Literature DB >> 35132915

Inhibition of miRNA-100 facilitates bone regeneration defects of mesenchymal stem cells in osteoporotic mice through the protein kinase B pathway.

Zhengqiu Dai1, Guoqiang Wei2.   

Abstract

Osteoporotic patients suffer from bone microstructure damage and are prone to fracture and bone defect. Due to the damage of bone healing ability, the bone repair of osteoporotic patients is usually slow. Here we aimed to explore the function and potential molecular mechanism of miR-100 in osteogenic differentiation ability of bone marrow stem cells (BMSCs). Ovariectomy was performed on mice to induce osteoporosis. BMSCs were extracted from normal and ovariectomized (OVX) mice to examine the effect of microRNA (miR)-100 on BMSC osteogenic differentiation. Hematoxylin and eosin (H&E) staining and safranin O-fast green staining assays were performed on femur tissues to reveal pathological changes. The osteogenic differentiation of BMSCs were determined by Alkaline Phosphatase and Alizarin red staining assays. The results showed that miR-100 expression was significantly upregulated in bone tissues and BMSCs from osteoporotic mice. MiR-100 knockdown partially improved osteogenic function of OVX mice-derived BMSCs. Next, mechanistic target of rapamycin kinase (MTOR) was identified as the target downstream miR-100. MiR-100 deficiency can activate the protein kinase B (AKT)/mTOR pathway. MiR-100 controlled the osteogenic function of BMSCs by the AKT/mTOR pathway. Collectively, our findings demonstrate that inhibition of miR-100 facilitates bone regeneration defects of BMSCs in osteoporotic mice through AKT pathway, indicating that miR-100 might be an effective target for the treatment of osteoporotic mandibular injury and bone defect diseases.

Entities:  

Keywords:  Bone regeneration; bone marrow stem cells (BMSCs); in vivo; miR-100/AKT; molecular mechanism; osteoporosis

Mesh:

Substances:

Year:  2022        PMID: 35132915      PMCID: PMC8974201          DOI: 10.1080/21655979.2021.2015880

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Osteoporosis is a systemic disease characterized by bone mass reduction and bone microstructure destruction, which can affect the whole-body bone, increase bone vulnerability and even cause fracture [1]. The relationship between mandible, a part of the whole-body bone, and fracture osteoporosis, and the effect of osteoporosis on the healing of mandibular bone defect are increasingly studied [2]. Different from the healing process of common fractures and bone defects, the arrangement of collagen fibers in the callus of osteoporotic patients after bone injury is disordered and loose, the number of osteoblasts on the trabecular surface is reduced, and the number of osteoclasts is increased, which leads to the reduction of osteogenic ability and poor bone healing [3]. In recent years, many studies have shown that osteoporosis has a significant negative impact on craniomaxillofacial fracture and bone defect healing [4]. In the previous study, the female osteoporotic rat model was established by ovariectomy (OVX), and unilateral closed fractures in the mandible was stimulated. It was found that the osteoporotic rats had delayed endochondral ossification and increased number of osteoclasts [5]. Although there are more osteoblasts and osteoclasts in the healing of fractures in osteoporotic bone, the number of osteoclasts is dominant. These results suggest that prolonged phase of bone turnover with osteoclast predominance is the cause of delayed healing of osteoporotic mandibular closed fractures [5]. Therefore, to improve the healing of mandibular fracture and defect in osteoporotic patients has become a more and more widespread concern. Bone marrow mesenchymal stem cells (BMSCs), the basic cell unit of embryonic bone formation, have strong self-renewal and osteogenic ability, and play an important role in the healing process after bone injury [6]. BMSCs have been widely used in bone regeneration as a promising medium for tissue regeneration and repair [7]. However, the osteogenic ability of BMSCs in OVX animals is impaired, resulting in delayed healing after bone injury. Therefore, it is of great significance to explore a new way to improve the osteogenic ability of BMSCs under osteoporotic condition. MicroRNAs (miRNAs), as non-coding RNAs with about 20 nucleotides, are widely involved in the biological processes of different diseases by regulating the transcription and translation of downstream target genes or pathways [8]. Previous studies have shown that some miRNAs play positive or negative roles in the regulation of osteoblast differentiation [9]. Meanwhile, some studies have shown that miRNAs play important roles in the proliferation, apoptosis and differentiation of BMSCs [10-12]. In addition, the protein kinase B (AKT) signal pathway is critical in pathogenesis of osteoporosis which is demonstrated by numerous studies [13-15]. A recent paper has shown that the overexpression of miR-19b-3p in BMSCs suppressed its osteogenic differentiation via AKT signaling [16]. Another literature reported that apolipoprotein D alleviates osteogenesis suppression in BMSCs through the AKT pathway [17]. Gene 26s protease regulatory subunit 10b has been indicated to aggravate OVX-induced osteoporosis by inhibiting the AKT signal transduction pathway [18]. Thus, AKT signal pathway was investigated in OVX mice-derived BMSCs in our experiment. MiR-100, namely miR-100-5p, can enhance MSC osteogenesis [19] and be used to bias MSC fate [20]. Moreover, previous studies have confirmed that the expression of miR-100 is significantly upregulated in plasma, serum, and bone tissue of patients with osteoporosis [21-23]. We made a hypothesis that miR-100 controls BMSC osteogenesis and is involved in osteoporosis and aimed to reveal the role of miR-100 in osteogenic differentiation of OVX mice-derived BMSCs. Our findings might provide a novel insight into stem cell-based therapy in bone injury-associated diseases by gene modification.

