Literature DB >> 35132378

LINC02273 Promotes Hepatocellular Carcinoma Progression via Retaining β-Catenin in the Nucleus to Augment Wnt Signaling.

Liang Peng1,2, Rong Ye3, Xiansen Zhu4, Yuankang Xie5, Baiyin Zhong5, Yao Liu6,7, Heping Li8, Binhui Xie5.   

Abstract

Hepatocellular carcinoma (HCC) is a lethal malignancy whereas the molecular mechanisms remain poorly understood. Recently, long noncoding RNAs (lncRNA) have been shown to regulate HCC progression. However, the involved lncRNAs remain to be fully explored. Here, we showed the expression pattern and biological function of a recently identified lncRNA, LINC02273, in HCC. LINC02273 played a critical role in HCC progression via stabilizing β-catenin. Knockdown of LINC02237 remarkably inhibited the proliferation, stemness, migration, and invasion abilities, whereas it increased the apoptosis of HCC cells. Overall, we characterized the functions of LINC02273 in HCC and its potential as a novel HCC targeting candidate.
Copyright © 2022 Liang Peng et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35132378      PMCID: PMC8817111          DOI: 10.1155/2022/9631036

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Hepatocellular carcinoma (HCC) is the third leading cause of global cancer-related deaths [1] and accounts for approximately one-fifth of the malignancy in China [2]. HCC is characterized as a highly aggressive liver malignancy [3] that are frequently refractory to many available anticancer therapies, such as surgical resection, liver transplantation, chemotherapy, and radiation therapy [4, 5]. Despite tremendous improvements in understanding the underlying mechanisms of HCC over the past decades, the prognosis and disease-free survival of HCC patients remain dismal due to the high recurrence rate [6, 7]. It is predicted that HCC will surpass breast cancer and colorectal cancer and will be ranked as the leading malignancy until 2030 if the increase of HCC incidence keeps at the current rate [8]. Therefore, further dissecting the underlying molecular details of HCC and discovering novel therapeutic targets are in urgent need. It is now well established that noncoding RNAs play a vital role in regulating many aspects of cellular life [9-11], of which long noncoding RNAs (lncRNAs) are larger than 200 nucleotides in length and are recently demonstrated to be involved in a wide range of cellular processes, such as epigenetic regulation of transcription and posttranslational regulation of protein stability [12]. Hence, lncRNAs are revealed to play an important role in cell activities, including cell proliferation, apoptosis, migration, and stemness maintenance and are frequently dysregulated in cancer occurrence and progression [12, 13]. The molecular mechanisms of the biological functions underlying lncRNAs are in diversity and complex, such as serving as scaffolds, guiding the interaction of biomacromolecules, decoying proteins or mRNAs, and sponging miRNAs [14]. Accumulating evidence has shown that lncRNAs could act as both tumor suppressor [15] and oncogene [16]. LINC02273 was recently discovered in breast cancer and was revealed to drive breast cancer metastasis via increasing AGR2 expression [17]. In the present study, we determined the expression pattern of LINC02273 in HCC cell lines and clinical samples. We subsequently demonstrated that LINC02273 is localized in the nucleus of HCC cells and is evidently associated with the malignant characteristics, such as proliferation, invasion, and antiapoptosis. Our data indicated that LINC02273 exerts its biological functions via activating β-catenin in HCC cells and suggested that LINC02273 is a potential biomarker and therapeutic target for HCC.

2. Materials and Methods

2.1. Tumor Samples

Human primary HCC and paired adjacent noncancerous liver tissues were obtained from the Department of Hepatobiliary Surgery, the First Affiliated Hospital of Gannan Medical University under the approval by the Ethical Committee of the Gannan Medical University. Informed consents were obtained from all patients involved in this study. A total of 31 pairs of HCC and adjacent nontumor samples were collected (Supplementary Table S1), with 4 normal liver tissues used as the control. The sample size was determined according to our inclusion criteria between June 2019 and November 2019 from the Department of Hepatobiliary Surgery, the First Affiliated Hospital of Gannan Medical University. The inclusion criteria for human tissues are as follows: all patients were first diagnosed with HCC, and none of them received any local or systemic anticancer therapies before resection. The diagnosis of all cases was confirmed pathologically by two experienced pathologists. The tumor pathological classification and staging standards of HCC are performed according to the Union for International Cancer Control (UICC) staging standards. The clinical features of the samples included in this study were summarized in Supplementary Table S1.

