiao-Ming Qin1.
Abstract
An increasing attention is being given to treat fruits with ultraviolet C (UV-C) irradiation to extend shelf-life, senescence, and protection from different diseases during storage. However, the detailed understanding of the pathways and key changes in gene expression and metabolite accumulation related to UV-C treatments are yet to be explored. This study is a first attempt to understand such changes in banana peel irradiated with UV-C. We treated Musa nana Laur. with 0.02 KJ/m2 UV-C irradiation for 0, 4, 8, 12, 15, and 18 days and studied the physiological and quality indicators. We found that UV-C treatment reduces weight loss and decay rate, while increased the accumulation of total phenols and flavonoids. Similarly, our results demonstrated that UV-C treatment increases the activity of defense and antioxidant system related enzymes. We observed that UV-C treatment for 8 days is beneficial for M. nana peels. The peels of M. nana treated with UV-C for 8 days were then subjected to combined transcriptome and metabolome analysis. In total, there were 425 and 38 differentially expressed genes and accumulated metabolites, respectively. We found that UV-C treatment increased the expression of genes in secondary metabolite biosynthesis related pathways. Concomitant changes in the metabolite accumulation were observed. Key pathways that were responsive to UV-C irradiation include flavonoid biosynthesis, phenylpropanoid bios6ynthesis, plant-pathogen interaction, MAPK signaling (plant), and plant hormone signal transduction pathway. We concluded that UV-C treatment imparts beneficial effects on banana peels by triggering defense responses against disease, inducing expression of flavonoid and alkaloid biosynthesis genes, and activating phytohormone and MAPK signaling pathways.Entities:
Keywords: UV-C treatment; antioxidant activity; banana storage; flavonoid biosynthesis; hypersensitive response; phenylpropanoid biosynthesis; postharvest treatment
Year: 2022 PMID: 35154246 PMCID: PMC8830439 DOI: 10.3389/fgene.2021.792991
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
FIGURE 1M. nana peel treated with UV-C (0.02 kJ/m2) or without UV-C (CK) for 0, 4, 8, 12, 15, and 18 days.
FIGURE 2Physiological index analyses of banana peel treated with UV-C (0.02 kJ/m2) or without UV-C (CK) for 0, 4, 8, 12, 15, and 18 days. (A) peel decay rate, (B) weight loss rate, (C) cellulase activity, (D) total phenols, (E) total flavonoids, (F) phenylalanine ammonia lyase (PAL) activity, (G) superoxidase dismutase (SOD) activity, (H) peroxidase (POD) activity, (I) 2, 20 -azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), (J) 1,1-diphenyl-2-picrylhydrazyl radical scavenging capacity (DPPH), and (K) ferric reducing antioxidant power (FRAP). The error bars represent standard deviation. The ns, *, and ** show that the differences between UV-C and CK treatments are non-significant, significant, and highly significant, respectively. The blue and orange bars represent CK and UV-C treated banana samples.
FIGURE 3(A) Overall Fragments Per kilobase of Transcript per Million fragments mapped for UV-C treated M. nana (T) and control (CK). (B) Pearson Correlation Coefficient between the UV-C and CK replicates. (C) Heatmap and hierarchical clustering of the expression of differentially expressed genes (DEGs) between UV-C and CK bananas. Differential gene expression between UV-C and CK.
FIGURE 4Differential regulation of phenylpropanoid biosynthesis pathway in M. nana peel under the influence of UV-C irradiation as compared to control. Number in the boxes represent E.C. numbers of the enzymes. Red and green color indicates upregulation and downregulation of genes in response to UV-C treatment.
FIGURE 5Differential regulation of flavonoid biosynthesis pathway in banana peels treated with or without UV-C irradiation. Number in the boxes represent E.C. numbers of the enzymes. Red and green color indicates upregulation and downregulation of genes in response to UV-C treatment.
FIGURE 6qRT-PCR analysis of selected M. nana genes that were differentially expressed in UV-C treated peels (UV-C) as compared to control (CK). The error bars on columns represent the standard deviation.
