Literature DB >> 35139115

Optimizing environmental safety and cell-killing potential of oncolytic Newcastle Disease virus with modifications of the V, F and HN genes.

J Fréderique de Graaf1, Stefan van Nieuwkoop1, Theo Bestebroer1, Daphne Groeneveld1, Casper H J van Eijck2, Ron A M Fouchier1, Bernadette G van den Hoogen1.   

Abstract

Newcastle Disease Virus (NDV) is an avian RNA virus, which was shown to be effective and safe for use in oncolytic viral therapy for several tumour malignancies. The presence of a multi basic cleavage site (MBCS) in the fusion protein improved its oncolytic efficacy in vitro and in vivo. However, NDV with a MBCS can be virulent in poultry. We aimed to develop an NDV with a MBCS but with reduced virulence for poultry while remaining effective in killing human tumour cells. To this end, the open reading frame of the V protein, an avian specific type I interferon antagonist, was disrupted by introducing multiple mutations. NDV with a mutated V gene was attenuated in avian cells and chicken and duck eggs. Although this virus still killed tumour cells, the efficacy was reduced compared to the virulent NDV. Introduction of various mutations in the fusion (F) and hemagglutinin-neuraminidase (HN) genes slightly improved this efficacy. Taken together, these data demonstrated that NDV with a MBCS but with abrogation of the V protein ORF and mutations in the F and HN genes can be safe for evaluation in oncolytic viral therapy.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35139115      PMCID: PMC8827430          DOI: 10.1371/journal.pone.0263707

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

In the last few decades, the use of oncolytic viruses (OVs) as therapy in cancer patients has shown to be a promising treatment strategy with encouraging results for a variety of tumours. OVs selectively infect and damage tumours either by directly killing the cells or by promoting an anti-tumour immune response towards them. Several oncolytic viruses have been tested in clinical trials with promising results, including Newcastle Disease Virus (NDV) [1-4]. NDV is a replication competent oncolytic virus belonging to the family Paramyxoviridae with an avian host range under normal conditions. Several studies have shown that OV therapy using NDV resulted in promising responses in several cancer types both in vitro and in vivo and was even capable of inhibiting metastases and inducing prolonged protection to tumour reoccurrence [5-7]. The direct oncolytic effect was a result of cell lysis due to viral replication, of which the efficacy is dependent on the NDV strain used [7, 8]. Similar to other OVs, a part of the therapeutic effect of oncolytic NDV is based on the induction of immune responses against the virus and the cancer cells. The secretion of pro-inflammatory cytokines, such as type I interferon (IFN), leads to counter-acting immune suppressive cells and hence enhances the anti-tumour response resulting in an indirect oncolysis [9]. NDV strains are categorized in three groups based on disease severity in chickens: non-virulent (lentogenic), intermediately virulent (mesogenic) and highly virulent (velogenic). An intracerebral pathogenicity index (ICPI) in chickens is determined as a marker for virulence [10, 11]. The cleavage site in the fusion (F) protein of NDV was shown to be a major determinant of these differences in virulence [12, 13]. Previously, we have shown that a lentogenic LaSota strain in which a multi-basic amino acid sequence at the cleavage site of the F protein was engineered (NDV F3aa), making this a mesogenic virus, had significant higher efficiency in killing tumour cells in vitro and in murine tumour models compared to the lentogenic strain NDV F0 [8]. Our study in non-human primates showed that NDV F3aa did not result in high pathogenicity, suggesting it is safe to use as oncolytic therapeutic in humans [14]. However, mesogenic and velogenic strains can cause outbreaks of severe disease in poultry and are defined as select agents in the USA [15]. Therefore, NDV F3aa has not been applied in clinical trials yet [3]. Several studies aimed to lower the virulence of mesogenic NDV-73T strain, while keeping the oncolytic efficacy of the virus, either by changing the cleavage site to that of a non-virulent virus, or by insertion of 198 nt at the HN-L junction [16]. Alternatively, NDV-73T was armed with immune modulatory protein genes such as granulocyte–macrophage colony-stimulating factor (GM-CSF), to increase the oncolytic effect of the virus [17]. We aimed to generate a mutant NDV F3aa with reduced replication capacity in avian cells and eggs, while maintaining killing potential in human tumour cells. Park and colleagues showed that the V protein of NDV is a determinant of host range restriction, as the V protein efficiently prevents innate host defences, such the type I IFN response as well as apoptosis, in avian cells and not human cells [18]. Multiple studies have confirmed that mutations in the open reading frame (ORF) of the V protein led to increased susceptibility to IFN responses and reduced virulence in embryonated chicken eggs [19, 20]. Nevertheless, the effect of abrogating the V protein ORF in the viral genome on virus induced tumour cell killing and environmental safety is not known yet. In this study, we generated NDV F3aa mutants in which expression of the V protein was abolished by introducing mutations in the stutter site and throughout the V protein ORF (NDV F3aa-STOPV). The mutations introduced in the V protein ORF affected all of the third positions of the codons of the essential Phosphoprotein (P) gene which did not result in any amino acid substitutions in the P protein but resulted in 15 stop codons in the V protein ORF. We investigated the effect of these modifications on avian-specific virulence. To improve the replication efficiency and oncolytic efficacy of these NDV F3aa mutants, additional mutations were introduced in the MBCS (F-117-S) and the intracellular domain (ICD) of the F protein (Y-524-A), which were suggested to improve F protein expression [21, 22]. In addition, the translation initiation site (TIS) of the F and HN genes was mutated to an optimized mammalian Kozak consensus sequence, aimed to obtain improvement of protein expression and hence viral replication [23]. These mutant viruses were evaluated for replication efficiency and cell-killing potential in human pancreatic adenocarcinoma cells (HPACs).

Results

Generation of NDV F3aa lacking V protein expression

The ORFs of the V and W proteins overlap with the ORF of the essential phospho (P) protein. The V protein ORF is only transcribed after a frameshift occurs as the result of stuttering by the viral polymerase protein [24]. To produce viruses that lack V protein expression, the stutter site was mutated at one or two nucleotide positions. In addition, every third nucleotide of the P protein codons was mutated, but only if this mutation did not result in a change of amino acid sequence of the P protein. In total 95 mutations were introduced, which resulted in the introduction of 15 stop codons in the V protein ORF, yielding the viruses NDV F3aa-STOPV1 and NDV F3aa-STOPV2, respectively (Fig 1A and 1B). The amino acid sequence of the P protein remained unchanged, because the mutations introduced into the ORF of the V protein only affected the third positions of the codons of the P protein gene. However, the modifications of the V protein ORF resulted in 40 amino acid substitutions in the W protein ORF including the deletion of the stop codon. Recombinant viruses were rescued in BSRT-7 cells and propagated further in Vero cells. The V protein gene of recombinant virus stocks from passage 2 were sequenced, which revealed that the viruses maintained the intended V protein sequence as indicated in Fig 1B.
Fig 1

Characterization of NDV F3aa-STOPV viruses in vitro.

(A) Schematic representation of the sequence of the stutter site of NDV F3aa and the NDV F3aa-STOPV mutants. (B) Amino acid sequence of V protein ORFs of NDV F3aa and F3aa-STOPV. (C-E) Cells were inoculated in triplo in (C) DF-1 at an MOI of 0.005 and at an MOI of 0.05 in (D) QT6 and (E) A549 cells. Supernatant samples were collected at the indicated time points and titrated in Vero cells (N = 2). Means and standard deviations of triplicates of representative experiments are plotted. The area under the curve (AUC) was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test).

Characterization of NDV F3aa-STOPV viruses in vitro.

(A) Schematic representation of the sequence of the stutter site of NDV F3aa and the NDV F3aa-STOPV mutants. (B) Amino acid sequence of V protein ORFs of NDV F3aa and F3aa-STOPV. (C-E) Cells were inoculated in triplo in (C) DF-1 at an MOI of 0.005 and at an MOI of 0.05 in (D) QT6 and (E) A549 cells. Supernatant samples were collected at the indicated time points and titrated in Vero cells (N = 2). Means and standard deviations of triplicates of representative experiments are plotted. The area under the curve (AUC) was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test).