Materials and methods

Animal feeding conditions and model construction

Female C57BL/6 J mice (6–8 weeks, 0–25 g) were housed at 25°C (air condition) under a 12-h light/dark cycle in standard rodent cages. During the experimental period, all mice were allowed free access to distilled water and standard chow. The distilled water and standard rat chow were provided every day. After a week of acclimatization, mice were randomly divided into sham operation group (bilateral laparotomy) and OVX group (bilateral ovariectomy) after being anesthetized. After the surgical procedures, the animals were monitored during the recovery period to help confirm surgical recovery. Tibias of OVX and sham-operated mice were taken and fixed in paraformaldehyde until analysis. The success of osteoporosis model was confirmed by CT analysis and bone volume/total volume (BV/TV) results of distal femur.

Histological analysis

After decalcification with 10% Ethylene Diamine Tetraacetic Acid, the distal femurs were embedded in paraffin and sectioned coronally into 5 μm slices. The sample slides were stained with hematoxylin and eosin (H&E) staining and safranin O-fast green.

Isolation, culture, and administration of BMSCs

The BMSCs were mainly isolated from the bone marrow of tibia and femur of control or ovariectomized mice at 56-day after operation and cultured according to the previous study [24]. The BMSCs derived from sham and OVX-operated mice were termed sham-BMSCs and OVX-BMSCs, respectively. In brief, after euthanasia, the hind limbs of mice in both groups were disinfected with 75% alcohol, then the soft tissues were removed, and the bone marrow was washed repeatedly in α-Minimum Essential Medium (α-MEM; Invitrogen, CA, USA) containing 10% fetal bovine serum (FBS; Gibco, CA, USA) and 1% penicillin/streptomycin (Beyotime, Wuhan, China). The obtained bone marrow culture medium was inoculated into the culture bottle and cultured in humidified air containing 5% CO2 at 37°C. The cultured cells were passaged to 3–5 passages for further experiments. Flow cytometry analysis sorting was conducted to screen BMSCs which were positive for CD44 and CD29 but negative for CD45 (Supplementary Figure S1). Next, miR-100 inhibitor was transfected into BMSCs with or without AKT inhibitor Honokiol for 48 hours using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis

TRIzol reagent (Invitrogen) was used to extract total RNA from tissues and cells. After RNA concentration was detected, a prime script RT Kit (Takara, Dalian, China) was used for reverse transcription. The expression of Alkaline Phosphatase (ALP), osteocalcin (OCN) and miR-100 was detected by RT-qPCR according to the protocol. The specific RT-qPCR cycle was as follows: 3 min at 95°C, 15 s at 95°C, 30 s at 60°C, 40 cycles. The SDS 1.3.1 (Sequence Detection Software) was used to create a relative quantification plate. The internal control of ALP and OCN was β-actin, while the internal control of miR-100 was U6. The specific primer sequence is shown in Table 1.
Table 1.

