Literature DB >> 35154140

P311 Facilitates the Angiogenesis and Wound Healing Function of MSCs by Increasing VEGF Production.

Zhihui Liu1,2, Jiacai Yang1,2, Yunxia Chen1,2, Cheng Chen1,2, Jue Wang1,2, Yew Mun Lee3,4, Wenxia Zheng1,2, Ruoyu Shang1,2, Yuanyang Tang1,5, Xiaorong Zhang1,2, Xiaohong Hu1,2, Yong Huang1,2, Shiya Peng6, Yih-Cherng Liou3,4, Weifeng He1,2, Gaoxing Luo1,2.   

Abstract

As a potential clinical therapeutic cell for injured tissue repair, mesenchymal stem cells (MSCs) have attracted increasing attention. Enhancing the pro-healing function of MSCs has gradually become an essential topic in improving the clinical efficacy of MSCs. Recently, studies have shown that neuronal protein 3.1 (P311) plays a crucial role in promoting skin wound healing, suggesting P311 gene modification may improve the pro-healing function of MSCs. In this study, we demonstrated that increasing the in vivo expression of P311 could significantly enhance the ability of MSCs to lessen the number of inflammatory cells, increase the expression of IL10, reduce the levels of TNF-α and IFN-γ, increase collagen deposition, promote angiogenesis, and ultimately accelerate skin wound closure and improve the quality of wound healing. Importantly, we uncovered that P311 enhanced the pro-angiogenesis function of MSCs by increasing the production of vascular endothelial growth factor (VEGF) in vitro and in vivo. Mechanistically, we revealed that the mTOR signalling pathway was closely related to the regulation of P311 on VEGF production in MSCs. Together, our data displayed that P311 gene modification in MSCs augments their capabilities to promote skin wound closure, which might bring the dawn for its clinical application in the future.
Copyright © 2022 Liu, Yang, Chen, Chen, Wang, Lee, Zheng, Shang, Tang, Zhang, Hu, Huang, Peng, Liou, He and Luo.

Entities:  

Keywords:  MSCs; P311; VEGF; angiogenesis; m-TOR signaling pathway; wound healing

Mesh:

Substances:

Year:  2022        PMID: 35154140      PMCID: PMC8831272          DOI: 10.3389/fimmu.2022.821932

Source DB:  PubMed          Journal:  Front Immunol        ISSN: 1664-3224            Impact factor:   7.561


Introduction

Skin wounds caused by various injuries, such as trauma, burns and diabetes mellitus, are a current clinical problem in urgent need of solutions. Mesenchymal stem cells (MSCs) are multipotent stem cells capable of differentiating into osteoblasts, chondrocytes, adipocytes, endothelial cells, and fibroblasts under certain conditions (1). In addition, MSCs can differentiate into multi-lineage cells and have enormous therapeutic potential for osteoporosis, neurogenesis and organ damage (2–5). Furthermore, a growing body of evidence has demonstrated that MSCs can also promote cutaneous wound healing through accelerating re-epithelisation, improving inflammatory response and facilitating collagen deposition following skin injury (6–8). Neuronal protein 3.1 (also named P311), a conserved RNA-binding intracellular protein, is a small polypeptide containing only 68 amino acids, with a molecular mass of 8 -kDa. P311 was first identified by Studler and his colleagues (9), using a differential screening in comparing striatal cells from two different embryonic stages of brain development. Studies have recently demonstrated P311 to be a multifunctional protein that is highly involved in embryonic development, regeneration, and human disease (10, 11). In addition, by utilising a skin excision mouse model, our group has previously demonstrated that P311 gene knock-out mice displays a series of phenotypes including delayed wound healing and fewer vessel numbers, suggesting that the deficiency of P311 gene highly affects angiogenesis during wound healing (12). Moreover, we also revealed that P311 could facilitate cutaneous wound re-epithelialisation by promoting the migration of EpSCs through RhoA and Rac1 activation (13). Furthermore, we also demonstrated that P311 induced the trans-differentiation of epidermal stem cells to myofibroblast-like cells by stimulating transforming growth factor β1 (TGFβ) expression for accelerating wound repair; loss of P311 attenuates angiogenesis in cutaneous wound healing (14). These studies have shed light on the role of P311 in functioning myofibroblast differentiation, angiogenesis, and re-epithelialisation after cutaneous injury; however, the effect of P311 on the pro-healing function of MSCs has not yet been well-elucidated. Angiogenesis, established by a pre-existing vascular network, is a fine-tuned biophysiological process involved in cell proliferation and migration. Additionally, in the phase of proliferation, angiogenesis is a critical procedure for wound repair (15). Endothelial cells (ECs) constitute the intima layer of the microvessels and are indispensable cells in vascular lumen formation (16). Angiogenesis is also believed to depend on a dynamic balance between endogenous stimulators and inhibitors (17). Positive regulators of angiogenesis include members of the vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), transforming growth factor (TGF), tumour necrosis factor (TNF), angiogenin, and interleukin (IL)-8. Moreover, it is also believed that angiopoietin is vital for the formation of new blood vessels in tumorigenesis, cutaneous injury and tissue regeneration (18). Among these pro-angiogenic factors, VEGF, a homodimeric protein, is generally thought to be a primary and potential regulator of angiogenesis under normal or abnormal conditions (19). Supported by a study using P311 knockout mice, the authors demonstrated that the loss of P311 would significantly increase the number of cutaneous microvessels (12). However, how P311 governs angiogenesis through regulators such as VEGF has not been extensively investigated. In the present study, we first explored the effect of MSCs overexpressed with P311 on skin wound healing both in vitro and in vivo. Our data demonstrated that P311 could increase the pro-angiogenesis function of MSCs by boosting the production of VEGF. Mechanistically, we further highlighted that the mTOR signalling pathway was closely related to P311-mediated regulation of VEGF production. Collectively, our data revealed for the first time that MSCs with increased P311 expression had enhanced capabilities in facilitating wound closure. Our study sheds new light on the novel regulatory mechanism of P311 on the pro-angiogenesis and pro-healing functions of MSCs. It might provide a new direction for their clinical and therapeutical applications on cutaneous wound healing.

Materials and Methods

Animals

All C57BL/6 mice (male, 6-8 weeks old) used for the experiments were age- and sex-matched and were purchased from the Experimental Animal Department of Army Medical University (Third Military Medical University, Chongqing, China) with animal license. All animal procedures were approved by the Animal Ethics Committee of the Army Military Medical University, Chongqing, China.

Cell Culture and Treatment

Three-week mice were sacrificed, and MSCs derived from bone marrow were isolated using previously described protocols (20). MSCs were cultured and expanded in MSCM supplement with 5% foetal bovine serum (ScienCell Research Laboratories, USA), 1% penicillin/streptomycin (P/S) solution and 1% mesenchymal stem cell growth supplement and (ScienCell Research Laboratories, USA) at 37°C with 5% CO2. Subsequently, flow cytometry analysis (FCAS) was performed to verify the purity of MSCs, which were used for all experiments when characterised by the expression of CD29 (Cy5.5-labelled), CD44 (BV510-labelled) and CD90 (SB600-labelled) > 95%, and the expression of CD11b (eFluor® 450-labelled) < 2%. Expanded MSCs were infected with lentivirus containing green fluorescent protein (GFP), purinomycin resistance gene, P311 and 1-KDa tag (referred to as MSCsP311) or control vehicle (referred to as MSCsCtrl), and selected with 10nM puromycin as previously described (21). Infection efficiency was determined by monitoring fluorescent signals under the microscope or FCAS. The expression levels of P311 were measured and quantified by qRT-PCR and Western blotting. P311-modified MSCs were verified for cell surface antigens mentioned above through FCAS. Additionally, MSCsP311 were transfected with a plasmid containing VEGF si-RNA (referred to as MSCsP311+si-VEGF) or a control vehicle (referred to as MSCsP311+si-Ctrl) as previously described (22). The expression levels of VEGF were detected by Western blot and qRT-PCR. The sequences of the siRNA were as follows: si‐VEGF, 5′‐GGAUCAAACCUCACCAAAGTT‐3′ (sense) and 5′‐CUUUGGUGAGGUUUGAUCCTT‐3′ (anti–sense). Cultured MSCsP311 were pre-treated with 4nM rapamycin (referred to as MSCsP311+Rap) (Selleck, USA), LY2584702 (referred to as MSCsP311+LY258) (Selleck, USA), 500nM LY294002 (referred to as MSCsP311+LY294) or DMSO (referred to as MSCsP311+DMSO) for 24 hours before experiments. Endothelial cells derived from mice brain microvessels (ECs) and fibroblasts derived from mice embryo (MEFs) were purchased from the ATCC (USA) and cultured in DMEM medium containing 10% FBS (Hyclone, USA) and 1% P/S solution at 37°C with 5% CO2.

Characterization of Differentiation Ablity for MSCs, MSCsCtrl and MSCsP311

Briefly, 2×104 cells/cm2 (MSCs, MSCsCtrl and MSCsP311) were seeded into a sterile 6-well plate. For osteogenesis differentiation, these three cells were cultured in osteogenic induction and differentiation medium (Cyagen, China) supplement with 10% foetal bovine serum (Cyagen, China) and 1.5% supplement of osteogenic differentiation (Cyagen, China) at 37°C under 5% CO2. For chondrogenic differentiation, all cells were incubated in chondrogenic induction and differentiation medium (Cyagen, China) supplement with 10% foetal bovine serum (Cyagen, China) and 1.5% supplement of adipogenic differentiation (Cyagen, China) at 37°C under 5% CO2. The complete medium was changed every three days within two weeks. These induced cells were stained using alizarin red (Cyagen, China) or oil red O solultions (Cyagen, China), and taken pictures under a microscope (Olympus).