Replication kinetics of NDV F3aa lacking V protein expression in vitro

To assess possible attenuation of the mutant viruses, replication kinetics of the STOPV viruses were evaluated in two different avian cell lines and in human adenocarcinoma cells known as a IFN responsive type II pulmonary epithelial cell (A549 cells). In chicken fibroblasts (DF-1 cells), the NDV F3aa-STOPV viruses were slightly attenuated (Fig 1C), while no replication was observed in quail fibroblasts (QT6 cells) (Fig 1D). Compared to the F3aa virus, the F3aa-STOPV viruses were severely attenuated in A549 cells (Fig 1E). Thus, the abolishment of V protein expression from NDV F3aa resulted in substantially attenuated virus replication in avian and human cells.

Increased interferon sensitivity of NDV F3aa lacking V protein expression

To evaluate the IFN sensitivity of the F3aa-STOPV viruses in vitro, chicken fibroblasts were pretreated with chicken IFN-β before virus inoculation. In these IFN-β pretreated cells, NDV F3aa replication was not affected (Fig 2A). In contrast, replication of both NDV F3aa-STOPV viruses was reduced in IFN treated cells compared to untreated cells, of which the replication of NDV F3aa-STOPV2 was significantly attenuated. These data indicate that abrogation of V protein expression increased the sensitivity of the viruses to IFN.
Fig 2

Characterization of NDV F3aa-STOPV viruses in ovo.

(A) DF-1 cells were mock-treated (solid line) or pretreated with 0.4 μg/ml chicken IFN-β for 24 hrs (dotted line) and inoculated in triplo at an MOI of 0.005. Samples were taken at the indicated time points and titrated. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test). (B) DF-1 or (C) A549 cells were inoculated with mock or at an MOI of 0.05 and harvested after 24h. The percentage of infected cells was determined by flow cytometry. Results are represented as fold change of IFN mRNA transcription in virus-infected cells versus mock. (D) Chicken and (E) duck eggs of different ages were inoculated and the allantoic fluid was harvested after 48 hours. The amount of infectious virus particles was determined by titration, with a maximal cut off of 8.3E8 TCID50/ml. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + Dunn’s multiple comparison test). ND: not detected.

Characterization of NDV F3aa-STOPV viruses in ovo.

(A) DF-1 cells were mock-treated (solid line) or pretreated with 0.4 μg/ml chicken IFN-β for 24 hrs (dotted line) and inoculated in triplo at an MOI of 0.005. Samples were taken at the indicated time points and titrated. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test). (B) DF-1 or (C) A549 cells were inoculated with mock or at an MOI of 0.05 and harvested after 24h. The percentage of infected cells was determined by flow cytometry. Results are represented as fold change of IFN mRNA transcription in virus-infected cells versus mock. (D) Chicken and (E) duck eggs of different ages were inoculated and the allantoic fluid was harvested after 48 hours. The amount of infectious virus particles was determined by titration, with a maximal cut off of 8.3E8 TCID50/ml. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + Dunn’s multiple comparison test). ND: not detected. To examine whether the loss of V protein expression also led to increased IFN responses, IFN-β mRNA expression levels upon inoculation of chicken DF-1 cells and human A549 cells were determined. Inoculation of DF-1 cells with NDV-F3aa did not result in elevated IFN-β mRNA levels, whereas inoculation with both NDV F3aa-STOPV viruses resulted in increased IFN-β mRNA expression levels compared to mock inoculation (Fig 2B). Inoculation of DF-1 cells with NDV F3aa-STOPV2 resulted in lower IFN IFN-β mRNA expression levels than inoculation with NDV F3aa-STOPV1, which is probably due to the higher levels of attenuation of NDV F3aa-STOPV2 in cells pretreated or producing INF, as shown in Fig 2A. These results confirm that the V protein acts as species specific IFN antagonist in avian cells [18]. In human A549 cells, all viruses induced increased IFN-β mRNA levels but differences were not observed between the viruses with and without an intact V ORF (Fig 2C). To confirm that the NDV F3aa-STOPV viruses were also attenuated in eggs due to increased IFN sensitivity, virus replication was assessed in embryonated chicken and duck eggs of different ages. Embryonated chicken eggs older than 10 days and duck eggs older than 13 days were described to produce IFN, in contrast to younger eggs [25]. Inoculation of chicken and duck eggs of all ages with NDV F3aa resulted in higher virus titers than inoculation with NDV F0 or F3aa-STOPV viruses (Fig 2D and 2E). In 6-day old chicken eggs, which have been reported to lack IFN production, higher virus titers of NDV F3aa-STOPV mutants were obtained than in older eggs. Upon inoculation of 14-day old chicken eggs which have been reported to produce IFN with NDV F3aa-STOPV2, no virus titers were obtained at all, underpinning the higher degree of attenuation of NDV F3aa-STOPV2 compared to that of NDV F3aa-STOPV1. Surprisingly, inoculation with NDV F0 led to higher titers in older eggs than in younger eggs. Inoculation of duck eggs with NDV F3aa-STOPV mutants resulted in similar virus titers in both young and older eggs, although inoculation of younger eggs with NDV F3aa-STOPV2, resulted in slightly higher titers than inoculation of older eggs. These data indicate that abolishment of V protein expression in NDV F3aa-STOPV resulted in an attenuated replication in both chicken and duck eggs, which in chicken eggs seems to be in part related to the age of the eggs, probably as a consequence of increased IFN sensitivity of the viruses.

Effect of NDV F3aa lacking V protein expression on tumour cell killing

The virus induced killing of tumour cells was assessed by determining the cell viability upon inoculation of ten HPAC cell lines. In general, inoculation of HPACs with NDV F3aa resulted in more cell death than inoculation with the other viruses (Fig 3A) and inoculation with NDV F3aa-STOPV viruses induced a similar level of cell killing as inoculation with NDV F0 in most HPACS, but not in Su.86.86 and CFPAC. The virus induced cell killing did not always correspond with the peak virus titers obtained at 48 hours after inoculation (Fig 3B). For instance, upon inoculation of CFPAC cells, NDV F3aa-STOPV induced less cell killing than NDV F0, while peak virus titers were similar for these viruses. Similarly, although similar virus titers were obtained upon inoculation of CPFAC and HPAFII cells with F3aa-STOPV, more cell killing was observed in CFPAC than in HPAFII cells. In two HPACS that were selected because they were most sensitive and least sensitive to NDV (Fig 3A), Su.86.86 and AsPC-1 respectively, replication of F3aa-STOPV viruses was clearly attenuated compared to NDV F3aa (Fig 3C and 3D). Although the replication of NDV F3aa-STOPV viruses was attenuated compared to NDV F3aa, the observed killing of tumour cells, being similar to that induced by NDV F0 in most cell lines, indicate that the viruses still have oncolytic potential.
Fig 3

Cell death of human cancer cell lines upon inoculation with NDV F3aa-STOPV viruses.

(A) Indicated HPACs were inoculated at an MOI of 10 in triplo with the indicated viruses. Cell viability was determined by an LDH cytotoxicity assay 120 hours after inoculation. Results are represented as percentage viable cells compared to mock, which were considered as 100% viable. Experiments were conducted two times. Means and standard deviations of triplicates of representative experiments are plotted. (B) Indicated HPACs were inoculated in duplo at an MOI of 0.1. After 48 hours, supernatant samples were collected and titrated in Vero cells. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. (C) Su.86.86 and (D) AsPC-1 cells were inoculated at an MOI of 0.05 in triplo. Supernatant samples were collected at the indicated time points and titrated in Vero cells. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test). ND: not detected.