List of metabolites that were differentially accumulated in Musa nana peel before and after UV-C treatment.
| Compounds | Index | CK (ion intensity) | UV-C (ion intensity) | VIP (variable importance in projection) | Log2FC |
|---|---|---|---|---|---|
| Alkaloids | |||||
| 3-Carbamyl-1-methylpyridinium (1-Methylnicotinamide) | pme1738 | 18,232 | 37,087 | 1.04 | 1.02 |
| Amino acids and derivatives | |||||
| 5-Aminovaleric acid | pme0120 | 9 | 24,860 | 1.67 | 11.43 |
| L-Tryptophan | mws0282 | 2,257,100 | 1,128,307 | 1.58 | -1.00 |
| L-Valyl-L-Phenylalanine | Lmhp002001 | 29,604 | 11,240 | 1.47 | -1.40 |
| Anthocyanins | |||||
| Cyanidin-3-O-(6″-O- | Lmpp003789 | 8,470,067 | 19,123,333 | 1.63 | 1.17 |
| Delphinidin-3-O-(6″-O- | Lmpp003662 | 12,015,000 | 27,235,000 | 1.62 | 1.18 |
| Diterpenoids | |||||
| Cafestol | pme3459 | 25,221 | 61,500 | 1.62 | 1.29 |
| Flavonols | |||||
| 7-O-Galloyltricetiflavan | Lmhn004960 | 20,380 | 57,734 | 1.33 | 1.50 |
| Catechin gallate | mws0355 | 28,317 | 78,391 | 1.17 | 1.47 |
| Epigallocatechin-3-gallate | mws0034 | 62,222 | 1,72,137 | 1.25 | 1.47 |
| Flavonoid | |||||
| Luteolin-7-O-neohesperidoside (Lonicerin) | pmp001079 | 26,332 | 64,707 | 1.65 | 1.30 |
| Hesperetin-8-C-glucoside-3′-O-glucoside* | pmb0618 | 62,916 | 1,38,263 | 1.60 | 1.14 |
| Flavonols | |||||
| 6-Hydroxykaempferol-7-O-glucoside | pmp001309 | 3,419,267 | 6,891,400 | 1.30 | 1.01 |
| Quercetin-3-O-(6″-acetyl)galactoside | Hmln002199 | 1979 | 7,946 | 1.48 | 2.01 |
| Quercetin-7-O-(6″-malonyl)glucoside | pmp000589 | 15,604 | 36,131 | 1.56 | 1.21 |
| Kaempferol-3-O-glucoside-7-O-rhamnoside | Lmsp004670 | 7,849,067 | 19,585,000 | 1.58 | 1.32 |
| Kaempferol-3-O-neohesperidoside* | Lmjp002867 | 7,249,867 | 18,705,333 | 1.61 | 1.37 |
| Quercetin-3-O-apiosyl (1→2)galactoside | Lmtp004044 | 3,513 | 15,564 | 1.01 | 2.15 |
| Quercetin-3-O-glucoside-7-O-rhamnoside | Lmsp004166 | 12,898,333 | 26,437,667 | 1.62 | 1.04 |
| Quercetin-7-O-rutinoside | pmb0711 | 10,995,400 | 24,707,000 | 1.55 | 1.17 |
| Quercetin-3-O-rutinoside (Rutin) | mws0059 | 4,823,300 | 1,1,302,000 | 1.55 | 1.23 |
| 6-Hydroxykaempferol-3,6-O-Diglucoside | pmp001310 | 32,312 | 72,397 | 1.56 | 1.16 |
| Kaempferol-3-O-neohesperidoside-7-O-glucoside | pmp001105 | 1,49,923 | 3,41,013 | 1.63 | 1.19 |
| Quercetin-3-O-rutinoside-7-O-glucoside | Lmmp002334 | 1,90,217 | 4,25,890 | 1.59 | 1.16 |