Preparation of Full-Thickness Excision Wound Model and Treatment

The hair on the dorsal surface of the mouse was removed one day before the experiment. The mice were intraperitoneally injected with 1% pentobarbital (Sigma, USA) (0.5-1.0 mL/100g of body weight) for anesthesia. After disinfecting with 75% ethyl alcohol, a full-thickness excisional wound (1 cm in diameter) was carried out on both sides of the dorsal skin. A total of 1×106 cells (MFBs, MSCs, MSCsCtrl, MSCsP311, MSCsP311+Si-Ctrl or MSCsP311+Si-VEGF) were subcutaneously injected into four sites around the wound in the mice. Then, the wound area was photographed, and pictures from the wounds were taken at equal intervals of 0, 5, 7 and 9 days post-injury, respectively. The area of wound healing was measured using the ImageJ Pro-Plus software (NIH, USA), and the wound-healing percentage was calculated using the following formula: where: AWi represents the area of the initial wound (the actual size after wound creation), and AWn represents the area of the wound at different time points post-injury. All wounds were uncovered, and mice were individually assigned into sterile bedding.

Hematoxylin and Eosin (H&E) Staining

Mice were sacrificed via intraperitoneal injection of 1% pentobarbital (5.0 mL/100g of body weight). The wound tissues were then harvested on the 3rd, 5th, 7th, and 9th day post-injury. Furthermore, the intact skin tissues were also harvested as a normal control group (referred to as Normal). All specimens were immediately fixed, embedded, and sectioned. Subsequently, the sections were deparaffinised, hydrated and stained with hematoxylin and eosin (H&E). The newly formed epidermis, granulation tissue, microvessels and inflammatory cell infiltration around the wound were observed under a full slide scanning microscope (VS200, Olympus). The vascularisation from the undersurface wounds was viewed by digital photographs.

Masson, Sirius Red and Reticular Staining

To evaluate the healing quality, the total collagens, collagens of type I and III and reticular fibers were stained. Briefly, the paraffin sections were deparaffinised, hydrated and stained by corresponding kits according to the manufacturer’s protocol. The collagen fibres were stained with a Masson staining kit; the collagen type I and III were stained with a Sirius red staining kit; the reticular fibres were stained with a reticular fibre staining kit. All staining kits were purchased from Beijing Solaibao Technology of China. The previous staining sections were observed and photographed under a full slide scanning microscope. The expression levels of total collagens, collagens of type I and III, and reticular fibers were quantified by calculating average optical density (AOD) using the Image J Pro-Plus software (NIH, USA). The data of MSCs group were normalized for analysing the relative expression levels of MSCsCtrl and MSCsP311 groups.

Immunohistochemical Staining

The indicated paraffin sections were deparaffinised, hydrated, blocked and incubated with the primary antibody at 4°C overnight. The sections were then incubated with biotinylated goat-anti-rabbit IgG antibody (ZSGB-BIO, China) for 60 minutes at room temperature and followed with the incubation of avidin peroxidase reagent (ZSGB-BIO, China) for 15 minutes. Afterwards, the counterstaining was carried out with hematoxylin (Beyotime, China) and taken photos under a full slide scanning microscope (Olympus, Japan). The primary antibodies were as follows: anti-IFN-γ (1:200), anti-TNF-α (1:200), anti-VEGF (1:200), anti-IL-10 (1:200), anti-CD31 (1:200). All primary antibodies were purchased from Abcam (UK).

Cell Proliferation Assay

For MSC proliferation, 5×103 cells/well (MSCs, MSCsCtrl and MSCsP311) were seeded onto a 96-well plate and cultured for 1, 3 and 5 days, respectively. Ten µL/well CCK8 solution (Dojindo, Japan) was added and incubated for two hours in the dark. The absorbance was then measured at 450 nm with a microplate reader. For EC proliferation, ECs were seeded at 4×104 cells/well on a 24-well plate and co-cultured for 1, 3 and 5 days together with 1×104 cells (MSCs, MSCsCtrl, MSCsP311, MSCsP311+Si-Ctrl or MSCsP311+si-VEGF) seeded into the transwell-insert upper chambers with a pore size of 0.4 µm (Merck, GER). The cell proliferation rate of the ECs at overall cellular levels was analysed using the CCK8 assay. A total of 10 µL of CCK8 solution was added to each well and incubated. The co-incubated solution was then transferred to a 96-well plate, and the absorbance was measured at 450 nm. In addition, the proliferation of ECs at the single-cell level was detected using an EdU detection kit (Beyotime, China), according to the manufacturer’s protocol. Briefly, the ECs were fixed, permeabilised, blocked and stained using a 1× DAPI solution containing an anti-fluorescence quenching agent (Beyotime, China). The fluorescent signal of the ECs was subsequently measured using a fluorescence microscope.

Cell Motility Assay

For MSC invasion assay, 4×104 cells/well (MSCs, MSCsCtrl and MSCsP311) were seeded to the transwell-insert upper chamber with a pore size of 8 µm (Merck, GER) using a complete MSCM medium and cultured for 12 hours, while the lower chamber was added with serum-free MSCM medium. For EC invasion assay, 1×104 cells/well cells (MSCs, MSCsCtrl, MSCsP311 or MSCsP311+si-VEGF) were seeded into a 24-well plate and cultured with serum-free MSCM medium and co-cultured for 12 hours with 4×104 ECs/well grown in the transwell-insert upper chamber with a pore size of 8 µm. Briefly, these inserts were stained for 10 minutes with 1% crystal violet reagent (Beyotime, China), and the uninvaded cells were wiped gently with a cotton swab. After washing three times with PBS and drying, the membrane in the inserts was harvested and fixed into a glass slide using a neutral resins reagent (ZSGB-BIO, China). The images of invasive ECs were photographed using an optical microscope. For EC migration, ECs were cultured on a 24-well plate, and the cells were scratched with a sterile pipette tip when cells reached about 80% confluent. The cells were then co-cultured with MSCs, MSCsCtrl, MSCsP311 or MSCsP311+si-VEGF for 24 hours using the transwell system as described above. The scratched wounds were observed under a phase-contrast microscope (Olympus, Japan), and the percentage of cell migration was calculated by analysing the scratch area using Image-Pro Plus software.

Matrigel Assay

Briefly, Matrigel (BD, USA) was diluted using DMEM medium as 1:1 ratio for angiogenesis experiments. 4×104/well ECs were seeded on a 24-well plate coated with Matrigel and co-cultured with 1×104 cells (MSCs, MSCsCtrl, MSCsP311 or MSCsP311+si-VEGF) that were seeded in the transwell insert with a pore size of 0.4 µm. After co-incubation for 6 hours, the images were obtained with an optical microscope, and the number of tube-like structures and branching points were calculated by Image-Pro Plus software.

Immunofluorescence Assay

The respective 4×104 cells/well cells (MSCs, MSCsCtrl, MSCsP311, MSCsP311+DMSO, MSCsP311+Rap, MSCsP311+LY258) were seeded at 4×104 cells/well onto a 24-well plate. The indicated cells were fixed, permeabilised, blocked and incubated overnight with the primary anti-VEGF antibody (1:200, Abcam, UK) at 4°C. Subsequently, the cells were incubated with secondary antibodies (1:500, ZSGB-BIO, China) for 1 hour at room temperature. Then, the cell slides were washed using 1×PBS and stained with 1× DAPI solution containing an anti-fluorescence quencher (Beyotime, China). The images were obtained under a confocal microscope (SpinRC10, Olympus).

ELISA Assay

For cells, the cultural supernatant derived from MSCs, MSCsCtrl, MSCsP311, MSCsP311+DMSO, MSCsP311+Rap, MSCsP311+LY258 and MSCsP311+LY294 was collected, and the contents of VEGF in the supernatant were detected using an ELISA detection kit (Reddot Biotech, Canada) according to manufacturer’s protocols. For tissues, the wound tissues were harvested from mice with MSCs, MSCsCtrl, MSCsP311, MSCsP311+si-Ctrl and MSCsP311+si-VEGF treatment on the 3rd, 5th, 7th and 9th day. Then, the specimens were lysed by RIPA lysis buffer on ice. The contents of VEGF, hydroxyproline, type I and III collagens (KRISHGEN BioSystems, USA), IFN-γ, TNF-α (U-CyTech, Netherlands) and IL-10 (Reddot Biotech, Canada) in tissues were measured by an enzyme-linked immunosorbent (ELISA) assay.