Cell death of human cancer cell lines upon inoculation with NDV F3aa-STOPV viruses.

(A) Indicated HPACs were inoculated at an MOI of 10 in triplo with the indicated viruses. Cell viability was determined by an LDH cytotoxicity assay 120 hours after inoculation. Results are represented as percentage viable cells compared to mock, which were considered as 100% viable. Experiments were conducted two times. Means and standard deviations of triplicates of representative experiments are plotted. (B) Indicated HPACs were inoculated in duplo at an MOI of 0.1. After 48 hours, supernatant samples were collected and titrated in Vero cells. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. (C) Su.86.86 and (D) AsPC-1 cells were inoculated at an MOI of 0.05 in triplo. Supernatant samples were collected at the indicated time points and titrated in Vero cells. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test). ND: not detected.

Genomic stability of NDV F3aa-STOPV viruses

During passaging of the recombinant viruses in mammalian and chicken cells seven times, all mutations introduced in both the stutter site and the open reading of the V protein were found to be genetically stable. However, in all virus stocks passaged in Vero cells, a phenylalanine to serine substitution occurred at position 117 in the F protein (F-117-S), located at the cleavage site of the protein. This substitution was not observed in any of the viruses passaged in chicken DF-1 cells. To evaluate the effect of the F-117-S substitution on virus production and cell death in HPACs, the substitution was introduced in the backbone of the NDV F3aa and NDV F3aa-STOPV2 viruses, resulting in the viruses NDV F3aa-S and NDV F3aa-S-STOPV2 (Fig 4A). Given that NDV F3aa-STOPV1 and NDV F3aa-STOPV2 induced similar responses in HPACs and embryonated eggs (Figs 1–3), we continued only with the virus with 2 mutations in the stutter-site as this virus has a smaller hypothetical chance of reversion. The F-117-S substitution did not result in substantial differences in virus induced cell killing for the NDV F3aa-S and NDV F3aa-S-STOPV2 viruses upon inoculation of four different HPACs (Fig 4B). However, increased cytotoxicity was observed upon inoculation of Vero cells with viruses with F-117-S for both NDV F3aa-S as NDV F3aa-S-STOPV2 (Fig 4C). In addition, slightly higher replication kinetics in Vero cells were observed for the NDV F3aa-S virus than for NDV F3aa virus and a larger increase in replication was seen for NDV F3aa-S-STOPV2 as compared to NDV F3aa-STOPV2 (Fig 4D). The improved replication of NDV F3aa-S-STOPV in Vero cells could be beneficial for obtaining high virus titers during the production of oncolytic viruses for cancer therapy.
Fig 4

Characterization of F3aa-S mutant viruses.

(A) Schematic representation of the amino acid sequence of the cleavage site in the F protein of recombinant viruses. (B) Indicated HPACs were inoculated at an MOI of 10 or (C) Vero cells at indicated MOIs (Vero cells) in triplo. The percentage viable cells was determined by an LDH cytotoxicity assay 120 hours after inoculation. Results are represented as percentage viable cells compared to mock, which were considered 100% viable. (D) Vero cells were inoculated at an MOI of 0.05 in triplo. Supernatant samples were collected at the indicated time points and titrated. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test). (E) Vero and (F) DF-1 cells were inoculated and fixed 16 hours later and stained. The focus index was determined by counting the number of nuclei per foci for N = 30 foci. Experiments were conducted twice. Means and standard deviations of triplicates of a representative experiment are plotted. *** = p<0.001, **** = p<0.0001 (one-way ANOVA + unpaired t test). NDV F0, taken along as control.

Characterization of F3aa-S mutant viruses.

(A) Schematic representation of the amino acid sequence of the cleavage site in the F protein of recombinant viruses. (B) Indicated HPACs were inoculated at an MOI of 10 or (C) Vero cells at indicated MOIs (Vero cells) in triplo. The percentage viable cells was determined by an LDH cytotoxicity assay 120 hours after inoculation. Results are represented as percentage viable cells compared to mock, which were considered 100% viable. (D) Vero cells were inoculated at an MOI of 0.05 in triplo. Supernatant samples were collected at the indicated time points and titrated. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test). (E) Vero and (F) DF-1 cells were inoculated and fixed 16 hours later and stained. The focus index was determined by counting the number of nuclei per foci for N = 30 foci. Experiments were conducted twice. Means and standard deviations of triplicates of a representative experiment are plotted. *** = p<0.001, **** = p<0.0001 (one-way ANOVA + unpaired t test). NDV F0, taken along as control. To investigate whether the improved replication in Vero cells was due to improved fusion activity as a consequence of the substitution in the F protein cleavage site, fusion assays were performed. In these assays, cells were inoculated with virus and fixed 16 hours later followed by Giemsa staining. Subsequently, the number of nuclei per foci were counted to determine the fusion activity of each virus. NDV F3aa-S and NDV F3aa-S-STOPV2 viruses showed significantly increased fusion activity in Vero cells compared to viruses without F-117-S and compared to NDV F0 (Fig 4E). The beneficial effect of F-117-S on the fusion activity of NDV F3aa-S and NDV F3aa-S-STOPV2 viruses was not observed in DF-1 cells (Fig 4F). These data indicate that the F-117-S mutation probably provides a specific adaptation towards Vero cells.

Reduced virulence of NDV F3aa-(S)-STOPV2 viruses

To further assess the virulence of NDV F3aa-STOPV2 and NDV F3aa-S-STOPV2, the mean death time (MDT) of embryonated chicken and duck eggs upon inoculation with these viruses was determined as compared to viruses with an intact V protein ORF (Table 1). A MDT of chicken embryos upon NDV inoculation greater than 90 hours has been shown to be typical for nonvirulent strains that have an ICPI value smaller than 0.7 [26]. Upon inoculation with NDV F3aa and NDV F3aa-S, chicken eggs reached an MDT below 60 hours and duck eggs below 100 hours. Inoculation with NDV F0 resulted in an MDT just above 100 hours for eggs of both origins. No MDT could be determined for both chicken and duck eggs inoculated with NDV F3aa-STOPV2 and NDV F3aa-S-STOPV2, because all embryos survived. These data indicate that NDV F3aa-STOPV2 and NDV F3aa-S-STOPV2 were nonvirulent for poultry embryos, in contrast to NDV F3aa and NDV F3aa-S.
Table 1

Mean death time of chicken and duck eggs upon inoculation with NDV and engineered mutants thereof.

VirusChicken egg MDT (h)*Duck egg MDT (h)
NDV F010732
NDV F3aa5287
NDV F3aa-S5896
NDV F3aa—STOPV2>160>184
NDV F3aa-S—STOPV2>160>184
NDV F3aa-S—STOPV2-ICD>160N.D.
NDV F3aa-S—STOPV2-TIS>160N.D.

* A MDT of chicken eggs >90h was shown previously to be typical for nonvirulent NDV strains [19].

N.D.—Not done.

* A MDT of chicken eggs >90h was shown previously to be typical for nonvirulent NDV strains [19]. N.D.—Not done.

Mutations in the F and/or HN gene improved replication of NDV F3aa-S-STOPV2

The attenuation of NDV F3aa-(S)-STOPV2 mutants in avian cells and eggs was accompanied by reduced virus replication and virus-induced cell death in most HPACs. To improve virus replication and virus-induced cell killing, we introduced a number of mutations in the F and HN genes of the NDV F3aa-S-STOPV2 virus (Fig 5A). First of all, a substitution (Y-524-A) was introduced in the intracellular domain (ICD) of the F protein. This substitution was previously shown to cause increased virus replication, possibly due to improved stability of the F protein [21]. Introduction of this substitution in the genome of NDV F3aa-S-STOPV2, yielded the virus NDV F3aa-S-STOPV2-ICD. In addition, the translation initiation sites (TIS) of the F and HN proteins were changed to a mammalian optimal TIS sequence, the Kozak consensus sequence, with the aim to increase the translation and expression of both proteins [23]. This yielded NDV F3aa-S-STOPV2-TIS (Fig 5A). The NDV F3aa-S-STOPV2-ICD and NDV F3aa-S-STOPV2-TIS viruses were genetically stable until at least passage 4 in Vero cells.
Fig 5

Characterization of NDV F3aa-(S)-STOPV mutants.