| Quercetin-3-O-(2‴- | Lmwp004293 | 8,003 | 62,906 | 1.62 | 2.97 |
| Quercetin-3-O-(6″-feruloyl)glucoside-7-O-rutinoside | Lmdp004461 | 5,339 | 12,901 | 1.62 | 1.27 |
| Free fatty acids | |||||
| Palmitoleic Acid | mws0361 | 6,847 | 2,752 | 1.27 | -1.32 |
| 9-Hydroperoxy-10E,12,15Z-octadecatrienoic acid | pmb2791 | 1,26,204 | 15,634 | 1.33 | -3.01 |
| 13S-Hydroperoxy-6Z,9Z,11E-octadecatrienoic acid | pmb2789 | 1,80,035 | 24,968 | 1.30 | -2.85 |
| Glycerol ester | |||||
| PI(18:2/0:0) | Lmqn008369 | 53,432 | 25,019 | 1.65 | -1.09 |
| Others | |||||
| Hydroxyanigorufone | HJAP129 | 3,28,233 | 2,456,067 | 1.59 | 2.90 |
| 3,5,7,4′-Tetrahydroxy-Coumaronochromone | Hmyp002315 | 61,487 | 1,90,140 | 1.64 | 1.63 |
| Phenolic acids | |||||
| Diisooctyl Phthalate | Lmmp010562 | 4,090,667 | 8,67,850 | 1.22 | -2.24 |
| 4- | Zmhn002508 | 9 | 32,638 | 1.67 | 11.82 |
| Di-O-Glucosylquinic acid | Zmhn000785 | 46,582 | 1,14,807 | 1.66 | 1.30 |
| Syringic acid-4-O-(6″-feruloyl) glucoside | pmb0824 | 6,162 | 12,872 | 1.60 | 1.06 |
| Tannin | |||||
| Cinnamtannin A2 | pmn001649 | 11,418 | 5,410 | 1.55 | -1.08 |
| Xanthone | |||||
| 6,8-Dihydroxy-1,2,3-trimethoxyxanthone | pmp001011 | 2,687 | 34,100 | 1.54 | 3.67 |
FIGURE 7(A) Co-joint analyses of DEGs and DAMs between UV-C treated M. nana and CK. (A) KEGG pathway enrichement, (B) nine-quadrant graph, and (C) network diagrams of DAMs and DEGs based on PCC (≥0.8).
List of primers used for qRT-PCR analysis of selected genes in M. nana peel treated with or without UV-C.
| Gene Id | Primer forward sequence (5′-3′) | Primer reverse sequence (5′-3′) |
|---|---|---|
|
| AGTGTTGGCTTTGTCTAT | CGGTTCCATTCTTCTT |
|
| AAGTAGTCCCATTTGTTCT | CAAGGGCTAAGGTTCA |
|
| CAAGCATTGGGATTTT | GTTACCACGGACACGA |
|
| GCCTAAAGGTCCTCTGT | GCTGTCCGTGTCAATC |
|
| TCTATGACTTGGAGGAACA | TGCTGGAACTACTGACG |
|
| ATCCCTTGGCAGTAAA | ATTCGTAAACCCTCAG |
|
| GCCCGTTCACCAAGTC | AAGCCCAAGAGCCAATG |
|
| GGTACAATCGCTCCATC | GAACGCTTTCTCCTCA |
|
| CAGGGTTTATGGAGGG | ACATTCTGGCTTTGGC |
|
| TCCCTGTTTCCACCTC | TTATTTCCTCGGATTCTC |
|
| CTGTCTCCCTTTCGTC | TGATGCCTCAGTGTTG |
|
| GTGCGGCAGAAGTGTC | TTCTTGAATCGGGAGG |
|
| ATGGGTTCAAAAATCTGCTTC | TCAATTAGAATTGACCTTCCTG |
|
| ATGGCTGCAAGAAACCCAT | CTAAGTTTTTGGGTGTTTCCC |
|
| ATGATGTCATTAACCGCCGT | CTACAAAATGGAACAAGCA |
|
| ATGGCCGTACCTTTCGCCAC | TTATCCACGCATGGCAATC |
|
| ATGGCTCAATACGGGAGGCA | CTATGAATTGGTCTTCCTG |
|
| ATGGGAAAAACAGAATTTTG | TCATCTATTGTTAGACAGA |