2.2. Cell Line Culture

All cell lines used in this work were purchased from the ATCC (USA) or the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and were cultured at 37°C in a humid atmosphere of 5% CO2 with the recommended medium. For THLE3, BEGM from Lonza (BEGM Bullet Kit; CC3170) was supplemented with extra 5 ng/mL EGF and 70 ng/mL. BLC-2, HCCLM3, Huh7, Hep3B, MHCC97H, and MHCC97L were cultured in DMEM (Corning), supplemented with 10% fetal bovine serum (FBS) (Gibco) and 100 IU/mL penicillin/streptomycin (Corning). All cells were routinely tested and confirmed to be mycoplasma free.

2.3. Plasmid Construction and Stable Cell Line Establishment

The shRNA vectors targeting LINC02273 used in this study were cloned following a previously reported method [18], with two independent target sites to exclude off-target effects: 5′- GTGGGAAGACCTATTATAAGT -3′ (KD-1) and 5′- CTCTCCAAGGTGCCAGGGTTA -3′ (KD-2) and a scramble sequence (5′- CCTAAGGTTAAGTCGCCCTCG -3′) targeting as the control. All plasmids were verified by sequencing at Sangon Biotechnology (Shanghai, China). Lentivirus particles were packaged and used as previously described [18]. Briefly, lentivirus was produced by cotransfecting HEK293T cells with desired plasmids together with psPAX2 and pMD2.G. The pseudovirus-containing supernatant was harvested and passed through a 0.45 mm filter. The collected lentivirus was stored at −80°C or used immediately to infect cells-of-interest in the presence of 8 μg/mL polybrene (Sigma-Aldrich). The infected cells then were selected with 2 μg/mL puromycin (Invivogen) for at least 7 days to establish stable cell strains.

2.4. RNA Extraction and Quantitative Real-Time PCR

Tumor tissue and cell pellet were collected and dissolved in RNAiso (Takara). Total RNA was extracted according to the supplier's recommendations. Subsequently, cDNAs were reverse transcribed with the Hiscript III Reverse Transcriptase kit (Vazyme) as recommended by the manufacturer. Then, real-time quantitative PCR was performed using SYBR qPCR Master Mix (Vazyme) on a ABI7300 System (Applied Biosystems). All primers used in this study for qRT-PCR were listed in supplementary table S2:

2.5. Colony Formation Assay

Colony formation assay was carried out by seeding three hundred living cells per well onto 6-well plates in triplicate and maintained in complete culture medium for about 12 days until visible colonies were observed. Colonies were then fixed with 70% ethanol for 5 min following twice washing of PBS. Then, the colonies were stained using Coomassie blue for 5 min. Residual Coomassie blue was washed away twice with ddH2O.

2.6. MTT Assay

MTT assay was performed following previous publication [18]. Briefly, 400 cells into each well of a 96-well plate at 4 replicates. Before measurement, MTT was added (1 mg/mL) and incubated at 37°C for 4 h. Subsequently, the MTT product was dissolved in DMSO for 10 min at room temperature, and absorbance at 490 nm (OD490) was measured.

2.7. TOP/FOP Luciferase Reporter Assay

The reporter plasmids containing wild-type β-catenin TCF/LEF DNA binding site (CCTTTGATC; TOP-flash) or the mutated version (CCTTTGGCC; FOP-flash) were cotransfected with pRL-TK Renilla plasmid into indicated HCC cells using Lipofectamine 3000 (Life Technologies). Forty-eight hours posttransfection, luciferase activity was measured using the Dual-Glo Luciferase Assay Kit (Promega) following the manufacturer's recommendations. The signal ratio of TOP/FOP-flash was calculated to indicate the activation of β-catenin [19].

2.8. Sphere Formation Assay

Serum-free DMEM/F12 medium was used for sphere culture, supplemented with 100 IU/mL penicillin, 100 μg/mL streptomycin, 20 ng/mL human recombinant epidermal growth factor, 20 ng/mL human recombinant basic fibroblast growth factor, 1% nonessential amino acids, 1% GlutaMax, 2% B27 supplement (Invitrogen, USA), and 1% methylcellulose (Sigma, USA). HCC cells were cultured at a density of 1000 cells/mL in ultralow attachment 6-well plates. After 7 days culture, spheres > 100 μm in diameter was counted and the sphere-forming efficiency was calculated [20].