(A) Schematic representation of the nucleotide sequence of the TIS and amino acid substitution of the ICD of the F and HN protein. (B) Vero cells, (C) Su.86.86 and (D) AsPC-1 were inoculated at an MOI of 0.05 in triplo. Supernatant samples were collected at the indicated time points and titrated. Means and standard deviations of triplicates of a representative experiment are plotted. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test as compared to NDV F3aa-S- STOPV2). (E) The indicated HPACs were inoculated at an MOI of 10 in triplo. The percentage viable cells was determined by an LDH cytotoxicity assay. Results are represented as percentage viable cells compared to mock, which were considered 100% viable. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted.

Characterization of NDV F3aa-(S)-STOPV mutants.

(A) Schematic representation of the nucleotide sequence of the TIS and amino acid substitution of the ICD of the F and HN protein. (B) Vero cells, (C) Su.86.86 and (D) AsPC-1 were inoculated at an MOI of 0.05 in triplo. Supernatant samples were collected at the indicated time points and titrated. Means and standard deviations of triplicates of a representative experiment are plotted. The AUC was used for statistical analysis. * = p <0.05, ** = p<0.01, *** = p<0.001 (one-way ANOVA + paired t-test as compared to NDV F3aa-S- STOPV2). (E) The indicated HPACs were inoculated at an MOI of 10 in triplo. The percentage viable cells was determined by an LDH cytotoxicity assay. Results are represented as percentage viable cells compared to mock, which were considered 100% viable. The experiment was conducted two times. Means and standard deviations of triplicates of a representative experiment are plotted. In Vero cells, the replication of NDV F3aa-S-STOPV2-TIS and NDV F3aa-S-STOPV2-ICD was attenuated compared to NDV F3aa-S-STOPV2 but the viruses reached similar end titers (Fig 5B). In contrast, in the HPAC cell line Su.86.86, replication of NDV F3aa-S-STOPV2-ICD was slightly higher than that of NDV F3aa-S-STOPV2 and F3aa-S-STOPV2-TIS (Fig 5C). In ASPC-1 cells, replication of both NDV F3aa-S-STOPV2-TIS and NDV F3aa-S-STOPV2-ICD was higher than that of NDV F3aa-S-STOPV2 (Fig 5D). The higher replication of NDV F3aa-S-STOPV2-TIS and NDV F3aa-S-STOPV2-ICD in ASPC-1 cells as compared to NDV F3aa-S-STOPV2 did not result in increased cell death of these HPACs. Only in 2 of the HPACs (Su.86.86 and HPAFII), inoculation with NDV F3aa-S-STOPV2-TIS and NDV F3aa-S-STOPV2-ICD resulted in more cell death than inoculation with NDV F3aa-S-STOPV2. Inoculation of CFPAC and Capan-2 cells resulted in more cell death after inoculation with NDV F3aa-S-STOPV2-TIS than upon inoculation with NDV F3aa-S-STOPV2 or NDV F3aa-S-STOPV2-ICD (Fig 5E). In the other HPACS virus induced cell killing was similar for the three viruses. Thus, the introduced mutations in the F and HN genes of the NDV F3aa-S-STOPV2 virus improved virus replication and cell killing of NDV F3aa-S-STOPV2 somewhat, but not consistently across all cell lines tested. Examination of the virulence in embryonated chicken eggs demonstrated that NDV F3aa-S-STOPV2-TIS and NDV F3aa-S-STOPV2-ICD did not kill chicken embryos (MDT >160 hours, Table 1). These observations were similar to those seen for the parental NDV F3aa-S-STOPV2 virus, indicative of the nonvirulent phenotype of NDV F3aa-S-STOPV2-ICD and NDV F3aa-S-STOPV2-TIS viruses. The virulence in duck eggs was not investigated for NDV F3aa-S-STOPV2-TIS and NDV F3aa-S-STOPV2-ICD.

Discussion

Oncolytic viro immunotherapy, based on OVs, is rapidly gaining interest in the field of immunotherapy against cancer. Due to significant virulence associated with the use of some of the human pathogens, animal viruses have been explored as an alternative, with NDV being one of them. NDV does not cause disease in humans, the virus does not interact with the host cell DNA, cellular genome integration is impossible, and the virus can efficiently and selectively replicate in tumor cells. In addition, NDV has been shown to be very safe upon high dose administration in humans, with no serious adverse events noted in early clinical trials. The results of early trials with NDV have been relatively disappointing, but with the advent of recombinant DNA techniques it has become possible to genetically engineer NDV and interest in the use of recombinant NDV (rNDV) as an oncolytic virus has revived over the last decade. One of the advantages of NDV is that genetic engineering of the genome is relatively easily, and the genome is forgiving for the acceptance of foreign genes. However, the limitation of using NDV is their potential to become virulent avian species. Although, several studies have demonstrated the safety and efficacy of lentogenic NDV F0 in clinical trials [1, 2], the use of mesogenic NDV F3aa resulted in higher oncolytic efficacy in vitro and in vivo. [8] the use of such a strain in oncolytic viral therapy could theoretically pose a risk for poultry due to the possible shedding of virus by treated patients [3, 4]. To avert any risks of outbreaks with NDV F3aa, we aimed to develop a virus that has oncolytic potential but does not cause disease in avian species. To this end, we abrogated the expression of the V protein, a specific avian IFN antagonist, by mutation of the stutter site and introduction of several stop codons in the ORF of the V protein, yielding viruses NDV F3aa-STOPV1 and NDV F3aa-STOPV2, and evaluated the genetic stability and their virulence in vitro and in ovo. Analyses of the genetic stability upon passaging the mutant viruses in chicken and mammalian cells revealed that the mutations introduced in the V protein ORF were genetically stable. However, during passaging in Vero cells, a F-117-S substitution in the MBCS of the F protein was observed. Introduction of this substitution in NDV F3aa and NDV F3aa-STOPV2 resulted in increased virus replication, fusion activity and cell death in Vero cells, but not in increased cell death in most HPAC cell lines. Our fusion experiment results are in agreement with previously reported data on the characterization of NDV with the F-117-S substitution in in vitro experiments showing that F-117-S resulted in higher fusion activity in HT1080 and Hela cells. However, in that study, the NDV 73 T strain with the F-117-S substitution had an intracerebral pathogenicity index (ICPI) of 1.05 in chickens, substantially higher than the ICPI of 0.13 for the wild type virus [22]. In contrast, in our study the LaSota variant of NDV F3aa-S had a slightly delayed MDT of chicken and duck embryos as compared to NDV F3aa, indicative for a slightly lower virulence. These observed differences in virulence might be due to the use of different methods for determining the virulence of NDV, e.g. MDT vs ICPI or due to differences between the NDV LaSota and NDV 73 T strains. The NDV F3aa-STOPV viruses displayed attenuated replication in avian and human cells. This attenuation was more pronounced in IFN-pretreated chicken cells. In addition, inoculation of chicken cells with the NDV F3aa-STOPV viruses induced higher IFN mRNA levels than the virus with an intact V protein, but this difference was not observed in human cells. Multiple studies have reported comparable results on viruses with a single mutation in the stutter site or introduction of a single stop codon in the V protein ORF, which led to increased susceptibility to IFN [18, 24, 27]. Our results are in agreement with these studies and confirm that the disruption of the V protein ORF attenuates NDV, likely due to increased IFN sensitivity in vitro. Similar results were obtained upon inoculation of chicken eggs, in which reduced virus titers were observed for NDV without a V protein [24]. Our study demonstrated that NDV F3aa-STOPV viruses were attenuated in both chicken and duck eggs. Virus titers for NDV F3aa-STOPV were slightly higher in young eggs as compared to older eggs, which is in agreement with the fact that older eggs produce IFN, suggesting that the attenuation in ovo is also based on increased IFN sensitivity. Based on the analyses of the MDT of eggs, both the NDV F3aa-STOPV and F3aa-S-STOPV should be considered as nonvirulent (lentogenic) viruses, compared to the mesogenic NDV F3aa and NDV F3aa-S viruses. Several studies have reported that eggs inoculated with viruses containing only a single stop codon in the V protein ORF had a similar or slightly higher MDT than eggs inoculated with the wild type virus [19, 28]. This difference in MDT in our study might be the result of additional amino acid substitutions in the W protein of our NDV F3aa-(S)-STOPV viruses. The function of the W protein has not been studied extensively, but it has been shown that the protein is expressed and does not function as an IFN antagonist [19, 29]. The attenuation of the NDV F3aa-STOPV viruses for poultry cells and eggs indicate that these viruses can be safely evaluated in oncolytic viral therapies. However, it is not known yet whether NDV F3aa-STOPV is able to cause disease in adult chickens. This is important information for the unlikely event that treated patients spread virus to birds. In addition, at present, all NDV strains which possess an MBCS in their fusion protein, or have an ICPI above 0.7, are considered to be select agents. Like the virulence in adult chickens, the ICPI has not been determined yet for the NDV F3aa-STOPV viruses. Based on the MDT, it is expected that these viruses have an ICPI lower than 0.7, classifying the viruses as lentogenic. However, the presence of an MBCS in the fusion protein, would still categorize the virus as virulent. Perhaps, an attenuated strain of a virus with an MBCS could be approved for viro-immune-therapy studies by the regulatory instances when virulence studies indicate the attenuated nature of these viruses. Although the NDV F3aa-(S)-STOPV viruses were slightly attenuated in mammalian cells, these viruses were still able to replicate in the HPACs and induced cell death. Mutating the ICD of the F protein or the TIS of the F and HN proteins slightly improved virus replication of the NDV F3aa-S-STOPV2 virus in HPACs, but not to similar levels as those of NDV F3aa. The improved replication of the ICD mutant in AsPC-1 is in line with previously reported studies [21]. In addition, the introduction of the TIS mutation in NDV F3aa-S-STOPV2 did increase virus induced cell death in some HPACs. Additional adaptations of these viruses, such as the incorporation of immune modulatory genes to increase anti-tumour responses, may further improve the therapeutic efficacy of our NDV mutants [30]. Taken together, our data indicate that NDV F3aa(-S)-STOPV viruses are attenuated for avian species but are perhaps over-attenuated to kill tumour cells as efficiently as NDV F3aa. This attenuation was not completely overcome with the introduced mutations (TIS, ICD) investigated in this study. Further adaptations and in vivo studies are necessary to confirm the safety and effectivity of NDV F3aa-STOPV viruses in oncolytic viral therapies in the future.