Information of primers used in PCR

TargetsPrimers (5ʹ-3ʹ)
ALPFGGGACTGGTACTCGGATAACGA
RCTGATATGCGATGTCCTTGCA
OCNFAAGCAGCAACGCTAGAAGACAG
RGCGCCGGAGTCTGTTCACTA
MTORFGAGTGATGCAGCTCTTTGG
 RGTATCTCTGGATGCTGAGGT
MiR-100FGAGGAACCCGTATCCGAA
RTAACCACCACACCAAACACA
U6FCTTGCTCCTCTTGGTCTGG
RCTGGTCTCATGCCTGGG
β-actinFCTGTCCCTGTATGCCTCTG
RTGATGTCACGCACGATTT
Information of primers used in PCR

Western blot

The whole cell lysate was used to collect BMSCs, which were added into EP tube and incubated on ice for 30 minutes. After extracting the protein, the concentration was detected and boiled for 10 minutes, then stored at −20°C for standby. The proteins were separated on 10% SDS polyacrylamide gel electrophoresis and transferred onto the polyvinylidene fluoride (Millipore, Burlington, MA, USA) films. After blocking with 5% BSA for 2 hours, the membranes were incubated with primary antibodies overnight at 4°C. The primary antibody information is as follows: AKT, p-AKT (S473), p-AKT (T308), β-actin (Cell Signaling Technology, MA, USA), p-mTOR, mTOR (Abcam), ALP and OCN (Santa Cruz, Dallas, USA). After 2 hours of incubation with the secondary antibody (Cell Signaling Technology, MA, USA), ECL luminescent solution was used for exposure, and the gray value to reveal protein expression was analyzed by the ImageJ software.

Luciferase assay

The 293 T cell line was obtained from ATCC. The wild-type (Wt) or mutated (Mut) 3ʹUTR of MTOR that has the complementary binding site with miR-100 was subcloned into the pmirGLO vectors to generate MTOR 3ʹUTR-Wt or MTOR 3ʹUTR-Mut plasmids, which were cotransfected with miR-100 inhibitor into 293 T cell line using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. After 48 h of transfection, luciferase activity was detected by a dual-luciferase reporter assay system (Promega, San Luis Obispo, CA). Renilla luciferase activity was normalized to Firefly luciferase activity.

Alizarin red staining

The miR-100 inhibitor transfected BMSCs in normal group and OVX group were treated with or without Honokiol for 48 hours. After the supernatant was discarded, the cells were washed with calcium free PBS three times. Next, the BMSCs were fixed with 4% paraformaldehyde for 30 min, then fixed with anhydrous ethanol for another 20 min, and finally stained with 1% alizarin red solution for 10 min to show the deposition of matrix minerals.

ALP staining

ALP staining was performed after culturing in bone marrow culture medium for three days. BMSCs were washed with PBS three times and fixed with 4% paraformaldehyde for 15 minutes. After washing, BMSCs were stained with a BCIP/NBT ALP Color Development Kit (Beyotime, Shanghai, China) based on the manufacturer’s protocols.

Statistical analysis

All data in this study were expressed as mean ± standard deviation (SD) using SPSS 17.0. T test was used to analyze difference comparison between the two groups. Univariate or two-way analysis of variance (ANOVA) and Bonferroni multiple comparison test were used to analyze the significant difference among three or more groups. Pearson correlation analysis was conducted for evaluation of expression correlation between miR-100 and MTOR in femur tissues of OVX mice. P value less than 0.05 was considered statistically significant.