2.9. Western Blotting Analysis

The nuclear protein was extracted following the manufacturer's recommendations (Abcam, ab113474). Briefly, the cell pellet was resuspended in the preextraction buffer for 10 min and vortexed vigorously for 10 s. After centrifugation, the cytoplasm-containing supernatant was harvested and the nucleus pellet was further lysed for subsequent analysis. The concentration of the fractioned nuclear protein was determined by the BCA kit (Thermo Fisher). Subsequently, 10 μg of the protein was loaded and separated by SDS/PAGE and transferred to PVDF membranes (Millipore). The membranes were then blocked with 5% (wt/vol) nonfat milk in TBS plus Tween 20 (1%) at room temperature for 1 hour before probing with primary antibodies against β-catenin (ab223075, Abcam, 1: 1000) or p84 (ab487, Abcam, 1: 1000) at 4°C overnight. After incubation with HRP-conjugated secondary antibodies, an enhanced chemiluminescent (ECL) chromogenic substrate was used to visualize the bands (Pierce) on a Western Blotting Detection System (GE Healthcare).

2.10. Subcellular Fractionation

Total RNA of cytoplasmic and nuclear fractions of the Hep3B and MHCC97H cells were prepared and purified following the instructions of the Nuclear/Cytoplasmic Isolation PARIS™ kit (AM1921, Life Technologies). GAPDH was used as the cytoplasmic endogenous control, and U6 small nuclear RNA was used as the nuclear endogenous control.

2.11. Statistical Analysis

Statistical analysis was performed using GraphPad Prism Version 7.0e (USA). The results are presented as the mean ± standard deviation (mean ± S.D.). The differences between two groups were determined by two-tailed Student's t-test, otherwise mentioned. For multigroup analysis, we performed ANOVA analysis followed by Dunnet's t-test. p < 0.05 was considered to be statistically significant, and the p values in figures are indicated with asterisks as below: ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

3. Results

3.1. LINC02273 Was Significantly Upregulated in Hepatocellular Carcinoma

To understand the role of LINC02273 in HCC, we firstly determined its expression pattern in tumor tissues and the normal counterparts. HCC tissues and the adjacent nontumor tissues (ANT) (n = 31), as well as normal liver tissue from donors (n = 4), were collected, and the expression of LINC02273 was determined by qRT-PCR. Interestingly, we found that LINC02273 was significantly upregulated in HCC tissue compared to the normal liver tissues (Figure 1(a)). Furthermore, a significant increase in LINC02273 expression was also observed when we compared tumor tissues to their adjacent nontumor counterpart (Figure 1(b)). To answer whether LINC02273 is associated with HCC progression, we categorized the HCC tissues into 2 groups, low stage (stage I-II, n = 16) and high stage (stage III-IV, n = 15), according to their pathological characteristics. Subsequent analysis determined that LINC02273 was significantly higher in stage III-IV than stage I-II, implying that LINC-2273 was associated with advanced HCC (Figure 1(c)). Apart from the HCC tissue data, which might be confused by the involvement of nontumor cell component such as immune cells and fibroblasts, we also conducted the analysis in cultured normal liver cells and liver cancer cells. We observed a significant increase in LINC02273 expression in HCC cell lines compared to the normal liver cell line THLE3 (Figure 1(d)). These results indicated that LINC02273 was upregulated in HCC, and its high expression was involved in HCC malignancy.
Figure 1

LIN02273 is significantly upregulated in HCC samples and cell lines. Expression of LINC02273 was determined by qRT-PCR in clinical and cell lines: (a) HCC tumor samples (n = 31) vs. normal liver samples (n = 4), (b) paired tumor samples (n = 31) vs. adjacent nontumor (ANT) samples (n = 31), (c) low-stage liver samples (stage I-II, n = 16) vs. high-stage liver samples (stage III-IV, n = 15), and (d) normal liver cell lines and HCC cell lines. For multiple groups, we performed ANOVA analysis followed by Dunnett's test.