Methods

Cell lines

The avian cell lines DF-1 and QT6 were both obtained from the American Type Culture Collection. DF-1 cells were cultured at 39°C in Dulbecco’s Modified Eagle’s Medium (DMEM, Lonza, The Netherlands) supplemented with 100 U ml-1 penicillin, 100 U ml-1 streptomycin, 2mM L-glutamine (PSG) and 10% Hyclone Characterized Fetal Bovine serum (FBS HC, Thermo Fischer Scientific, The Netherlands). QT6 cells were cultured at 37°C in Medium 119 (Lonza) supplemented with PSG, 5% FBS HC, 1% chicken serum (Sigma-Aldrich, Germany) and 5% tryptose phosphate broth (MP Biomedicals, Belgium). BSR-T7 (kind gift of K. Conzelmann) were cultured in DMEM supplemented with PSG and 10% FBS FC at 37°C. A549 were cultured in HAM’s F-12 (GIBCO, Life Technologies, The Netherlands). Vero cells and human pancreatic adenocarcinoma cell lines were cultured as previously described [31]. In case of virus infection experiments, 2% FBS was used in all media (infection media).

Cloning of recombinant viruses

The reversed genetics system for the NDV LaSota strain has been described before and was kindly provided by Ben Peeters from the Central Veterinary Institute of Wageningen, The Netherlands [32]. To introduce mutations in the V ORF a subclone was generated, using the unique digestion sites Sac-II and Not-I. The V protein with introduced mutations coding for stop codons (NDV F3aa-STOPV1 or STOPV2, Fig 1B) was ordered at Integrated DNA Technologies (IDT, Iowa) and inserted via PCR-cloning using the V protein specific insertion primers (Table 2) as described in Liu, 2008 [33]. Additional mutations were introduced by side-directed mutagenesis as described before using specific primers (Table 2) [8]. Subsequently, the different subclones were cloned back to the full-length construct and sequenced for their correctness using a 3130xL Genetic Analyzer (Life Technologies).
Table 2

Primers used for cloning.

ConstructPrimerSequence 5’- 3’
Delete V F GCAATAAATCGTCCAATGCTGGTTGACTATCAGCTAGATC
R GATCTAGCTGATAGTCAACCAGCATTGGACGATTTATTGC
Insert ΔV1 F GCAATAAATCGTCCAATGCTAAGAAGGGCCCCTGGTCTAG
Insert ΔV2 F GCAATAAATCGTCCAATGCTAAGAAAGGCCCCTGGTCTAG
Insert ΔV1/ ΔV2 R GATCTAGCTGATAGTCAACCTTACTAACCCTTTGCGAAATAG
* SDM F117S F AATAATGGCGCCTATAGAGCGCCTCTGTCTCCG
R GGAGACAGAGGCGCTCTATAGGCGCCATTATT
SDM ICD F CTAGCATGCGCCCTAATGTAC
R GTACATTAGGGCGCATGCTAG
SDM TIS F F CGCCCTCCAGGGCCACCATGGGCTCCAGACC
R GGTCTGGAGCCCATGGTGGCCCTGGAGGGCG
SDM TIS HN F CACCGACAACAGTCCGCCACCATGGACCGCGC
R GCGCGGTCCATGGTGGCGGACTGTTGTCGGTG
Sequence analysis V F GGGTAAACCAGCAGAG
R CTTGCTTAGGAGCTTGGC
Sequence analysis MBCS F GGCCAAGATACTCTGGAG
R GTAAAGTGCCTGAATAG

*SDM: site directed mutagenesis

*SDM: site directed mutagenesis

Sequencing

RNA was extracted from the virus stocks using the High Pure RNA isolation kit (Roche Diagnostics, The Netherlands) according to manufacturer’s instructions. cDNA was produced as described before using the Superscript III Reverse Transcriptase kit (Invitrogen, Thermo Fischer) [34]. Primers (Table 3) were used to amplify seven overlapping parts of the genome using Pfu Ultra II Fusion HS NA Polyemarase (600674, Agilent technologies, USA) followed by purification using the MinElute Purification Kit (Qiagen, Germany). Sequence primers were used to sequence the V gene and the MBCS of the F gene using a 3130xL Genetic Analyzer (Life Technologies) (Table 2).
Table 3

Amplification primers.