Results

MiR-100 expression was upregulated in bone tissues and BMSCs in osteoporotic mice

To investigate the role of miR-100 in osteoporosis, we first constructed a mouse model of osteoporosis by OVX operation and assessed the expression of miR-100 in bone tissue of osteoporotic mice. BV/TV was used to verify the successful construction of the model at 8 weeks (Figure 1a). H&E staining and safranin O-fast green staining showed that the bone trabeculae of OVX mice was decreased compared with control mice (Figure 1b and c). By RT-PCR analysis, we found that the expression of ALP and OCN in bone tissue and BMSCs of OVX mice was decreased significantly, which further proved the successful establishment of osteoporotic mice (Figure 1d and e). Furthermore, we found that the expression of miR-100 was significantly higher in OVX mice and OVX-BMSCs than that in control mice (Figure 1f).
Figure 1.

MiR-100 is upregulated in bone tissues and BMSCs of OVX mice. (a) OVX induced osteoporosis in mice was confirmed by detecting BV/TV. (b-c) H&E and safranin O-fast green staining of femur tissues from control mice and OVX mice. (d-e) RT-PCR analysis was used to determine the expression of ALP and OCN in sham and bone tissues and BMSCs of OVX mice. (f) RT-PCR analysis was used to determine the expression of miR-100 in sham and OVX bone tissues and BMSCs of OVX mice. All experiments were carried out three times independently. The error bar indicates SD. ***p < 0.001.

MiR-100 is upregulated in bone tissues and BMSCs of OVX mice. (a) OVX induced osteoporosis in mice was confirmed by detecting BV/TV. (b-c) H&E and safranin O-fast green staining of femur tissues from control mice and OVX mice. (d-e) RT-PCR analysis was used to determine the expression of ALP and OCN in sham and bone tissues and BMSCs of OVX mice. (f) RT-PCR analysis was used to determine the expression of miR-100 in sham and OVX bone tissues and BMSCs of OVX mice. All experiments were carried out three times independently. The error bar indicates SD. ***p < 0.001.

MiR-100 knockdown partially improved osteogenic function of OVX-BMSCs

To explore the effect of miR-100 in osteogenesis of OVX-BMSCs, we transfected the sham-BMSCs and OVX-BMSCs with miR-100 inhibitor for 48 hours and determined the mRNA and protein levels of ALP and OCN. RT-PCR analysis results showed that the expression of miR-100 was decreased significantly by miR-100 inhibitor (Figure 2a). Furthermore, RT-PCR and Western blot analysis showed that the expression of ALP and OCN in OVX-BMSCs was decreased significantly by miR-100 inhibitor at transcriptional and translational levels in OVX-BMSCs. MiR-100 inhibitor caused no significant effects on ALP and OCN levels in sham-BMSCs (Figure 2b–d). In addition, Alizarin red staining results demonstrated that calcium deposition was markedly reduced in OVX-BMSCs compared with sham-BMSCs and was increased after 48 hours of miR-100 inhibitor treatment. MiR-100 inhibitor had no significant effects on calcium deposition in sham-BMSCs (Figure 2e). OVX induced the decrease of ALP staining in BMSCs. MiR-100 inhibitor increased ALP staining in OVX-BMSCs but not sham-BMSCs (Figure 2f).
Figure 2.

MiR-100 inhibition rescues the osteogenic function of OVX-BMSCs. (a) The expression of miR-100 was detected using RT-PCR analysis. (b-c) The ALP and OCN expression in sham-BMSCs and OVX-BMSCs was detected via RT-PCR analysis. (d) Alizarin red staining was performed to examine the calcium deposition. (e-f) ALP staining of sham-BMSCs and OVX-BMSCs with or without transfection of miR-100 inhibitor. All experiments were carried out three times independently. The error bar indicates SD. **p < 0.01; ***p < 0.001.