Western Blot

Briefly, cells (MSCs, MSCsCtrl, MSCsP311, MSCsP311+DMSO, MSCsP311+Rap, MSCsP311+LY258, MSCsP311+LY294, MSCsP311+si-Ctrl, MSCsP311+si-VEGF) and wound tissues (MSCs, MSCsCtrl, MSCsP311) were lysed with ice-cold 1× RIPA lysis buffer containing a protease/phosphatase inhibitor cocktail (Beyotime, China) and quantified using a BCA kit (Thermo Fisher, USA). A total of 20 µg protein for each specimen was resolved by standard SDS-PAGE electrophoresis and transferred to a 0.22 µm PVDF membrane. After blocking with 1 × TBS-T containing 5% non-fat milk, the PVDF membrane was incubated overnight at 4°C with the following primary antibodies: anti-VEGF (1:1000, Abcam, UK), anti-Tag (1:1000, CST, USA), anti-mTOR (1:1000, CST, USA), anti-p-mTORSer2448 (1:1000, CST, USA), anti-PI3K (1:1000, CST, USA), anti-p-PI3KTyr458 (1:1000, CST, USA), anti-AKT (1:1000, CST, USA), anti-p-AKTSer473 (1:1000, CST, USA), anti-P70S6K (1:1000, CST, USA), anti-p-P70S6KSer424 (1:1000, CST, USA), anti-4EBP1 (1:1000, CST, USA), anti-p-4EBP1Ser65 (1:1000, CST, USA) and anti-GAPDH (1:1000, CST, USA). The PVDF membrane was then incubated with a corresponding horseradish peroxidase-conjugated secondary antibody (Beyotime, China) at room temperature for one hour. The chemical signal was detected using a chemiluminescent reagent (Advansta, USA).

Real-Time Quantitative PCR

Briefly, 5×105 cells/well (MSCs, MSCsCtrl and MSCsP311) were seeded and cultured on a 6-well plate, and the total RNAs in cells was extracted by TRIzol® reagent (Thermo Fisher Scientific, USA). The reverse transcription was performed to obtain cDNA using reverse transcription kit (TOYOBO, Japan). The expression of P311 and VEGF mRNA was quantified by real-time quantification PCR (qRT-PCR), respectively. The primers used were listed as follows: P311 5′-3′ (forward) CCGTGCCTAAGGAAGTGAACCG, 5′-3′ (reverse) GGAGGTAACTGGTAGCTGGAGAGG; VEGF 5′-3′ (forward) GAGGGCAGA ATCATCACGAAGT, 5′-3′ (reverse) TCCTAT GTGCTGGCCTTGGTGA.

Statistical Analysis

All data from three reduplicative experiments were presented as mean ± SD. The statistical differences were calculated by one-way ANOVA or two-way ANOVA using the GraphPad 8.0.1 version software (USA). The graphs were prepared using the GraphPad Prism 8.0.1 version software. P<0.05 was considered statistically significant.

Results

P311 Enhances the Capability of MSCs-Mediated Skin Wound Repair

Previous studies demonstrated that P311 plays essential regulatory roles in skin wound healing, while exogenous administration of MSCs was beneficial to skin wound repair (12, 23). Therefore, to determine how P311 could affect MSCs healing functions, we first determined the expression of makers and the differentiation capacity for MSCs. The results showed the positive expression for CD29, CD44 and CD90, and negative expression for CD11B ( ), and differentiation into osteocytes and adipose cells ( ), suggesting the expanded MSCs were of sound purity. Subsequently, we intended to investigate whether P311 could up-regulate the pro-healing function of MSCs. We verified that MSCsP311, rather than MSCs and MSCsCtrl, had a higher P311 expression at both protein and mRNA levels ( ), indicating that P311-overexpressed MSCs were successfully established. We then utilised a murine full-thickness wound model and exogenously administered MEFs, MSCs, MSCsCtrl, or MSCsP311 at day 0 post-injury. We recorded the skin wound area at 0, 5, 7, 9 days post-injury and analysed the kinetics of the cutaneous wound healing. The data showed that mice treated with MSCs markedly improved wound healing compared to mice with MEFs treatment. Mice administrated with MSCsP311, but not MSCsCtrl, significantly promoted skin wound repair, as compared to mice treated with MSCs (5, 7 and 9 days post-injury; MSCsP311 vs MSCs; MSCsCtrl vs MSCs) ( ), suggesting that P311 enhances the ability of MSCs-mediated promotion of wound healing. Moreover, re-epithelialisation and granulation tissue formation, which are critical key aspects in controlling skin wound healing, were further evaluated by detecting the length and thickness of the neo-epithelial tongue and the area of granulation tissue at 9 days post-injury ( ). Compared to mice administered with control MSCsCtrl, the mice treated with MSCsP311 had a marked increase both in length ( ) and thickness ( ) of tongue epithelium and a two-fold increase in the area of granulation tissues ( ). Collectively, these data demonstrate that P311 not only enhances wound healing but also elevates the capability of MSCs-mediated promotion of skin wound repair.
Figure 1

P311 could enhance the capability of MSCs-mediated promotion of skin wound repair. Full-thickness wounds were created on both sides of the dorsal skin in sex- and age- matched C57BL/6 mice. Wound closure kinetics in mice subcutaneously injection with 1×106 MEFs, MSCs, MSCsCtrl or MSCsP311 after wounding immediately (n=3/group) was analysed. (A, B) Representative photos of wounds on 5, 7 and 9 days post-wounding were shown (left panel). The open wound area was normalised to 1cm-diameter yellow circle which was the same size as the area of wound on day 0, and wound closure curve was statistically analysed (right panel). (* means MEFs vs MSCs) (C–E) The re-epithelialisation of wounds on day 7 post-excision was determined by H&E staining in mice with MSCs, MSCsCtrl, or MSCsP311 administration (n=3/group). Representative H&E images of re-epithelialisation were shown, and the distance between ends of neo-epithelium (black arrows), the length (red solid line) and thickness (yellow dotted line) of neo-epithelial tongue were statistically analysed, respectively. Scale bar: 200 µm. (F, G) Representative Masson images of granulation tissue were shown, and the expression of total collagen with blue staining was statistically analysed. Scale bar: 50 µm. (H) The contents of HYP were examined and analysed in wound tissues. Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; *P < 0.05, **P < 0.01; ***,###P < 0.001).

P311 could enhance the capability of MSCs-mediated promotion of skin wound repair. Full-thickness wounds were created on both sides of the dorsal skin in sex- and age- matched C57BL/6 mice. Wound closure kinetics in mice subcutaneously injection with 1×106 MEFs, MSCs, MSCsCtrl or MSCsP311 after wounding immediately (n=3/group) was analysed. (A, B) Representative photos of wounds on 5, 7 and 9 days post-wounding were shown (left panel). The open wound area was normalised to 1cm-diameter yellow circle which was the same size as the area of wound on day 0, and wound closure curve was statistically analysed (right panel). (* means MEFs vs MSCs) (C–E) The re-epithelialisation of wounds on day 7 post-excision was determined by H&E staining in mice with MSCs, MSCsCtrl, or MSCsP311 administration (n=3/group). Representative H&E images of re-epithelialisation were shown, and the distance between ends of neo-epithelium (black arrows), the length (red solid line) and thickness (yellow dotted line) of neo-epithelial tongue were statistically analysed, respectively. Scale bar: 200 µm. (F, G) Representative Masson images of granulation tissue were shown, and the expression of total collagen with blue staining was statistically analysed. Scale bar: 50 µm. (H) The contents of HYP were examined and analysed in wound tissues. Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; *P < 0.05, **P < 0.01; ***,###P < 0.001). Exogenous administration of MSCs could enhance collagen deposit to improve the quality of skin wound healing (24). Therefore, to access the effects of P311 on MSCs-mediated improvement of the skin healing quality, we examined the collagen deposition and fibre formation in granulation tissues of mice treated with MSCs, MSCsCtrl, or MSCsP311. We determined the collagen deposit of granulation tissues at 9 days post-injury using Masson staining and ELISA. Our results showed that MSCsP311, but not MSCsCtrl, significantly increased the expression levels of total collagen ( ) and amounts of hydroxyproline (HYP) ( ) in the wound tissues. Furthermore, to investigate the effects of P311 on the biological composition of collagen, the levels of type I and III collagen, and collagen fibre formation in granulation tissues of the wound tissues were detected and analysed using ELISA, Sirius red staining and Reticular staining, respectively. Our results showed that administration of MSCsP311, rather than MSCs and MSCsCtrl, markedly elevated the expression of type I and III collagen ( ) and the levels of type I and III collagen fibres ( ) in the wound tissues. Subsequently, utilising the reticular fibre staining assay, we further examined the reticular fibres in granulation tissues of wounds, and found that there were approximately 1.3-1.5 times increment of the reticular fibres at 9 days post-injury in mice with MSCsP311 treatment, compared to mice treated with MSCs or MSCsCtrl ( ). Collectively, these data strongly suggest that P311 enhances the MSCs-mediated enhancement of the wound healing quality.