3.2. LINC02273 Enhances HCC Cell Proliferation and Stemness

Based on the above observation, we then asked how LINC02273 promoted the progression of HCC. As lincRNAs were reported to play their function in specific cellular compartments, we determined the localization of LINC02273 by nuclear cytoplasmic fractionation. qRT-PCR was subsequently performed to determine the level of LINC02273 in both fractions. Intriguingly, we observed LINC02273 was mainly distributed in the nuclear fraction in a similar manner to the known nuclear localized U6 RNA; in contrast, GAPDH was mainly found in the cytoplasm (Figure 2(a)). To reveal the functional roles of LINC02273 in hepatocellular carcinoma, we then knocked down LINC02273 in HCC cancer cell lines Hep3B and MHCC97H. After confirmation of the RNA interference of LINC02273 (Figure 2(b)), we tested the effects of LINC02273 KD on cell proliferation, colony formation, and sphere formation. We observed that knockdown of LINC02273 significantly inhibits proliferation, colony, and sphere formation abilities in both Hep3B and MHCC97H (Figures 2(c)–2(e)). These results indicated that LINC02273 is involved in promoting HCC cell proliferation and stemness.
Figure 2

LINC02273 is a nuclear lncRNA and KD of LINC02273 inhibited proliferation of HCC cells. (a) The ratio of LINC02273, U6, and GAPDH was determined in the fractioned cytoplasmic and nuclear RNA of Hep3B and MHCC97H cells, with U6 and GAPDH as endogenous nuclear and cytoplasmic indicators, respectively. (b) qRT-PCR was performed to determine the KD of LINC02273 in Hep3B and MHCC97H cells. (c–e) MTT, colony formation, and sphere formation was conducted to determine the effects of LINC02273 KD on proliferation, colony formation, and sphere formation abilities. For multiple group comparison, we performed ANOVA analysis followed by Dunnett's test. ∗∗p < 0.01, ∗∗∗p < 0.001.

3.3. LINC02273 Promotes HCC Cell Migration, Invasion, and Survival

LINC02273 has been reported to promote breast cancer metastasis via enhancing migration and invasion. Due to this, we asked whether LINC02273 has a similar effect on HCC cell migration and invasion. We performed wound healing assay to assess the migration ability, and we subsequently found to LINC02273 knockdown significantly inhibited migration in both Hep3B and MHCC97H (Figure 3(a)). Then, we conducted Transwell assay to determine the invasion ability after LINC02273 KD. We found that KD of LINC02273 remarkably impaired the invasion ability in Hep3B and MHCC97H (Figure 3(b)). These results suggested that LINC02273 upregulation in HCC cells could promote HCC cell migration and invasion. During culture of the KD clones, more dead cells were observed in the supernatant of the knockout groups compared with the control group. Therefore, we performed apoptosis assay and found that LINC02273 knockout indeed significantly increased apoptotic cells in both Hep3B and MHCC73H cells (Figure 4), indicating that LINC02273 has a role in promoting HCC cell survival. These data together imply that LINC02273 might play a crucial role in promoting HCC metastasis, since migration, invasion, and survival are most important features to metastatic cells.
Figure 3

Interference of LINC02273 suppressed migration and invasion abilities of HCC cells. (a) Would healing assay was performed to assess the migration ability of Hep3B and MHCC97H after LINC02273 KD. The percentage of would coverage was calculated (B). (b) The invasion ability of Hep3B and MHCC97H was determined using Transwell assay, with the representative pictures shown on (A) and the statistical results on (B). ∗p < 0.05, ∗∗p < 0.01.

Figure 4

Knockdown of LINC02273 increased HCC cell apoptosis. Apoptosis analysis was performed using FITC-Annexin V and PI staining in the LINC02273 KD Hep3B and MHCC97H cells. Representative FACS pictures were shown on (A) and the statistical analysis of the percentage of apoptotic cells (early plus late apoptosis) on (B). ∗∗p < 0.01, ∗∗∗p < 0.001.