MiR-100 inhibition rescues the osteogenic function of OVX-BMSCs. (a) The expression of miR-100 was detected using RT-PCR analysis. (b-c) The ALP and OCN expression in sham-BMSCs and OVX-BMSCs was detected via RT-PCR analysis. (d) Alizarin red staining was performed to examine the calcium deposition. (e-f) ALP staining of sham-BMSCs and OVX-BMSCs with or without transfection of miR-100 inhibitor. All experiments were carried out three times independently. The error bar indicates SD. **p < 0.01; ***p < 0.001.

MiR-100 targets MTOR

According to TargetScan prediction, 25 targets of miR-100 were identified (Table 2). We focused on MTOR due to its close association with the AKT pathway. MTOR expression was lower in femur tissues and BMSCs from OVX mice than that from control mice (Figure 3a). MiR-100 inhibitor induced the upregulation of MTOR at the mRNA and protein levels (Figure 3b). The binding site of miR-100 and MTOR was conserved among many mammals (Figure 3c). Luciferase activity of MTOR 3ʹUTR-Wt was increased by miR-100 inhibitor in 293 T cells, while that of MTOR 3ʹUTR-Mut was not significantly influenced by miR-100 inhibitor (Figure 3d). Moreover, according to result of Pearson correlation analysis, there was a negative expression correlation between miR-100 and MTOR in femur tissues of OVX mice (Figure 3e).
Table 2.

Targets of miR-100 based on TargetScan prediction

Gene symbolRepresentative transcriptGene name
EPDR1ENST00000423717.1Ependymin related 1
HS3ST2ENST00000261374.3Heparan sulfate (glucosamine) 3-O-sulfotransferase 2
KBTBD8ENST00000295568.4Kelch repeat and BTB (POZ) domain containing 8
FKBP5ENST00000536438.1FK506 binding protein 5
SMARCA5ENST00000283131.3SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
MTORENST00000376838.1Mechanistic target of rapamycin (serine/threonine kinase)
FZD8ENST00000374694.1Frizzled family receptor 8
RASGRP3ENST00000402538.3RAS guanyl releasing protein 3 (calcium and DAG-regulated)
CLDN11ENST00000064724.3Claudin 11
TRIB2ENST00000155926.4Tribbles pseudokinase 2
ZBTB7AENST00000322357.4zinc finger and BTB domain containing 7A
TMEM135ENST00000340353.7transmembrane protein 135
ST5ENST00000526757.1Suppression of tumorigenicity 5
PPP1CBENST00000395366.2Protein phosphatase 1, catalytic subunit, beta isozyme
NXF1ENST00000531709.2Nuclear RNA export factor 1
SLC44A1ENST00000374720.3Solute carrier family 44 (choline transporter), member 1
RRAGDENST00000369415.4Ras-related GTP binding D
ZZEF1ENST00000381638.2Zinc finger, ZZ-type with EF-hand domain 1
CYP26B1ENST00000001146.2Cytochrome P450, family 26, subfamily B, polypeptide 1
TAOK1ENST00000261716.3TAO kinase 1
THAP2ENST00000308086.2THAP domain containing, apoptosis associated protein 2
BMPR2ENST00000374574.2Bone morphogenetic protein receptor, type II (serine/threonine kinase)
ZNRF2ENST00000323037.4Zinc and ring finger 2
AGO2ENST00000220592.5Argonaute RISC catalytic component 2
FZD5ENST00000295417.3Frizzled family receptor 5
Figure 3.

MiR-100 targets MTOR. (a) Expression of MTOR in femur tissues and BMSCs from control mice and OVX mice. (b) Expression of MTOR in BMSCs after transfection with miR-100 inhibitor. (c) The binding site of miR-100 and MTOR was conserved among many mammals, as predicted from Targetscan. (d) A luciferase reporter assay was performed to reveal activities in 293 T cells after cotransfection with MTOR 3ʹUTR-Wt/MTOR 3ʹUTR-Mut and miR-100 inhibitor. (e) The expression correlation between miR-100 and MTOR was analyzed using the Spearman Rank Correlation. *p < 0.05; **p < 0.01; ***p < 0.001.