P311 Enhances the Capability of MSCs-Mediated Improvement of Inflammatory Microenvironment in Skin Wound Tissues

Improving the immune microenvironment is one of the critical mechanisms for MSCs promoting skin wound healing (25). To evaluate the impact of P311 on MSCs-mediated immune microenvironment improvement, we examined the inflammatory cell infiltration, and the levels of pro-inflammatory and anti-inflammatory cytokines in the wound tissues of animals administered with MSCs, MSCsCtrl, or MSCsP311. We detected the infiltration of inflammatory cells in granulation tissues at 3, 5, 7 and 9 days post-wounding by H&E staining. Our results showed that MSCsP311, but not MSCs and MSCsCtrl, significantly reduced the number of inflammatory cells in granulation tissues on day 3 and 5 ( and ), while there has no obvious difference in granulation tissues on day 7 and 9 ( ). Moreover, to investigate the function of P311 in regulating the levels of pro-inflammatory and anti-inflammatory cytokines in wound tissues on the 3th day, the production of IFN-γ, TNF-α and IL-10 in the wound tissues were subsequently measured using IHC and ELISA assays. Our data showed that MSCsP311, but not MSCs and MSCsCtrl, markedly decreased the production of pro-inflammatory cytokines IFN-γ by 2.5-fold and TNF-α by 2.5-fold ( ) in wound tissues. On the other hand, the expression of anti-inflammatory cytokine IL-10 was dramatically elevated in the wound tissues by approximately 2.5 folds in the MSCsP311, but not MSCs and MSCsCtrl, treated mice at 3 days post-wounding, as compared to mice with the treatment of MSCs or MSCsCtrl ( ). In summary, these data demonstrate that P311 strengthens the improvement of the immune microenvironment mediated by MSCs during the process of skin wound closure.
Figure 2

P311 enhances the capability of MSCs-mediated improvement of inflammatory microenvironment in skin wound tissues. The immunological microenvironment of wound tissue was evaluated at day 3 post-injury by detecting the infiltration of inflammatory cells, production of pro-inflammatory cytokines, and expression of anti-inflammatory cytokine in normal mice and mice with MSCs, MSCsCtrl, MSCsP311 administration (n=3/group). The inflammatory cell infiltration in granulation tissues was examined by H&E staining. (A, B) Representative H&E images of granulation tissues were shown (left panel), and inflammatory cells per visual field were counted and statistically analysed (right panel). Scale bar: 50 µm. (C–F) Representative immunohistochemical images of IFN-γ and TNF-α in granulation tissues were shown (left panel), and the expression of IFN-γ and TNF-α was statistically analysed (right panel). Scale bar: 50 µm. (G, H) Representative immunohistochemical images of IL-10 in granulation tissues were shown (black arrows) (left panel), and the expression of IL-10 was statistically analysed (right panel). Scale bar: 50 µm. Supernatants of wound tissue extract at day 3 post-injury were applied for identifying the content of IFN-γ (I) and TNF-α (J) in mice with MSCs, MSCsCtrl, MSCsP311 treatment by means of ELISA. (K) Supernatants of wound tissue extracted at day 3 post-injury were applied for identifying the contents of IL-10 in mice with MSCs, MSCsCtrl, MSCsP311 treatment by means of ELISA. Scale bar: 50 µm. Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; *P < 0.05, **p < 0.01; ***p < 0.001).

P311 enhances the capability of MSCs-mediated improvement of inflammatory microenvironment in skin wound tissues. The immunological microenvironment of wound tissue was evaluated at day 3 post-injury by detecting the infiltration of inflammatory cells, production of pro-inflammatory cytokines, and expression of anti-inflammatory cytokine in normal mice and mice with MSCs, MSCsCtrl, MSCsP311 administration (n=3/group). The inflammatory cell infiltration in granulation tissues was examined by H&E staining. (A, B) Representative H&E images of granulation tissues were shown (left panel), and inflammatory cells per visual field were counted and statistically analysed (right panel). Scale bar: 50 µm. (C–F) Representative immunohistochemical images of IFN-γ and TNF-α in granulation tissues were shown (left panel), and the expression of IFN-γ and TNF-α was statistically analysed (right panel). Scale bar: 50 µm. (G, H) Representative immunohistochemical images of IL-10 in granulation tissues were shown (black arrows) (left panel), and the expression of IL-10 was statistically analysed (right panel). Scale bar: 50 µm. Supernatants of wound tissue extract at day 3 post-injury were applied for identifying the content of IFN-γ (I) and TNF-α (J) in mice with MSCs, MSCsCtrl, MSCsP311 treatment by means of ELISA. (K) Supernatants of wound tissue extracted at day 3 post-injury were applied for identifying the contents of IL-10 in mice with MSCs, MSCsCtrl, MSCsP311 treatment by means of ELISA. Scale bar: 50 µm. Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; *P < 0.05, **p < 0.01; ***p < 0.001).

P311 Enhances the Capability of MSCs-Mediated Vascularization

To check whether P311 can affect the stemness of MSCs, we examined several MSC cell surface markers and differentiation capacity, including CD11B, CD29, CD44, CD90, osteogenesis and adipogenesis differentiation, and found that MSCsCtrl and MSCsP311, owning the abilities of differentiation into osteocytes and adipose cells ( ), have a similar expression level to MSCs ( ), suggesting P311 has a minimal effect on the stemness of MSCs. However, we observed that MSCsP311 displayed a significantly higher migration rate by a transwell assay ( ), and proliferation, as determined by a cell counting assay at OD450 nm ( ), indicating that P311 can promote the migration and proliferation of MSCs. The ability of proliferation, mobility, and tube-like structure formation on vascular endothelial cells are the cytological basis of angiogene (26). To further investigate the regulatory roles of P311 on the MSCs-mediated pro-angiogenesis, we established a transwell co-incubation system of ECs and MSCs to evaluate the effects of P311 on the MSCs-mediated proliferation, migration, and tube-like structure forming ability of ECs in vitro. We then examined the ECs proliferation at the single-cell and overall levels using EdU incorporation and cell counting assays at OD450 nm, respectively. As shown in , at the single-cell level, there were 76% of MSCsCtrl co-incubated ECs displayed EdU-positive cells, compared to approximately 27% of EdU-positive cells in both MSCs and MSCsCtrl co-incubated ECs ( ). Similarly, the MSCsP311 co-incubated ECs have approximately 1.6 folds significant higher viability on day 5, when compared to that of MSCs and MSCsCtrl co-incubated ECs ( ). Collectively, these results suggest that P311 can promote MSCs-mediated cell proliferation of ECs. To characterise the role of P311 in promoting cell mobility, we examined the function of P311 on the mobility of ECs at 24 hours after co-incubation with MSCs, MSCsCtrl or MSCsP311 by utilising the transwell invasion and scratch migration assays. Compared to the controls MSCs and MSCsCtrl, we found that co-incubation with MSCsP311 can increase the ability of ECs invasion by approximately 82% (or 1.82 folds) ( ). Likewise, the results of the scratch migration assays also showed MSCsP311 co-incubation can enhance the migration of ECs by approximately 76% (or 1.76 folds) in comparison to ECs co-incubated with MSCs and MSCsCtrl ( ). Furthermore, to access P311 function on angiogenic signalling by MSCs through the ability of ECs to divide and migrate, we utilised the matrigel assays with a transwell co-culture system and then analysed the tube-like formation structure of ECs co-incubated with MSCs, MSCsCtrl or MSCsP311. As shown in , our results demonstrated that expression of P311, but not the control vector, obviously promoted the formation of capillary-like structures of the ECs; in ECs co-incubated with MSCsP311, both total loops and total branching points of the capillary-like structures were increased by 2 folds and 2.3 folds, respectively, compared to co-inhibition with MSCs and MSCsCtrl. Taking all these results together strongly indicate that P311 plays a vital role in promoting the tube-like structure formation of MSCs in vitro.
Figure 3

P311 enhances the capability of MSCs-mediated tube-like structure formation. (A–C) The effect of MSCs, MSCsCtrl, MSCsP311 on the proliferation of ECs was evaluated by using transwell co-culture system (0.4 µm pore size). 4×104 ECs seeded on the lower chamber were co-cultured with 1×104 MSCs, MSCsCtrl, MSCsP311 seeded on the upper chamber. (A, B) The proliferation of ECs was examined at single cell levels by EdU assays at 24 hours after co-incubation. Scale bar: 100 µm. (C) Cell viability of ECs was detected by CCK8 assays on 1, 3 and 5 days after co-incubation. (D–G) The effect of MSCs, MSCsCtrl, MSCsP311 on migration and invasion abilities of ECs was evaluated by means of scratch and transwell assays. (D, E) The invasion of ECs at 24 hours after co-incubation was examined by transwell assays (8-µm pore size). Scale bar: 200 µm. (F, G) The migration of ECs at 24 hours after co-incubation was detected by scratch assays with transwell co-culture system (0.4-µm pore size). Scale bar: 200 µm. (H–J) The effect of MSCs, MSCsCtrl and MSCsP311 on tube-like structure formation of ECs was evaluated by Matrigel assays with transwell co-culture system (0.4-µm pore size). ECs on 24-well plates supplement with Matrigel were co-cultured with MSCs, MSCsCtrl or MSCsP311 on transwell insert with 0.4-µm pore size. The formation of tube-like structure was photographed under optical microscope. Representative images for the formation of tube-like structure and statistical analysis were shown. Scale bar: 200 µm. MSCs group: MSCs + ECs; MSCsCtrl group: MSCsCtrl + ECs; MSCsP311: MSCsP311 + ECs. Scale bar: 50 µm. Data are representative of at least three independent experiments and represent mean ± SD. (ns, no statistical significance; *P < 0.05; **P < 0.01; ***P < 0.001).