FunctionAmplicon sizePrimerSequence 5’- 3’
Amplicon 1 2232F ACCAAACAGAGAATCCGTGAGTTACG
R GTTGCTTGCTCCGGTCCTGAG
Amplicon 2 2340F CAGCATGGGAGAAGCATGGGAG
R GGATTGTATTTGGCAAGGGTGTGCC
Amplicon 3 2172F GCCAAGATACTCTGGAGTCAAACCG
R GCTTCACCGACAACAGTCCTC
Amplicon 4 2404F GTGTGAAAGTTCTGGTAGTCTGTCAG
R GGAAGCGGTAGCCCAGTTAATTTCC
Amplicon 5 2375F GTGGCAATGAGATACAAGGCAAAACAGC
R GGCTTGATGCAACTGTGTCAACACC
Amplicon 6 2421F GCCAGAAGCTATGGACAATGATCTC
R CTGCAAGTTGGTGTGATCCGTCATG
Amplicon 7 3298F GAAGTGCTCCTCGACTGTTCTTACC
R ACCAAACAAAGATTTGGTGAATGACGAGAC

Rescue and passaging of recombinant viruses

Recombinant NDVs were rescued by transfecting BSR-T7 cells with 5 μg full length NDV plasmid, 2.5 μg pClneo-NP, 1.25 μg pCleo-P and 1.25 μg pClneo-L using 8 nM calcium phosphate. Three days later, BSRT-7 cells were scraped and co-cultured with Vero cells. After 5 days, co-cultures were harvested and used to generate passage 1 in Vero cells. Titrations were done in Vero cells as described before [8]. Passage 2 was produced in Vero cells using an MOI 0.01, titrated and stored at -80°C. In case of NDV F0, BSRT-7 cells were scraped, and the cell suspension was then inoculated in to 10-day old eggs. Following passages were produced in Vero cells in the presence of 2 μg/ml TPCK-treated Trypsin (T1426, Sigma-Aldrich). For all experiments virus stocks from passage 2 were used unless indicated otherwise. The titer of the virus stocks was determined by end-point titration in Vero cells, calculated using the method of Reed & Muench and expressed as TCID50 ml−1 [35].

Replication kinetics

For all cell types, one million cells were seeded in 6-well plates (Corning). The next day, cells were inoculated at the indicated multiplicity of infections (MOIs) and after 1h incubation cells were washed three times with phosphate buffered saline (PBS) and cell-specific media was added. In case of IFN pre-treatment, cells were pretreated for 24h with 30 μg/ml chicken IFN-β (abx067344, Abbexa, UK). At the indicated time points, 100 μl supernatant was collected and stored with 25% sucrose (w/w) at -80°C. Subsequently, collected samples were titrated in Vero cells. To this end, 24- well plates (Corning, The Netherlands) were seeded with 200.000 cells per well and inoculated with virus and supernatant was collected 48 hours after washing. All samples for the NDV F0 virus were titrated in media supplemented with 2 μg/ml TPCK-treated Trypsin (T1426, Sigma-Aldrich).

Replication kinetics in ovo

Embryonated chicken and duck eggs of various ages were inoculated in the allantoic cavity with 100 μl 1E6 TCID50/ml virus. After 48 hours incubation at 37°C, the allantoic fluid was harvested and stored at -80°C until titration in Vero cells as described before, using infection media without trypsin supplementation.

Determination of virus induced IFN-β mRNA expression levels

DF-1 or A549 cells were seeded in 24-well plates (Corning) and inoculated at an MOI of 0.01 (DF-1) or 1 (A549). In case of A549 cells, spin-inoculation (800xg, 10 min) was applied [36]. After 1 hour, cells were washed once with PBS and fresh infection media was added. Subsequently, cells were incubated for 24 hours and RNA was isolated according to the manufacturer’s instructions. In addition, cells were treated with trypsin-EDTA (Lonza) and fixed in Cytofix/Cytoperm (BD, The Netherlands) for flow cytometry analysis according the manufacturer’s instructions. After fixation, cells were incubated in 1% normal goat serum (MP Biomedicals) and stained with 1:1000 anti-NDV (ab34402, Abcam, UK) and 1:1000 secondary FITC-labelled antibody (ab6749, Abcam) and analyzed by FACS Canto (BD) to determine the percentage of infected cells. qRT-PCR (45 cycles) was performed using 5 μl RNA in an ABI PRISM 7500 sequence Detection System (Life Technologies) using TaqMan gene expression assay for human IFN-β, chicken IFN-β and chicken β-actin (Hs00277188, Gg03344129, Gg03815934, Thermo Fischer Scientific). Human β-actin primers have been described before [31]. Results are shown as fold change of inoculated samples versus mock-inoculated samples both corrected for the household gene actin-β, calculated using the 2-ΔΔT method [37].

Cytotoxicity assay

HPAC cell lines were seeded in 96-well plates (Greiner) and inoculated at the indicated MOIs. After 1 hour, cells were washed once with PBS and fresh infection media was added. A lactate dehydrogenase assay (Promega, The Netherlands) was used to determine cell viability as described before [31].

Fusion assay

One million cells were seeded in 6-well plates (Corning) and inoculated at an MOI of 1. After 1 hour, cells were washed once with PBS and fresh infection media was added. Subsequently, cells were incubated for 16 hours and fixed with 4% PFA. The cells were then stained with Giemsa (HX71780604, Millipore) and the fusion index was determined by averaging the number of nuclei of 30 fusion foci.

Mean death time assay

Ten-day-old embryonated specific pathogen free (SPF) chicken eggs were inoculated with 100 μl 1E6 TCID50/ml virus and incubated at 37°C for up to 160 hours. All eggs were candled every 8 hours to determine whether the embryo was still alive.

Raw data used for Figs 1, 2, 3, 4 and 5 provided in separated tabs.

(XLSX) Click here for additional data file. 7 Jan 2022
PONE-D-21-05320
Optimizing environmental safety and cell-killing potential of oncolytic Newcastle Disease virus with modifications of the V, F and HN genes
PLOS ONE Dear Dr. van den Hoogen, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please integrate the suggestions brought forward by the reviewer into the manuscript. Where this might not be possible, please discuss the reasons.
 