Targets of miR-100 based on TargetScan prediction MiR-100 targets MTOR. (a) Expression of MTOR in femur tissues and BMSCs from control mice and OVX mice. (b) Expression of MTOR in BMSCs after transfection with miR-100 inhibitor. (c) The binding site of miR-100 and MTOR was conserved among many mammals, as predicted from Targetscan. (d) A luciferase reporter assay was performed to reveal activities in 293 T cells after cotransfection with MTOR 3ʹUTR-Wt/MTOR 3ʹUTR-Mut and miR-100 inhibitor. (e) The expression correlation between miR-100 and MTOR was analyzed using the Spearman Rank Correlation. *p < 0.05; **p < 0.01; ***p < 0.001.

Inhibition of miR-100 activates the AKT/mTOR pathway in BMSCs

Previous studies have shown that the AKT signaling pathway is significantly inhibited in osteoporotic bone tissue [25], and some studies have shown that the AKT signaling pathway can be negatively regulated by miR-100 [26]. To further verify whether miR-100 affects the AKT pathway in OVX-BMSCs, we first determined the expression of mTOR and AKT in OVX-BMSCs. The results showed that the expression of mTOR and phosphorylated AKT (Thr308 and Ser473) was significantly inhibited in OVX-BMSCs (Figure 4a). Next, we found that the AKT/mTOR pathway was activated by inhibiting miR-100 in BMSCs (Figure 4b). Finally, Western blot result indicated that the OVX-induced inhibition of the AKT/mTOR pathway was significantly reversed by miR-100 inhibitor (Figure 4c). These results suggested that the AKT/mTOR pathway may be an important pathway of miR-100 mediated osteogenesis of OVX-BMSCs.
Figure 4.

Inhibition of miR-100 activates the AKT/mTOR pathway in BMSCs. (a-c) Western blot analysis was conducted to determine the protein expression of mTOR, p-AKT (Ser473), p-AKT (Thr308), AKT, mTOR, p-mTOR in different groups. All experiments were carried out three times independently. The error bar indicates SD. *p < 0.05; **p < 0.01; ***p < 0.001.

Inhibition of miR-100 activates the AKT/mTOR pathway in BMSCs. (a-c) Western blot analysis was conducted to determine the protein expression of mTOR, p-AKT (Ser473), p-AKT (Thr308), AKT, mTOR, p-mTOR in different groups. All experiments were carried out three times independently. The error bar indicates SD. *p < 0.05; **p < 0.01; ***p < 0.001.

Honokiol mediates the promotional role of miR-100 inhibition in osteogenic function of BMSCs

Subsequently, to further verify whether miR-100 mediates BMSC osteogenesis by the AKT pathway, an AKT inhibitor (Honokiol) was used to cotreat BMSCs with miR-100 inhibitor. The OVX-stimulated decrease in expression levels of ALP and OCN in BMSCs was markedly reversed after transfection of miR-100 inhibitor, while the effect of miR-100 inhibitor on ALP and OCN levels was rescued by Honokiol (Figure 5a and b). Furthermore, Honokiol reversed the positive effect of miR-100 inhibitor on calcium deposition and ALP staining in OVX-BMSCs (Figure 5c-e). Therefore, above data indicate that miR-100 inhibition facilitates osteogenic differentiation of OVX-BMSCs through the AKT pathway.
Figure 5.

Honokiol blocks the promotional role of miR-100 inhibition in osteogenic function of OVX-BMSCs. (a-b) RT-qPCR analysis was used to detect the expression of ALP and OCN in different treatment groups. (c-d) Alizarin red staining was performed to determine the calcium deposition in different treatment groups. (e) ALP staining of OVX-BMSCs. All experiments were carried out three times independently. The error bar indicates SD. *p < 0.05; **p < 0.01; ***p < 0.001.