3.4. LINC02273 Promotes the HCC Malignant Characteristics via β-Catenin

We then determined to unravel the molecular mechanisms by which LINC02273 enhances the proliferation, invasion, stemness, and antiapoptosis abilities of HCC cells. Wnt/β-catenin signaling axis has been reported to play a critical role in HCC initiation and progression, which could promote the proliferation, invasion, stemness, and survival of HCC cells, reminiscent of the biological function of LINC02273 [21, 22]. Therefore, we tested whether LINC02273 functions via the Wnt/β-catenin axis by a TOP/FOP reporter system. Interestingly, we found that the β-catenin transcription activity was significantly inhibited when LINC02273 was knocked down, as indicated by the decreased TOP/FOP signal in LINC02273-KD cell lines (Figure 5(a)). We also determined the level of nuclear β-catenin in LINC02273-KD cells and we observed that LINC02273 resulted in decreased nuclear β-catenin in both Hep3B and MHCC97H cells (Figure 5(b)). Further analysis of the downstream gene expression of the Wnt/β-catenin pathway also demonstrated that LINC02273 KD led to the suppression of the transcriptional activity of β-catenin, where the proved downstream genes, such as c-Myc, Cyclin D1, Survivin, MMP-7, and COX-2, were observed to be downregulated after LINC02273 interference (Figure 5(c)) [23, 24], suggesting that LINC02273 might potentiates the proliferation, stemness, invasion, migration, and survival of HCC cells. These results could largely explain the previous biological effects upon of LINC02273 interference, such as the suppressed proliferation, invasion, and increased apoptosis. These results imply that LINC02273 functions via β-catenin in HCC, probably by increasing its nuclear stability as LINC02273 is characterized as a nucleus localized lncRNA.
Figure 5

LINC02273 knockdown led to decreased nuclear β-catenin accumulation and suppressed downstream gene expression. (a) β-Catenin transcription activity was determined by the TOP/FOP reporter system, with the signal of each cell line normalized to the corresponding NT group. (b) WB of β-catenin and p84 in fractioned nuclear protein, with p84 as the loading control. (c) The expression of β-catenin downstream genes (c-Myc, Cyclin D1, Survivin, MMP-7, and COX-2) was determined by qRT-PCR and normalized to the corresponding NT group. ∗∗p < 0.01, ∗∗∗p < 0.001.

4. Discussion

In this work, we found that LINC02273 expression is upregulated in hepatocellular carcinoma and promotes HCC malignancy via augmenting Wnt/β-catenin signaling in the nucleus through direct interaction with β-catenin and increasing its stability. Accordingly, our results suggest that interference the expression of LINC02273 could significantly decrease the activity of the Wnt/β-catenin axis and thus suppress the HCC progression (Figure 6).
Figure 6

The schematic model of this study. LINC02273 is mainly localized in the nucleus, where it binds to β-catenin to increase its stabilization and augments downstream signaling of Wnt/β-catenin axis. Accordingly, interference of LINC02273 expression is a potential strategy to decrease Wnt/β-catenin signaling and thus suppress HCC progression.

LINC02273 was recently discovered in breast cancer, where it functions as an onco-lncRNA via promoting the transcription of ARG2 to promote breast cancer metastasis [17]. As our group was dedicated in understanding the molecular mechanisms of HCC, we analyzed the expression pattern of LINC02273 in clinical HCC samples collected in our hospital. Intriguingly, we found that LINC02273 was significantly overexpressed in HCC samples compared to normal samples as well as adjacent nontumor tissues. We further showed that downregulation of LINC02273 impaired the proliferation, stemness, migration/invasion ability, and survival of HCC cells. As these characteristics remind us of the Wnt/β-catenin, which has been documented to regulate the abovementioned biological processes in HCC [21]; we then determined the effects of LINC02273 KD on the Wnt/β-catenin axis. As expected, LINC02273 KD significantly suppressed the transcription activity of β-catenin via decreasing the nuclear β-catenin level. Moreover, the key downstream genes of β-catenin were also inhibited upon LINC02273 interference. Therefore, LINC02273 could serve as a valuable prognostic factor in hepatocellular carcinoma and a potential therapeutic target. lncRNAs exert their biological functions in diverse and complex molecular mechanisms [25, 26]. Accumulating evidence suggests that lncRNAs can serve as a scaffold for assembly of protein complex by stabilizing proteins [26]. Since LINC02273 is mainly localized in the nucleus, it would be reasonably to expect that LINC02273 could interact with components in the nuclear compartment, including proteins, RNAs, or even chromatin. In the previous study of LINC02273 in breast cancer [17], the authors discovered that LINC02273 interacts with the hnRNPL protein to promote its function as a transcription regulator at the promoter of ARG2, whereas LINC02273 seems not to affect the stability of the hnRNPL protein. Here, in this study, we found that LINC02273 KD resulted in significantly decreased β-catenin in the nucleus. As LINC02273 itself is mainly a nucleus-localized lncRNA in HCC, it is likely that LINC02273 functions in HCC via stabilizing β-catenin or preventing its degradation, which needs to be further studied in future work. The Wnt/β-catenin signaling pathway has an important role in not only organism development but also in cancer when dysregulated [27]. However, directly targeting Wnt or β-catenin has been demonstrated to be prone to induce systemic toxicity as Wnt/β-catenin is vital in maintaining the stem cell niche in many normal tissues [28]. Therefore, targeting molecules or pathways that are involved in dysregulating Wnt/β-catenin but not expressed or required by normal tissues is a promising strategy. In this sense, LINC02273, which is highly expressed in HCC but not in normal liver tissues, would be one of the candidates that could be employed to inhibit the Wnt/β-catenin axis activity. As interference of LINC02273 could remarkably inhibit the proliferation, stemness, migration, and invasion abilities of HCC cells, LINC02273 shows the potential as a promising target for HCC therapeutics. Although siRNA or shRNA are not effective in vivo, the chemically modified antisense oligos (ASO) and locked nucleic acid (LNA) have been applied to target mRNAs in vivo [29, 30]. What is more encouraging is that several ASOs have recently been in the clinical trials (e.g., NCT01839604 and NCT02423590). These advances in both basic research and clinical trials might in the near future lead to the application of LINC02273 as a therapeutic target in HCC (Figure 6).