P311 enhances the capability of MSCs-mediated tube-like structure formation. (A–C) The effect of MSCs, MSCsCtrl, MSCsP311 on the proliferation of ECs was evaluated by using transwell co-culture system (0.4 µm pore size). 4×104 ECs seeded on the lower chamber were co-cultured with 1×104 MSCs, MSCsCtrl, MSCsP311 seeded on the upper chamber. (A, B) The proliferation of ECs was examined at single cell levels by EdU assays at 24 hours after co-incubation. Scale bar: 100 µm. (C) Cell viability of ECs was detected by CCK8 assays on 1, 3 and 5 days after co-incubation. (D–G) The effect of MSCs, MSCsCtrl, MSCsP311 on migration and invasion abilities of ECs was evaluated by means of scratch and transwell assays. (D, E) The invasion of ECs at 24 hours after co-incubation was examined by transwell assays (8-µm pore size). Scale bar: 200 µm. (F, G) The migration of ECs at 24 hours after co-incubation was detected by scratch assays with transwell co-culture system (0.4-µm pore size). Scale bar: 200 µm. (H–J) The effect of MSCs, MSCsCtrl and MSCsP311 on tube-like structure formation of ECs was evaluated by Matrigel assays with transwell co-culture system (0.4-µm pore size). ECs on 24-well plates supplement with Matrigel were co-cultured with MSCs, MSCsCtrl or MSCsP311 on transwell insert with 0.4-µm pore size. The formation of tube-like structure was photographed under optical microscope. Representative images for the formation of tube-like structure and statistical analysis were shown. Scale bar: 200 µm. MSCs group: MSCs + ECs; MSCsCtrl group: MSCsCtrl + ECs; MSCsP311: MSCsP311 + ECs. Scale bar: 50 µm. Data are representative of at least three independent experiments and represent mean ± SD. (ns, no statistical significance; *P < 0.05; **P < 0.01; ***P < 0.001). To confirm that P311 could regulate pro-angiogenesis of MSCs, we evaluated the vascularisation of the wound tissues by examining the effects of MSCs, MSCsCtrl, or MSCsP311 administered in vivo. For assessing the vascularisation, we harvested the wound tissues at 9 days post-injury and analysed the number of blood vessels present. As shown in , the treatment with MSCsP311 significantly increased the number of blood capillaries in the wound tissues ( ). The quantitative data on the number of capillaries around the wound indicated that the MSCsP311 enhanced the number of blood vessels formed by approximately 2.1-2.6 folds, compared to that of MSCs or MSCsCtrl treatment ( ). In addition, we also analysed the number of vessel-like structure formation in granulation tissues and found that the wound tissue section from MSCs and MSCsCtrl administered mice contain an avenge of 2.2 to 3 neo-vessels, while in the MSCsP311 treated tissues, the number of vessel-like structure in the granulation tissues was approximately 2-3 folds more ( ). Collectedly, our data demonstrate that P311 appreciably enhances the MSC-mediated pro-angiogenesis in vivo to facilitate skin wound closure.

P311 Up-Regulates Pro-Angiogenesis Cytokine VEGF Secretion of MSCs

As a critical angiogenic growth factor, VEGF plays a vital role in tissue repair and regeneration, which is essential for the pro-angiogenesis functions of MSCs (27). To investigate the regulation of P311 on VEGF expression in MSCs and VEGF production in animal wound tissue induced by MSCs administration, we evaluated the expression of VEGF in MSCs, MSCsCrtl, MSCsP311 in vitro and the expression levels of VEGF in the wound tissues of animals administered with MSCs, MSCsCrtl, MSCsP311 in vivo. We first examined the extracellular secretion levels of VEGF using ELISA. Our results revealed that MSCsP311, but not MSCs and MSCsCtrl, have a significant secretion of extracellular VEGF by about 10 folds (from 87.48 to 888.13pg/mL) ( ). Consistently, MSCsP311 also showed remarkedly higher intracellular expression of VEGF than MSCs and MSCsCtrl ( ). Confocal images also showed that the MSCsP311 displayed an average of 6.1-fold stronger signals of VEGF than that in MSCs and MSCsCtrl ( ). Furthermore, the mRNA expression levels of VEGF were 30-fold higher in MSCsP311 than that in MSCs and MSCsCtrl ( ). To verify the results from these bioassays and the function of P311 in vitro, we further examined the expression levels of VEGF in wound tissues of animals administered with MSCs, MSCsCrtl, MSCsP311 in vivo. At 7 days post-injury, the expression levels of VEGF in MSCsP311 administered wound and surrounding tissues increased by about 2.3 and 1.8 folds (from 266.16 to 614.00pg/mL; from 100.49 to 182.00pg/mL) as detected by ELISA compared to the wound tissues administered with MSCs and MSCsCrtl ( ). Consistently, the immunohistochemical images of VEGF in MSCsP311-mediated granulation tissues displayed significantly higher levels of VEGF staining signals, as compared to the granulation tissues mediated by MSCs and MSCsCrtl, indicating that the expression of VEGF is elevated in MSCsP311-mediated granulation tissues ( ). Collectively, our data suggest that P311 enhances VEGF expression of MSCs and mediates the production of VEGF in the MSCs administered wound tissues, thus further facilitating the function of pro-angiogenesis and pro-wound healing of MSCs.
Figure 4

P311 up-regulates pro-angiogenesis cytokine VEGF secretion of MSCs. (A) The extracellular secretion of VEGF in MSCs, MSCsCtrl and MSCsP311 was examined by ELISA assays. (B–G) The regulation of P311 on VEGF expression of MSCs was estimated by identifying the extracellular secretion, intracellular expression, and mRNA transcription levels of VEGF in MSCs, MSCsCtrl and MSCsP311. (B–E) The intracellular expression of VEGF in MSCs, MSCsCtrl and MSCsP311 was detected by Western blot and confocal microscopy. (B, C) Representative immunoblotting images for VEGF in MSCs, MSCsCtrl and MSCsP311 were shown (left panel), and the gray value of VEGF was statistically analysed (right panel). (D, E) Representative confocal images for VEGF in MSCs, MSCsCtrl and MSCsP311 were shown (left panel), and the MFI value of VEGF was statistically analysed (right panel). Scale bar: 100 µm. (F) The mRNA transcription levels of VEGF in MSCs, MSCsCtrl and MSCsP311 were identified by qRT-PCR. (G–J) The expression of pro-angiogenesis cytokine in wound tissue post-injury was evaluated by assessing the content of VEGF in mice with MSCs, MSCsCtrl, MSCsP311 treatment (n=3/group). Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; **P < 0.01; ***P < 0.001).

P311 up-regulates pro-angiogenesis cytokine VEGF secretion of MSCs. (A) The extracellular secretion of VEGF in MSCs, MSCsCtrl and MSCsP311 was examined by ELISA assays. (B–G) The regulation of P311 on VEGF expression of MSCs was estimated by identifying the extracellular secretion, intracellular expression, and mRNA transcription levels of VEGF in MSCs, MSCsCtrl and MSCsP311. (B–E) The intracellular expression of VEGF in MSCs, MSCsCtrl and MSCsP311 was detected by Western blot and confocal microscopy. (B, C) Representative immunoblotting images for VEGF in MSCs, MSCsCtrl and MSCsP311 were shown (left panel), and the gray value of VEGF was statistically analysed (right panel). (D, E) Representative confocal images for VEGF in MSCs, MSCsCtrl and MSCsP311 were shown (left panel), and the MFI value of VEGF was statistically analysed (right panel). Scale bar: 100 µm. (F) The mRNA transcription levels of VEGF in MSCs, MSCsCtrl and MSCsP311 were identified by qRT-PCR. (G–J) The expression of pro-angiogenesis cytokine in wound tissue post-injury was evaluated by assessing the content of VEGF in mice with MSCs, MSCsCtrl, MSCsP311 treatment (n=3/group). Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; **P < 0.01; ***P < 0.001).

The Expression of VEGF Is Essential for P311-Mediated Pro-Angiogenesis and Inflammatory Regulation of MSCs In Vitro and In Vivo

Our data shown above convincingly suggests that P311 can enhance the expression of VEGF in MSCs; however, the underlying mechanisms of how P311-induced VEGF mediates pro-angiogenesis of MSCs would need to be further explored. To investigate the precise roles of VEGF during the P311-mediated pro-angiogenesis of MSCs, VEGF was knocked down in MSCsP311. We first ensured that the expression of VEGF was markedly downregulated when VEGF was depleted in MSCsP311 ( ). Subsequently, we evaluated the proliferation, motility, and tube-like structure formation ability of ECs that were co-incubated with MSCsP311 transfected with or without VEGF si-RNA in the transwell-coincubation system. Using EdU-incorporation staining, we found that approximately 73% of the ECs co-incubated with MSCsP311+si-Ctrl were EdU-positive, which is much higher than 26% of the ECs co-incubated with MSCsCtrl and 54% of the ECs co-incubated with MSCsP311+si-VEGF ( ), suggesting that the reduction of VEGF production significantly attenuated MSCsP311-mediated enhancement of the viability and proliferation of ECs. In addition, using cell counting assay, we found that ECs had significantly higher viability when co-incubated with MSCsP311+si-Ctrl than that with MSCsCtrl and MSCsP311+si-VEGF at day 5 as detected by OD450 ( ). To characterise the role of VEGF on MSCsP311-mediated pro-angiogenesis, we utilised the transwell invasion and analysed the effects of VEGF on the mobility of ECs at 24 hours after co-incubation with MSCsP311+si-Ctrl, MSCsCtrl and MSCsP311+si-VEGF. As shown in , ECs co-incubated with MSCsP311+si-Ctrl had approximately 1.9-fold improvement in invasion ability, compared to ECs co-incubated with MSCsCtrl. ECs co-incubated with MSCsP311+si-VEGF had a 50% reduction in invasion ability. Likewise, in comparison to ECs co-incubated with MSCsCtrl, the data of the scratch migration assays also showed an approximately 80% enhancement in migration of ECs co-incubated with MSCsP311+si-Ctrl; however, the depletion of VEGF by siRNA reduced the enhancement effect of P311 by about 50% ( ). Moreover, in addition to evaluating MSCsP311-mediated angiogenic signalling through the ability of ECs to divide and migrate, we also investigated the effects of VEGF on the MSCsP311-mediated angiogenesis using matrigel assays with the transwell co-culture system and analysed the tube-like formation structure of ECs. Our results clearly demonstrated that ECs co-incubated with MSCsP311+si-Ctrl, but not MSCsCtrl, significantly promoted the formation of capillary-like structures of ECs for both total loops and total branching points, while depletion of VEGF by siRNA in MSCsP311+si-VEGF dramatically slowed down the MSCsP311-mediated development of the capillary-like structures of ECs by approximately 59% ( ). Moreover, in line with in vitro results, our in vivo data revealed that MSCsP311-treated granulation tissues dramatically elevated the number of the CD31-positive ECs, with about two folds increment, as compared to either MSCs or MSCsCrtl treated granulation tissues. However, the high number of the CD31-positive ECs in MSCsP311+si-Ctrl-administered granulation tissues was also reduced significantly by depletion of VEGF (MSCsP311+si-VEGF) ( ). Collectively, our data strongly suggest that VEGF plays an essential role in governing P311-mediated pro-angiogenesis of MSCs.
Figure 5