Honokiol blocks the promotional role of miR-100 inhibition in osteogenic function of OVX-BMSCs. (a-b) RT-qPCR analysis was used to detect the expression of ALP and OCN in different treatment groups. (c-d) Alizarin red staining was performed to determine the calcium deposition in different treatment groups. (e) ALP staining of OVX-BMSCs. All experiments were carried out three times independently. The error bar indicates SD. *p < 0.05; **p < 0.01; ***p < 0.001.

Discussion

The present study demonstrated that miR-100 is a key regulator of osteoporosis. The expression of miR-100 in bone tissue and OVX-BMSCs of osteoporosis mice was significantly increased. Inhibition of miR-100 can significantly promote the osteogenic ability of OVX-BMSCs. Finally, we confirmed that inhibition of miR-100 expression in OVX-BMSCs can promote the osteogenic ability of OVX-BMSCs through the AKT pathway. There are two factors that affect the healing of fracture and bone defect: systemic and local factors, and they participate in each stage of repair after injury. After fracture or bone defect, the body regulates the metabolism of calcium and phosphorus, and affects the secretion of corresponding substances by osteoblasts and osteoclasts to regulate the formation and absorption of bone [27,28]. Calcium and phosphorus, as important elements in the process of fracture healing, are important guarantees to maintain bone formation (calcium salt deposition in bone) and rapid healing after injury [29]. ALP is the main protein involved in the process of osteogenesis. It can promote matrix mineralization by decomposing inorganic phosphorus of phosphate and increasing its local concentration [30]. ALP is a marker of bone remodeling activity and can be used as an indicator of fracture healing [31]. OCN is a non-collagen synthesized by osteoblasts in the process of bone matrix mineralization, which is another important marker of osteogenic activity and bone turnover [32]. Moreover, the depletion of ALP and OCN is associated with the inhibition of osteoblast differentiation and the exacerbation of osteoporosis as well [29, 30]. In this study, we found that the expression of osteogenic markers ALP and OCN in OVX-BMSCs was significantly downregulated. Therefore, it is of great significance to explore the target genes that can enhance the osteogenic differentiation ability of OVX-BMSCs. In previous studies, abnormal miR-100 expression has been found in a series of disease models, including tumor [33], ischemic heart disease [34], and nervous system disease [35]. Some studies have shown that the abnormal expression of miR-100 in the plasma of patients with osteoporosis is increased, and it can be used as one of the diagnostic markers of osteoporotic patients [21]. However, the role of miR-100 in OVX-BMSCs and whether it can be used as a potential therapeutic target are still unclear. In this study, we found that inhibition of miR-100 significantly rescued the OVX-induced decrease of ALP and OCN levels in BMSCs. Since the decrease of ALP and OCN are related to the suppression in osteoblast differentiation and the aggravation in osteoporosis [29, 30], we concluded that miR-100 silencing improves osteoblast differentiation and protects against osteoporosis. Many references indicated that the AKT pathway is downregulated in estrogen deficiency-induced osteoporosis and can be used as a target for osteoporosis treatment. Chlorogenic acid promotes osteoblastic differentiation of BMSCs via the AKT/cyclin D1 pathway [36]. Arctigenin induces osteogenesis on OVX-BMSCs and plays a protective role in OVX rats by the AKT/peroxisome proliferator activated receptor gamma axis [37]. Consistent with these findings, our results suggested the inhibition of AKT activity and the decrease of matrix mineral deposition in OVX-BMSCs. Using the AKT inhibitor Honokiol, the positive effect of miR-100 inhibitor on the AKT pathway was partially rescued, and the pathological state of OVX-BMSCs was improved. We identify for the first time that, miR-100 inhibition promotes the osteogenic differentiation of OVX-BMSCs via activating the AKT/mTOR signal pathway.