Furthermore, please expand the discussion part of the manuscript, which is currently still too short. Please add two paragraphs there:
1. Please explain the limitations of your results in detail.
2. Please discuss what advantages and disadvantages NDV might have in comparison to other oncoloytic viruses.
Please submit your revised manuscript by Feb 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Michael C Burger, M.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: "We would like to acknowledge the support from the Dutch Foundation OAK (“Overleven with alvleesklierkanker”) and NWO-TTW grant #15414 (NWO-domein Toegepaste en Technische Wetenschappen)." We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "JFG and DG obtained funding from the Dutch Foundation “Overleven with alvleesklierkanker”; https://www.supportcasper.nl/nl/over-support-casper/stichting/ RF and SN obtained funding from  NWO-TTW grant #15414 (NWO-domein Toegepaste en Technische Wetenschappen; https://www.nwo.nl/toegepaste-en-technische-wetenschappen-ttw). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 5. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. 6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript “Optimizing environmental safety and cell-killing potential of oncolytic Newcastle Disease virus with modifications of the V, F and HN genes” is a well-reported high-quality study. The goal of the study is to make the Newcastle disease virus (NDV) less harmful to poultry, while maintaining its oncolytic properties. Achieving this goal is difficult, and the study's authors along with some other researchers took up the challenge. The authors of the study create NDV constructs that disrupt the translation of the viral protein V, which is responsible for blocking the interferon response in avian host cells. The disruption occurs by introducing one- or two-point mutations in the stutter site and introducing several stop codons into the gene encoding the V protein, without damaging the translation of another viral gene, which is partially translated from another coding frame. Next step, which is described in the manuscript, includes verification through multiple experiments, that this disruption indeed makes the viral constructs less infectious for avian cells and embryos. After this step, the authors through multiple virus passaging checked the genetic stability of mutants. By monitoring the frequency of reverse mutations, they found that the created mutants do not return to the original variant with an intact V gene, but after passaging in human cells they developed another frequent mutation, leading to one amino acid change in viral F-gene. However, this unexpected gain of function for F gene manifest itself in better viral fusogenic activity of human cells, but not in higher virulence for avian cells or embryos. Thus, the authors concluded that created viral constructs are attenuated and less virulent for avian species. Unfortunately, screening in various cancers cell lines demonstrated that the constructs to same degree lost their oncolytic properties. Some cells line demonstrated less sensitivity to viral infection by created constructs. To solve this problem, further genetic engineering was carried out, which led to an improvement in the oncolytic properties of the constructs without gaining avian virulence. Consequently, there are more gains compared to losses. While the best tradeoff between avian virulence and oncolytic virus properties is still to come for NDV, the authors of the manuscript have made valuable contributions to this area by better pinpointing the genes that are the main players in the game. Moreover, some developed NDV constructs are candidates for preclinical studies in animals. In my opinion, the main claims of the article are supported by the evidence provided. The conclusions, together with the information that supports these conclusions, serve the research area of oncolytic viruses well. I think that the scientific context of the study and previous research are well presented. The experimental work is logical, each step is justified, and the results are well communicated. However, I do suggest some improvements. Major: Discussion section The authors use Vero cells to titrate variable viral constructs grown in different cancer cell lines. However, they show that in Vero cells, different constructs grew with variable efficiency (Fig. 4D). For example, there was a significant difference in growth curves for the NDV3aa and NDV 3aa stop V constructs. This difference in growth curves indicates that titration of Vero cells may cause some experimental error. Consequently, experimental measurements of the titers of viruses produced in different cell lines systematically introduce some bias. Perhaps the weak correlation between the efficacy of malignant cells killing efficiency by the viral constructs and their titer measured in Vero can to some extent can be explained by this introduced bias. I think it would be nice if the authors paid attention to this issue in the discussion section. Minor: Annotation The text is duplicated in the annotation on the first page of the pdf file. Introduction The Introduction section can be improved by adding one or more sentences to indicate the mechanism by which the V gene acts as an alpha interferon antagonist in avian cells and why the mechanism appears to be species specific. Also, other recent studies in relation to oncolytic NDV can be cited such as: “Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy” https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC4934751/ and “Oncolytic Newcastle disease virus activation of the innate immune response and priming of antitumor adaptive responses in vitro” https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC7230062/ Figures 1) Figures would benefit if more information from the legends were added directly to the images. Thus, it will be easier to understand the graphical information if the cell lines, their origin (human or avian) and the names of the viral constructs are indicated directly in the figures, and not in their text legends. 2) Line 471. I think that authors meant “Results are represented as fold change of IFN mRNA transcription in mock versus virus-infected cells versus mock cells.” Otherwise, the sentence is meaningless along with the relevant histogram data, it looks like the mock infected A549 cells produce more interferon compared to the infected ones. 3) What is an explanation for Figure 2 B results? Why NDV F3aa- STOPV1, is less efficiently inhibits interferon mRNA compared to NDV F3aa- STOPV2 in avian DF-1 cells? References There are two weird references 10 and 11 (line 378). Some other minor suggestions and corrections in the attached file. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Olga Matveeva [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
Submitted filename: PONE-D-21-05320-cor.pdf Click here for additional data file. 24 Jan 2022 Comments from the Reviewer: Annotation The text is duplicated in the annotation on the first page of the pdf file. We thank the reviewer for pointing out. We have tried to correct this with the re-submission, but, unfortunately, in the process of building the PDF this happened again. I hope the editor knows how to avoid this. Introduction The Introduction section can be improved by adding one or more sentences to indicate the mechanism by which the V gene acts as an alpha interferon antagonist in avian cells and why the mechanism appears to be species specific. Also, other recent studies in relation to oncolytic NDV can be cited such as: “Genetic Modification of Oncolytic Newcastle Disease Virus for Cancer Therapy” https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC4934751/ and “Oncolytic Newcastle disease virus activation of the innate immune response and priming of antitumor adaptive responses in vitro ”https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC7230062/ We thank the reviewer for this comment, and we have now added text on the function of V and added the references. Line 46: as the V protein efficiently prevents innate host defences, such the type I IFN response as well as apoptosis, in avian cells and not human cells. Line 41: Several studies aimed to lower the virulence of mesogenic NDV-73T strain, while keeping the oncolytic efficacy of the virus, either by changing the cleavage site to that of a non-virulent virus, or by insertion of 198 nt at the HN-L junction. Alternatively, NDV-73T was armed with immune modulatory protein genes such as granulocyte–macrophage colony-stimulating factor (GM-CSF), to increase the oncolytic effect of the virus (REF). Discussion section The authors use Vero cells to titrate variable viral constructs grown in different cancer cell lines. However, they show that in Vero cells, different constructs grew with variable efficiency (Fig. 4D). This difference in growth curves indicates that titration of Vero cells may cause some experimental error. Consequently, experimental measurements of the titers of viruses produced in different cell lines systematically introduce some bias. Perhaps the weak correlation between the efficacy of malignant cells killing efficiency by the viral constructs and their titer measured in Vero can to some extent can be explained by this introduced bias. I think it would be nice if the authors paid attention to this issue in the discussion section. We thank the reviewer for this comment. We thank the reviewers for suggesting possible explanations for the weak correlation between killing efficiency and measured titer in Vero cells. We like to point out that Vero cells are the most susceptible cells for NDV and its variants and is therefore the first choice for titrations. In addition, the method used for titration is an end-point dilution assay, not a replication assay. This means that the input is serial diluted, in theory to 1 virus particle per well, and 5 days after inoculation the wells are scored for positive or negative, allowing sufficient time to detect the presence of virus. As this scoring is based on positive/negative, and not on replication, attenuation in Vero cells would not influence the outcome of the titrations. The possible bias that the reviewer refers to is not always that clearly reflected in Fig 3a and b. While NDV F0 and the NDV F3aa- STOPV viruses reached equal titers in CFPAC, inoculation with F0 induced more cell death that inoculation with STOPV. If titers for the STOPV were underestimated, and if there was a correlation between cell killing efficiency and titers, you would expect higher killing efficiency of STOPV compared to F0 in these cells. Figures 1) Figures would benefit if more information from the legends were added directly to the images. Thus, it will be easier to understand the graphical information if the cell lines, their origin (human or avian) and the names of the viral constructs are indicated directly in the figures, and not in their text legends. We thank the reviewer for the suggestion, and we have changed the figures accordingly. 2) Line 471. I think that authors meant “Results are represented as fold change of IFN mRNA transcription in mock versus virus-infected cells versus mock cells.” Otherwise, the sentence is meaningless along with the relevant histogram data, it looks like the mock infected A549 cells produce more interferon compared to the infected ones. Line 472: the sentence has changed to: “mRNA transcription in virus-infected cells versus mock” 3) What is an explanation for Figure 2 B results? Why NDV F3aa- STOPV1, is less efficiently inhibits interferon mRNA compared to NDV F3aa- STOPV2 in avian DF-1 cells? We think the reviewer means ‘why does stopV1 induces more interferon production than stopV2’, because viruses without expression of V are not able to inhibit interferon production. The difference in induction of interferon production between NDV F3aa-STOPV1 and STOPV2 is likely due to the higher level of attenuation of NDV F3aa-STOPV2 in avian cells. This is shown in the replication kinetics in figure 1C, where at 24 hrs after infection the titers for NDV F3aa-STOPV2 are lower than those of STOPV1. More pronounced is the effect in cells that are pre-treated with interferon (fig2A) or in older chicken eggs, producing interferon, as shown in fig 2D. We added the following lines (line 103): “Inoculation of DF-1 cells with NDV F3aa-STOPV2 resulted in lower IFN IFN-β mRNA expression levels than inoculation with NDV F3aa-STOPV1, which is probably due to the higher levels of attenuation of NDV F3aa-STOPV2 in cells pretreated or producing IFN, as shown in figure 2A”. And at line 116: “underpinning the higher degree of attenuation of NDV F3aa-STOPV2 compared to that of NDV F3aa-STOPV1.” References There are two weird references 10 and 11. References 10 and 11 have now been corrected Some other minor suggestions and corrections in the attached file. We made the changes as recommended by the reviewer. Line 69: “The paragraph is too long. The reviewer suggests to start a new paragraph from the sentence “Recombinant viruses..” (which is now line 77 in revised version) We have started a new paragraph. However, not with the sentence the reviewer referred to, as we think this sentence belongs with the previous paragraph. We did start a new paragraph at line 81, with a new heading for the first paragraph ‘Generation of NDV F3aa lacking V protein expression’ Line 177: we have added the words ‘the viruses’ (line 194 in revised manuscript) Line 215: The paragraph is too long. The text will be easier to understand if it is split into two or more smaller paragraphs. The paragraph (now starting at line 249 in the revised manuscript) has now been split up in two paragraphs (break at line 257). Line 470 (line 514 in revised version) : the sentence has changed to: “mRNA transcription in virus-infected cells versus mock” Comments from the editor: Please expand the discussion part of the manuscript, which is currently still too short. Please add two paragraphs there: 1. Please explain the limitations of your results in detail. 2. Please discuss what advantages and disadvantages NDV might have in comparison to other oncoloytic viruses. We have now added a paragraph on the limitations of our results and a paragraph on the advantages and disadvantages of NDV as oncolytic virus,. 1. Line 270: “However, it is not known yet whether the virus is able to cause disease in adult chickens. This is important information for the unlikely event that treated patients spread virus to birds. In addition, at present, all NDV strains which possess an MBCS in their fusion protein, or have an ICPI above 0.7, are considered to be select agents. Like the virulence in adult chickens, the ICPI has not been determined yet for the NDV F3aa-STOPV viruses. Based on the MDT, it is expected that these viruses have an ICPI lower than 0.7, classifying the viruses as lentogenic. However, the presence of an MBCS in the fusion protein, would still categorize the virus as virulent. Perhaps, an attenuated strain of a virus with an MBCS could be approved for viro immune-therapy studies by the regulatory instances when virulence studies indicate the attenuated nature of these viruses”. 2. Line 212: “Oncolytic viro immunotherapy, based on OVs, is rapidly gaining interest in the field of immunotherapy against cancer. Due to significant virulence associated with the use of some of the human pathogens, animal viruses have been explored as an alternative, with NDV being one of them. NDV does not cause disease in humans, the virus does not interact with the host cell DNA, cellular genome integration is impossible, and the virus can efficiently and selectively replicate in tumor cells. In addition, NDV has been shown to be very safe upon high dose administration in humans, with no serious adverse events noted in early clinical trials. The results of early trials with NDV have been relatively disappointing, but with the advent of recombinant DNA techniques it has become possible to genetically engineer NDV and interest in the use of recombinant NDV (rNDV) as an oncolytic virus has revived over the last decade. One of the advantages of NDV is that genetic engineering of the genome is relatively easily, and the genome is forgiving for the acceptance of foreign genes. However, the limitation of using NDV is their potential to become virulent avian species”. Please ensure that your manuscript meets PLOS ONE’s style requirements. We have made changes accordingly. We note that the grant information you provided in the ‘Funding Information” and “Financial Disclosure” sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. We have corrected this. We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "JFG and DG obtained funding from the Dutch Foundation “Overleven with alvleesklierkanker”; https://www.supportcasper.nl/nl/over-support-casper/stichting/ RF and SN obtained funding from NWO-TTW grant #15414 (NWO-domein Toegepaste en Technische Wetenschappen; https://www.nwo.nl/toegepaste-en-technische-wetenschappen-ttw). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. We have taken out the information on funding in the acknowledgement section. And we have removed the acknowledgement section. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. We have now made the minimal data set available. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper. If the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. The data is not a core part of the research. The described results are in fact depicted in fig 1B. We have now indicated this in the text. Line 79. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. We have reviewed our reference list. We have not cited papers that have been retracted. We have improved reference 10 and 11. Submitted filename: response to reviewers.docx Click here for additional data file. 26 Jan 2022 Optimizing environmental safety and cell-killing potential of oncolytic Newcastle Disease virus with modifications of the V, F and HN genes PONE-D-21-05320R1 Dear Dr. van den Hoogen, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Michael C Burger, M.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 31 Jan 2022 PONE-D-21-05320R1 Optimizing environmental safety and cell-killing potential of oncolytic Newcastle Disease virus with modifications of the V, F and HN genes Dear Dr. van den Hoogen: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Michael C Burger Academic Editor PLOS ONE
  34 in total