VEGF is essential in P311-mediated angiogenesis of MSCs in vitro and in vivo. The roles of VEGF in P311-mediated promotion of MSCs on ECs proliferation and motility were estimated by using MSCsP311 transfected with VEGF si-RNA (MSCsP311+si-VEGF) or control vehicle (MSCsP311+si-Ctrl). (A–E) Using transwell system mentioned above, ECs were co-cultured with MSCsP311+si-VEGF or MSCsP311+si-Ctrl for 24 hours at ratio 4:1. (A, B) The proliferation of ECs was examined at single cell level by EdU assays at 24 hours after co-incubation. Representative confocal images of EdU were shown (left panel), and the number of EdU-positive cells was counted and statistically analysed (right panel). Scale bar: 100 µm. (C) Cell viability for ECs was detected by means of CCK8 assay on day 1, 3 and 5 after co-incubation. (* means MSCsCtrl vs MSCsP311+si-Ctrl, # means MSCsP311+si-Ctrl vs MSCsP311+si-VEGF) (D–G) The roles of VEGF in P311-mediated increase in motility of ECs was estimated by detecting the invasion and migration in MSCsP311+si-VEGF or MSCsP311+si-Ctrl co-incubation. (D, E) ECs in upper chamber were co-cultured with MSCsCtrl, MSCsP311+si-VEGF or MSCsP311+si-Ctrl in lower chamber at ratio 4:1 for 6 hours, and ECs that have migrated through the membrane were stained, counted, and statistically analysed. Scale bar: 200 µm. (F, G) The migration of ECs at 24 hours after co-incubation was detected by scratch assays with transwell co-culture system (0.4-µm pore size). Scale bar: 200 µm. (H–J) The regulation of P311 on pro-angiogenesis functions of MSCs was evaluated by tube-like structure formation assays in vitro. Representative images of tube-like structure formation were shown (left panel) and the number of loops and branch points were counted and statistically analysed (right panel). Scale bar: 200 µm. MSCsCtrl group: MSCsCtrl + ECs; MSCsP311+si-Ctrl group: MSCsP311+si-Ctrl + ECs. MSCsP311+si-VEGF group: MSCsP311+si-VEGF + ECs. (K) The representative immunohistochemical staining images of CD31-positive ECs were shown (black arrows, left panel), and the number of vessels was counted and statistically analysed (right panel). Scale bar: 50 µm. Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; *P < 0.05; **p < 0.01; ***p < 0.001).

VEGF is essential in P311-mediated angiogenesis of MSCs in vitro and in vivo. The roles of VEGF in P311-mediated promotion of MSCs on ECs proliferation and motility were estimated by using MSCsP311 transfected with VEGF si-RNA (MSCsP311+si-VEGF) or control vehicle (MSCsP311+si-Ctrl). (A–E) Using transwell system mentioned above, ECs were co-cultured with MSCsP311+si-VEGF or MSCsP311+si-Ctrl for 24 hours at ratio 4:1. (A, B) The proliferation of ECs was examined at single cell level by EdU assays at 24 hours after co-incubation. Representative confocal images of EdU were shown (left panel), and the number of EdU-positive cells was counted and statistically analysed (right panel). Scale bar: 100 µm. (C) Cell viability for ECs was detected by means of CCK8 assay on day 1, 3 and 5 after co-incubation. (* means MSCsCtrl vs MSCsP311+si-Ctrl, # means MSCsP311+si-Ctrl vs MSCsP311+si-VEGF) (D–G) The roles of VEGF in P311-mediated increase in motility of ECs was estimated by detecting the invasion and migration in MSCsP311+si-VEGF or MSCsP311+si-Ctrl co-incubation. (D, E) ECs in upper chamber were co-cultured with MSCsCtrl, MSCsP311+si-VEGF or MSCsP311+si-Ctrl in lower chamber at ratio 4:1 for 6 hours, and ECs that have migrated through the membrane were stained, counted, and statistically analysed. Scale bar: 200 µm. (F, G) The migration of ECs at 24 hours after co-incubation was detected by scratch assays with transwell co-culture system (0.4-µm pore size). Scale bar: 200 µm. (H–J) The regulation of P311 on pro-angiogenesis functions of MSCs was evaluated by tube-like structure formation assays in vitro. Representative images of tube-like structure formation were shown (left panel) and the number of loops and branch points were counted and statistically analysed (right panel). Scale bar: 200 µm. MSCsCtrl group: MSCsCtrl + ECs; MSCsP311+si-Ctrl group: MSCsP311+si-Ctrl + ECs. MSCsP311+si-VEGF group: MSCsP311+si-VEGF + ECs. (K) The representative immunohistochemical staining images of CD31-positive ECs were shown (black arrows, left panel), and the number of vessels was counted and statistically analysed (right panel). Scale bar: 50 µm. Data are representative of at least three independent experiments and represent mean ± SD of indicated number of mice per group. (ns, no statistical significance; *P < 0.05; **p < 0.01; ***p < 0.001). To determine the effects of VEGF on the MSCsP311-mediated pro-angiogenesis and inflammatory regulation in vivo, we evaluated the vascularisation, the levels of VEGF and inflammatory state in wound tissues of animals administered with MSCsCtrl, MSCsP311+si-Ctrl, and MSCsP311+si-VEGF. We first harvested the wound tissues at day 9 post-injury and analysed the number of blood vessels. As shown in , the treatment of MSCsP311+si-Ctrl, but not MSCsCtrl, significantly increased the number of blood capillaries in the wound tissues by about 2 folds (from 6 to 13 capillaries). However, depletion of VEGF in the MSCsP311-mediated tissues markedly reduced the increment of the vasculature as compared to MSCsP311+si-Ctrl by approximately 31% (from 13 to 9 capillaries) ( ). Moreover, we also found the number of vessel-like structures in MSCsP311+si-Ctrl-administered granulation tissues increased about 2.7 folds (increased from average 2.3 to 6 neo-vessles), in comparison to MSCsCtrl-administered granulation tissues. Consistently, knockdown of VEGF in the MSCsP311-mediated tissues dramatically attenuated the enhancement of vasculature in MSCsP311+si-Ctrl from 3 to 1.5 folds (reduced from average 6 to 3 neo-vessels) ( ). Finally, to recapitulate the data above, we also showed that knockdown of VEGF significantly reduced MSCsP311-mediated elevation of VEGF production in the wound tissues ( ). Meantimes, the wound tissues after treatment at day 3 were harvested and analyzed the expression of TNF-α, IFN-γ and IL-10. The data showed that MSCsP311+si-Ctrl, but not MSCsCtrl, markedly decreased the production of pro-inflammatory cytokines TNF-α and IFN-γ in wound tissues. Nonetheless, the knockdown of VEGF in the MSCsP311-mediated tissues markedly up-regulated the expression of TNF-α and IFN-γ as compared to MSCsP311+si-Ctrl ( ). For anti-inflammatory cytokines, the expression of IL-10 was dramatically elevated in the wound tissues of the MSCsP311+si-Ctrl treated mice, when compared to mice with the treatment of MSCsCtrl. This phenomenon was weakened as the expression of VEGF in MSCsP311 was blocked by VEGF siRNA ( ). Moreover, the expression of collagen was also observed by Masson staining. As shown in , the contents of total collagen in wound tissues of the MSCsP311+si-Ctrl treated mice were higher than MSCsCtrl treated mice, while the deletion of VEGF in MSCsP311 significantly inhibited the increasement of total collagen in MSCsP311+si-VEGF-administered wound tissues ( ). Collectively, our data demonstrate that VEGF is essential for P311-mediated pro-angiogenesis and inflammatory control of MSCs in vivo.

mTOR Signal Pathway Is Deeply Involved in the Regulation of P311 on VEGF Expression in MSCs