Conclusion

In Conclusion, knockdown of miR-100 leads to significant increase of osteogenesis in OVX-BMSCs by promoting the AKT/mTOR pathway. Our findings indicate that miR-100 might be an effective target for the treatment of osteoporotic mandibular injury and bone defect diseases. Click here for additional data file.
  37 in total

1.  Circulating fractures-related microRNAs distinguish primary hyperparathyroidism-related from estrogen withdrawal-related osteoporosis in postmenopausal osteoporotic women: A pilot study.

Authors:  C Verdelli; V Sansoni; S Perego; V Favero; J Vitale; A Terrasi; A Morotti; E Passeri; G Lombardi; S Corbetta
Journal:  Bone       Date:  2020-05-05       Impact factor: 4.398

2.  In situ miRNA delivery from a hydrogel promotes osteogenesis of encapsulated mesenchymal stromal cells.

Authors:  J Carthew; I Donderwinkel; S Shrestha; V X Truong; J S Forsythe; J E Frith
Journal:  Acta Biomater       Date:  2019-11-10       Impact factor: 8.947

Review 3.  Targeting bone morphogenetic protein antagonists: in vitro and in vivo evidence of their role in bone metabolism.

Authors:  Evaggelos Tsialogiannis; Ioannis Polyzois; Quen Oak Tang; George Pavlou; Evgenios Tsiridis; Manolis Heliotis; Eleftherios Tsiridis
Journal:  Expert Opin Ther Targets       Date:  2009-01       Impact factor: 6.902

Review 4.  Association between Dietary Patterns of Meat and Fish Consumption with Bone Mineral Density or Fracture Risk: A Systematic Literature.

Authors:  Simone Perna; Ilaria Avanzato; Mara Nichetti; Giuseppe D'Antona; Massimo Negro; Mariangela Rondanelli
Journal:  Nutrients       Date:  2017-09-18       Impact factor: 5.717

5.  Bone mesenchymal stem cell-derived extracellular vesicles deliver microRNA-23b to alleviate spinal cord injury by targeting toll-like receptor TLR4 and inhibiting NF-κB pathway activation.

Authors:  Hongfei Nie; Zhensong Jiang
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

6.  Mechanically-sensitive miRNAs bias human mesenchymal stem cell fate via mTOR signalling.

Authors:  Jessica E Frith; Gina D Kusuma; James Carthew; Fanyi Li; Nicole Cloonan; Guillermo A Gomez; Justin J Cooper-White
Journal:  Nat Commun       Date:  2018-01-17       Impact factor: 14.919

7.  miRNAs in bone tissue correlate to bone mineral density and circulating miRNAs are gender independent in osteoporotic patients.

Authors:  Sarah Kelch; Elizabeth R Balmayor; Claudine Seeliger; Helen Vester; Jan S Kirschke; Martijn van Griensven
Journal:  Sci Rep       Date:  2017-11-20       Impact factor: 4.379

8.  Increase in bone metabolic markers and circulating osteoblast-lineage cells after orthognathic surgery.

Authors:  Yoko Abe; Mirei Chiba; Sanicha Yaklai; Roan Solis Pechayco; Hikari Suzuki; Tetsu Takahashi
Journal:  Sci Rep       Date:  2019-12-27       Impact factor: 4.379

9.  Apolipoprotein D alleviates glucocorticoid-induced osteogenesis suppression in bone marrow mesenchymal stem cells via the PI3K/Akt pathway.

Authors:  Rong-Hua Yu; Xiang-Yang Zhang; Wei Xu; Zhi-Kun Li; Xiao-Dong Zhu
Journal:  J Orthop Surg Res       Date:  2020-08-08       Impact factor: 2.359

10.  The interaction of miR-181a-5p and sirtuin 1 regulated human bone marrow mesenchymal stem cells differentiation and apoptosis.

Authors:  Haitao Zhu; Hua Chen; DeGang Ding; Shui Wang; XiaoFeng Dai; YuLong Zhu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.