1.  A phase 1 clinical study of intravenous administration of PV701, an oncolytic virus, using two-step desensitization.

Authors:  Scott A Laurie; John C Bell; Harold L Atkins; Joanne Roach; Michael K Bamat; James D O'Neil; M Scot Roberts; William S Groene; Robert M Lorence
Journal:  Clin Cancer Res       Date:  2006-04-15       Impact factor: 12.531

Review 2.  An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs.

Authors:  M Kozak
Journal:  Nucleic Acids Res       Date:  1987-10-26       Impact factor: 16.971

3.  Studies on interferon induction by infectious bursal disease virus (IBDV). II. Interferon production in White Leghorn chickens infected with an attenuated or pathogenic isolant of IBDV.

Authors:  J Gelb; C S Eidson; O J Fletcher; S H Kleven
Journal:  Avian Dis       Date:  1979 Jul-Sep       Impact factor: 1.577

4.  Newcastle Disease Virus Establishes Persistent Infection in Tumor Cells In Vitro: Contribution of the Cleavage Site of Fusion Protein and Second Sialic Acid Binding Site of Hemagglutinin-Neuraminidase.

Authors:  Udaya S Rangaswamy; Weijia Wang; Xing Cheng; Patrick McTamney; Danielle Carroll; Hong Jin
Journal:  J Virol       Date:  2017-07-27       Impact factor: 5.103

5.  Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence.

Authors:  B P Peeters; O S de Leeuw; G Koch; A L Gielkens
Journal:  J Virol       Date:  1999-06       Impact factor: 5.103

6.  Pathological and molecular investigation of velogenic viscerotropic Newcastle disease outbreak in a vaccinated chicken flocks.

Authors:  Asok Kumar Mariappan; Palanivelu Munusamy; Deepak Kumar; Shyma K Latheef; Shambu Dayal Singh; Rajendra Singh; Kuldeep Dhama
Journal:  Virusdisease       Date:  2018-04-03

7.  Newcastle disease virus exerts oncolysis by both intrinsic and extrinsic caspase-dependent pathways of cell death.

Authors:  Subbiah Elankumaran; Daniel Rockemann; Siba K Samal
Journal:  J Virol       Date:  2006-08       Impact factor: 5.103

8.  Newcastle disease virus V protein is associated with viral pathogenesis and functions as an alpha interferon antagonist.

Authors:  Zhuhui Huang; Sateesh Krishnamurthy; Aruna Panda; Siba K Samal
Journal:  J Virol       Date:  2003-08       Impact factor: 5.103

9.  Newcastle disease virotherapy induces long-term survival and tumor-specific immune memory in orthotopic glioma through the induction of immunogenic cell death.

Authors:  Carolien A Koks; Abhishek D Garg; Michael Ehrhardt; Matteo Riva; Lien Vandenberk; Louis Boon; Steven De Vleeschouwer; Patrizia Agostinis; Norbert Graf; Stefaan W Van Gool
Journal:  Int J Cancer       Date:  2014-09-19       Impact factor: 7.396

10.  Newcastle Disease Virus V Protein Targets Phosphorylated STAT1 to Block IFN-I Signaling.

Authors:  Xusheng Qiu; Qiang Fu; Chunchun Meng; Shengqing Yu; Yuan Zhan; Luna Dong; Cuiping Song; Yingjie Sun; Lei Tan; Shunlin Hu; Xiaoquan Wang; Xiaowen Liu; Daxin Peng; Xiufan Liu; Chan Ding
Journal:  PLoS One       Date:  2016-02-09       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.