The mTOR signalling pathway plays a pivotal role in the translation process (28). However, the role of the mTOR signalling pathway in P311-mediated VEGF expression of MSCs has not yet been elucidated. To understand the underlying molecular mechanism on whether P311 elevates the levels of VGEF through the mTOR pathway, we first accessed the relationship between P311 and mTOR signalling in cell and tissue levels by examining the activation of mTOR signal pathways, including PI3K, AKT, 4EBP1 and P70S6K in MSCs, MSCsCrtl, and MSCsP311. Our data highlighted that the overexpression of P311 in MSCsP311, but not MSCs and MSCsCrtl, significantly induced the phosphorylation of PI3K, AKT, mTOR, 4EBP1 and P70S6K in the mTOR signalling pathway ( and ). To define the roles of the mTOR signalling pathway in P311-mediated VEGF expression of MSCs, we examined the expression of VEGF in MSCsP311 in the presence or absence of rapamycin (a mTORC1 inhibitor), LY2584702 (a P70S6K inhibitor), and LY294002 (a PI3K inhibitor), respectively. Interestingly, our results showed that inhibition of mTORC1, P70S6K or PI3K markedly reduced the extracellular secretion of VEGF, as detected by ELISA ( ), the intracellular VEGF expression by Western blot ( ) and confocal cellular images ( ) in MSCP311. Taken together, our data strongly suggest that the regulation of P311 on the elevation of VEGF in MSCs is dependent on the mTOR signalling pathway, and the overexpression of P311 would activate PI3K-mTOR and its downstream signalling; the VEGF pathway is subsequently activated and promotes the angiogenesis in the wound and granulating tissues by MSCs.
Figure 6

mTOR signalling pathway is deeply involved in the regulation of P311 on VEGF expression in MSCs. (A–F) The activation of mTOR (P70S6K/p-P70S6K, 4EBP1/p-4EBP1, mTOR/p-mTOR, AKT/p-AKT, and PI3K/p-PI3K) signalling pathway in MSCs, MSCsCtrl and MSCsP311 was detected using Western blot. Representative images for mTOR related signaling pathway were shown (left panel), and the ratio of phosphorylated to total proteins were statistically analysed (right panel). (G–K) The affection of mTOR related signalling pathway on P311-mediated up-regulating VEGF expression of MSCs was estimated by detecting VEGF extracellular secretion, intracellular expression of VEGF in MSCsP311 with rapamycin (mTOR inhibitor), LY2584702 (P70S6K inhibitor), LY294002 (PI3K inhibitor), or control vehicle (DMSO) treatment. (G) The extracellular secretion of VEGF in MSCsP311 with rapamycin, LY2584702, LY294002 or DMSO treatment was examined by ELISA assays. (H–K) The intracellular expression of VEGF in MSCsP311 with rapamycin, LY2584702, LY294002, or DMSO treatment was detected by Western blot and confocal microscopy. (H, I) Representative immunoblotting images for VEGF were shown (left panel), and the mean gray value of VEGF was statistically analysed (right panel). (J, K) Representative fluorescent images for VEGF were shown (left panel), and the mean fluorescence intensity value of VEGF was statistically analysed (right panel). Scale bar: 100 µm. Data are representative of at least three independent experiments and represent mean ± SD. (ns, no statistical significance; **P<0.01; ***p < 0.001).

mTOR signalling pathway is deeply involved in the regulation of P311 on VEGF expression in MSCs. (A–F) The activation of mTOR (P70S6K/p-P70S6K, 4EBP1/p-4EBP1, mTOR/p-mTOR, AKT/p-AKT, and PI3K/p-PI3K) signalling pathway in MSCs, MSCsCtrl and MSCsP311 was detected using Western blot. Representative images for mTOR related signaling pathway were shown (left panel), and the ratio of phosphorylated to total proteins were statistically analysed (right panel). (G–K) The affection of mTOR related signalling pathway on P311-mediated up-regulating VEGF expression of MSCs was estimated by detecting VEGF extracellular secretion, intracellular expression of VEGF in MSCsP311 with rapamycin (mTOR inhibitor), LY2584702 (P70S6K inhibitor), LY294002 (PI3K inhibitor), or control vehicle (DMSO) treatment. (G) The extracellular secretion of VEGF in MSCsP311 with rapamycin, LY2584702, LY294002 or DMSO treatment was examined by ELISA assays. (H–K) The intracellular expression of VEGF in MSCsP311 with rapamycin, LY2584702, LY294002, or DMSO treatment was detected by Western blot and confocal microscopy. (H, I) Representative immunoblotting images for VEGF were shown (left panel), and the mean gray value of VEGF was statistically analysed (right panel). (J, K) Representative fluorescent images for VEGF were shown (left panel), and the mean fluorescence intensity value of VEGF was statistically analysed (right panel). Scale bar: 100 µm. Data are representative of at least three independent experiments and represent mean ± SD. (ns, no statistical significance; **P<0.01; ***p < 0.001).

Discussion

The multipotent MSCs have the potential to differentiate into a variety of cell types and play a central role in promoting wound repair (23). Approaches to boost the pro-healing function of MSCs have gradually come into force to improve the current clinical efficacy of MSCs. In recent times, P311 has been identified to play crucial roles in promoting skin wound healing, suggesting that P311 gene modification may improve the pro-healing function of MSCs. In this study, we have demonstrated both in vivo and in vitro that the induced expression of the P311 gene can significantly enhance the ability of MSCs to (i) increase collagen deposition, such as more contents of type I and III collagens, elevated the production of hydroxyproline; (ii) improve the immune environment by increasing the levels of anti-inflammatory IL10, while reducing the levels of pro-inflammatory TNF-α and IFN-γ; (iii) promote angiogenesis, such as greater number of blood vessels and tube-like structure, and stronger vascularisation; (iiii) up-regulate the expression of VEGF ( ). Moreover, we show that the enhanced pro-angiogenic function of MSCs by P311 is highly correlated with the increased VEGF production in vitro and in vivo. The mTOR signalling pathway mechanistically regulates the P311-mediated increase in the production of VEGF in the MSCs. Together, our study highlights the potential of P311 in strengthening the MSCs-mediated enhancement of cutaneous wound closure.
Figure 7

The schematic diagram on how P311 enhances the wound healing capabilities of MSCs via the up-regulation VEGF expression mediated by mTOR signalling pathway. (A) P311-mediated anti-inflammatory effects attenuate the inflammatory status of wound tissues for wound healing. (B) Neo-vascularization of new blood vessels by the release of VEGF from MSCs with increased P311 levels that enhances their pro-angiogenesis function to accelerate skin wound healing. (C) Increased collagen deposition and elevated production of hydroxyproline by MSCs with increased P311 levels. (D) Increased P311 levels in MSC activates the mTOR signalling pathway, which in turn up-regulate the expression of VEGF, leading to their release from the MSCs to aid in enhanced wound healing process by MSCs. Collective functions of these processes mediated by P311 enhanced MSCs contributes to the overall quality of wound healing. Created with BioRender.com.

The schematic diagram on how P311 enhances the wound healing capabilities of MSCs via the up-regulation VEGF expression mediated by mTOR signalling pathway. (A) P311-mediated anti-inflammatory effects attenuate the inflammatory status of wound tissues for wound healing. (B) Neo-vascularization of new blood vessels by the release of VEGF from MSCs with increased P311 levels that enhances their pro-angiogenesis function to accelerate skin wound healing. (C) Increased collagen deposition and elevated production of hydroxyproline by MSCs with increased P311 levels. (D) Increased P311 levels in MSC activates the mTOR signalling pathway, which in turn up-regulate the expression of VEGF, leading to their release from the MSCs to aid in enhanced wound healing process by MSCs. Collective functions of these processes mediated by P311 enhanced MSCs contributes to the overall quality of wound healing. Created with BioRender.com. During wound healing, the increased deposition of collagen contributes to the adhesion of various cell types, such as endothelial cells, fibroblasts, and myofibroblasts to promote the formation of granulation and further accelerate the wound repair (29–31). Over the past years, a considerable number of studies have revealed that MSC and their exosomes facilitated collagen deposition in wound tissue (24). Yet, whether P311 improves MSCs-mediated collagen deposition and the healing process for injured tissue remains unknown. In the present study, we show that the elevation of the P311 level indeed enhances the function of MSCs in promoting collagen deposition. Specifically, P311 enhances the production of MSC-mediated type I and type III collagens in wounded skin. In addition to our in vitro data, P311 also enhances the MSCs-mediated increase of reticular fibres in in vivo studies. To some extent, at least in part, P311 amplifies the MSCs-mediated enhancement of wound healing quality via improved collagen formation. An inflammatory response occurs following hemostasis and has an irreplaceable role in wound healing (32). It is paramount to keep the balance between pro-inflammatory and anti-inflammatory reactions during the homeostasis of the wound microenvironment. MSCs have been considered a promising candidate for stem cell therapies as they can appropriately regulate the inflammatory response when the immune system is overactivated or under-activated. A study reported by Denis Gallagher et al. (33) showed that MSCs could reduce stress-induced circulating pro-inflammatory cytokines, monocytes and neuroinflammation. Their data demonstrated that MSCs could modulate the central nervous system inflammatory processes using a stress-based rodent model of major depressive disorder. Furthermore, Ahn and his colleagues proved that MSCs-derived human umbilical cord blood could inhibit inflammation and alleviate the pathological immune responses as a therapeutic tool (34). However, it has been unclear whether P311 could also modulate the immunoregulatory function of MSCs in promoting wound healing. As expected, our data demonstrated that P311 strongly enhances the capabilities of MSCs-mediated immunomodulation by increasing the anti-inflammatory cytokine, IL10, while decreasing the pro-inflammatory cytokines, TNF-α and IFN-γ. The improved recovery from inflammation could have contributed to the early start of the wound healing process, leading to enhanced quality in wound healing, such as reduced scarring. Angiogenesis, the process of forming new blood vessels from the de novo generation of endothelial cells, is significant during wound healing (35). Angiogenesis is a prerequisite for the formation of granulation tissue, which timely replenishes the damaged area for wound repair after cutaneous injury (36). In addition to playing an important role in immune regulation, as highlighted previously, MSCs can also promote the formation of new blood vessels (37). For instance, An et al. have previously demonstrated that MSCs derived from the bone marrow could boost vascularisation by enhancing autophagy in mice (23). A similar study showed that injecting MSCs subcutaneously into mice can accelerate the wound vascularisation, highlighting the ability of MSCs in contributing to increased angiogenesis (38). Moreover, our previous study using a P311 knockdown mouse model has proved that P311 can facilitate skin wound tissue re-epithelialisation to accelerate wound healing by augmenting the number of blood capillaries (13). Nevertheless, it has been still obscured whether P311 enhances MSCs-mediated angiogenesis in injured mice. Therefore, we infer that P311 could strengthen the functions of MSCs-mediated vascularisation. The present data uncovered that P311 does intensify the abilities of MSCs-mediated angiogenesis in full-thickness excision of mice. VEGF, crucial in angiogenesis, was identified and isolated over 25 years ago (39). Although several related genes, including FGF, TGF, IL-8 and TNF-α, have been associated with angiogenesis, much emphasis has been placed on VEGF due to its key role in regulating angiogenesis during homeostasis and disease (40). In recent years, many studies have paid more attention to the correlation among VEGF, MSCs and angiogenesis. It has been reported that the paracrine signalling of VEGF in MSCs was required for angiogenesis during wound healing (41). In another study, Yu et al. discovered that exosomes derived from atorvastatin-pre-treated MSCs enhanced the formation of micro-vessels by up-regulating the expression of VEGF via the AKT/eNOS signalling pathway (42). Moreover, the data from Zacharek et al. revealed that stroke treated with MSCs facilitated angiogenesis and vascular stabilisation, which was in part mediated by VEGF (27). In support, our data in this study also demonstrated that a P311-mediated increase in expression of VEGF in MSCsP311 is necessary for the formation of new blood vessels and the number of tube-like structures during wound healing. To exclude the effect of the increased VEGF on tumorigenesis, we evaluate organs including heart, liver, spleen, lung and kidney by H&E staining. We observed that these organs have no structural change between normal mice and mice treated with MSCs, MSCsCtrl, MSCsP311 ( ). Even though VEGF is modulated in MSCs for wound healing, the mechanism which controls the level of VEGF during wound healing has to be further investigated. The protein Mammalian target of rapamycin (mTOR) is a serine/threonine kinase that senses changes in the level of amino acids, nutrients and growth factors. This allows mTOR to regulate numerous fundamental cellular processes, including protein synthesis, growth, metabolism, aging, regeneration and autophagy (43). Since the catalytic domain of mTOR resembles that of the lipid kinases such as phosphoinositide 3-kinase, mTOR is considered an atypical protein kinase belonging to the PI3K-related kinase family (44). It has been shown that plasma endothelial cells-derived-extracellular vesicles accelerated skin wound healing in diabetic mice by activating the PI3K/Akt/mTOR pathway (45, 46). It has been shown that Plasma endothelial cells-derived-extracellular vesicles accelerated skin wound healing in diabetic mice by activating the PI3K/Akt/mTOR pathway (47). Furthermore, Wang et al. (48) reported that leonurine promoted the production of VEGF by activating the mTOR pathway and could efficiently enhance angiogenesis and facilitate the wound healing process in vivo. Similarly, it has been shown that the expression of VEGF was up-regulated when the PI3K/AKT/mTOR signalling pathway was activated, suggesting that VEGF was mediated by PI3K/AKT/mTOR pathway (49). In line with the previous findings, our current study also strongly demonstrates that P311 enhances the pro-angiogenesis function of MSCs by increasing the production of VEGF both in vitro and in vivo, together with the activation of mTOR related signalling pathway. Taken together, we have demonstrated that P311 can significantly enhance the ability of MSCs to accelerate cutaneous wound closure and facilitate the healing quality in vivo. Furthermore, P311 enhances the pro-angiogenesis function of MSCs by increasing the production of VEGF while activating the mTOR signalling pathway in parallel. While the current data has clarified that P311-modified MSCs have been distinctly enhanced in their capability of promoting skin wound healing, how P311 could regulate mTOR and how mTOR affected the expression of VEGF were not entirely investigated in our study. Despite the current limitations in the clinical application of gene-modified MSCs, our current data provide a reference point for future clinical research in wound healing.

Conclusion

In conclusion, our present data demonstrated that induced expression of P311 can significantly enhance the ability of MSCs to accelerate skin wound closure and improve the healing quality. This improvement is in part contributed by the increased production of VEGF both in vitro and in vivo. In addition, it was mechanistically revealed that the mTOR signalling pathway was closely related to the regulation of P311 on the production of VEGF in MSCs, which might pave the way for its clinical application in the future.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics Statement

The animal study was reviewed and approved by Animal Ethics Committee of the Army Military Medical University, Chongqing, China.

Author Contributions

ZL performed the experiments and preparing the first draft of the manuscript. JY carried out the animal experiments. YC, CC, JW, RS, YT, XZ, XH, and SP performed most of the experiments and prepared the manuscript. WZ performed the technical support of confocal microscopy and full slide scanning microscope. YML, Y-CL, WH, and GL conceived and designed the research and edited the manuscript. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by funds from the National Natural Sciences Foundation of China (No. 31872742 to WH, No. 81630055 and No. 81920108022 to GL), Military Medical Science and Technology Youth Training Program of Army Military Medical University (Third Military Medical University) (No. 20QNPY024 to WH), the Special Project for Enhancing Science and Technology Innovation Ability (frontier exploration) of Army Military Medical University (Third Military Medical University) (No. 2019XQY12 to WH) and in part from R154-000-C006-114 (MOE, Tier 1), Singapore, for YL.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  48 in total

Review 1.  Therapeutic strategies for enhancing angiogenesis in wound healing.

Authors:  Austin P Veith; Kayla Henderson; Adrianne Spencer; Andrew D Sligar; Aaron B Baker
Journal:  Adv Drug Deliv Rev       Date:  2018-09-26       Impact factor: 15.470

2.  CD26 upregulates proliferation and invasion in keloid fibroblasts through an IGF-1-induced PI3K/AKT/mTOR pathway.

Authors:  Yu Xin; Peiru Min; Heng Xu; Zheng Zhang; Yan Zhang; Yixin Zhang
Journal:  Burns Trauma       Date:  2020-10-30

Review 3.  Kaposi's sarcoma: its 'oncogenes' and growth factors.

Authors:  J G Sinkovics
Journal:  Crit Rev Oncol Hematol       Date:  1991       Impact factor: 6.312

4.  Defective angiogenesis in the inflammatory granulation tissue in histidine decarboxylase-deficient mice but not in mast cell-deficient mice.

Authors:  Ajoy Kumar Ghosh; Noriyasu Hirasawa; Hiroshi Ohtsu; Takehiko Watanabe; Kazuo Ohuchi
Journal:  J Exp Med       Date:  2002-04-15       Impact factor: 14.307

5.  P311 induces the transdifferentiation of epidermal stem cells to myofibroblast-like cells by stimulating transforming growth factor β1 expression.

Authors:  Haisheng Li; Zhihui Yao; Weifeng He; Hongyan Gao; Yang Bai; Sisi Yang; Lu Zhang; Rixing Zhan; Jianglin Tan; Junyi Zhou; Masao Takata; Jun Wu; Gaoxing Luo
Journal:  Stem Cell Res Ther       Date:  2016-12-01       Impact factor: 6.832

6.  Plasma endothelial cells-derived extracellular vesicles promote wound healing in diabetes through YAP and the PI3K/Akt/mTOR pathway.

Authors:  Feng Wei; Aixue Wang; Qing Wang; Wenrui Han; Rong Rong; Lijuan Wang; Sijia Liu; Yimeng Zhang; Chao Dong; Yanling Li
Journal:  Aging (Albany NY)       Date:  2020-06-22       Impact factor: 5.682

7.  Early gestational mesenchymal stem cell secretome attenuates experimental bronchopulmonary dysplasia in part via exosome-associated factor TSG-6.

Authors:  Sushma Chaubey; Sam Thueson; Devasena Ponnalagu; Mohammad Afaque Alam; Ciprian P Gheorghe; Zubair Aghai; Harpreet Singh; Vineet Bhandari
Journal:  Stem Cell Res Ther       Date:  2018-06-26       Impact factor: 6.832

8.  Arachidonic acid promotes skin wound healing through induction of human MSC migration by MT3-MMP-mediated fibronectin degradation.

Authors:  S Y Oh; S-J Lee; Y H Jung; H J Lee; H J Han
Journal:  Cell Death Dis       Date:  2015-05-07       Impact factor: 8.469

9.  Exosomes derived from atorvastatin-pretreated MSC accelerate diabetic wound repair by enhancing angiogenesis via AKT/eNOS pathway.

Authors:  Muyu Yu; Wei Liu; Junxian Li; Junxi Lu; Huijuan Lu; Weiping Jia; Fang Liu
Journal:  Stem Cell Res Ther       Date:  2020-08-12       Impact factor: 6.832

Review 10.  Mesenchymal stromal cells-exosomes: a promising cell-free therapeutic tool for wound healing and cutaneous regeneration.

Authors:  Peng Hu; Qinxin Yang; Qi Wang; Chenshuo Shi; Dali Wang; Ubaldo Armato; Ilaria Dal Prà; Anna Chiarini
Journal:  Burns Trauma       Date:  2019-12-26
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.