5. Conclusions

Our study demonstrated that LINC02273, as a novel onco-lncRNA in hepatocellular carcinoma, promoted the proliferation, invasion, stemness, and survival of tumor cells. Mechanistically, LINC02273 was localized in the nucleus, where it likely functions via stabilizing β-catenin and thus enhancing transcription of the downstream genes, including m-Myc, Cyclin D1, Survivin, MMP-7, and COX-2. LINC02273-β-catenin axis shows the potential as prognostic biomarkers and a promising therapeutic target to intervene HCC progression (Figure 6).
  27 in total

1.  Functional genomics: Screening for lncRNA function.

Authors:  Linda Koch
Journal:  Nat Rev Genet       Date:  2017-01-03       Impact factor: 53.242

Review 2.  Hepatocellular Carcinoma From Epidemiology to Prevention: Translating Knowledge into Practice.

Authors:  Amit G Singal; Hashem B El-Serag
Journal:  Clin Gastroenterol Hepatol       Date:  2015-08-15       Impact factor: 11.382

Review 3.  The implication of long non-coding RNAs in the diagnosis, pathogenesis and drug resistance of pancreatic ductal adenocarcinoma and their possible therapeutic potential.

Authors:  Gouri Pandya; Anuradha Kirtonia; Gautam Sethi; Amit Kumar Pandey; Manoj Garg
Journal:  Biochim Biophys Acta Rev Cancer       Date:  2020-08-29       Impact factor: 10.680

Review 4.  Tumour evolution in hepatocellular carcinoma.

Authors:  Amanda J Craig; Johann von Felden; Teresa Garcia-Lezana; Samantha Sarcognato; Augusto Villanueva
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2019-12-02       Impact factor: 46.802

5.  EpCAM-positive hepatocellular carcinoma cells are tumor-initiating cells with stem/progenitor cell features.

Authors:  Taro Yamashita; Junfang Ji; Anuradha Budhu; Marshonna Forgues; Wen Yang; Hong-Yang Wang; Huliang Jia; Qinghai Ye; Lun-Xiu Qin; Elaine Wauthier; Lola M Reid; Hiroshi Minato; Masao Honda; Shuichi Kaneko; Zhao-You Tang; Xin Wei Wang
Journal:  Gastroenterology       Date:  2008-12-06       Impact factor: 22.682

Review 6.  Role of Wnt/β-catenin signaling in hepatocellular carcinoma, pathogenesis, and clinical significance.

Authors:  Ahmed M Khalaf; David Fuentes; Ali I Morshid; Mata R Burke; Ahmed O Kaseb; Manal Hassan; John D Hazle; Khaled M Elsayes
Journal:  J Hepatocell Carcinoma       Date:  2018-06-27

Review 7.  Molecular Mechanisms Involved in HCC Recurrence after Direct-Acting Antiviral Therapy.

Authors:  Rosanna Villani; Gianluigi Vendemiale; Gaetano Serviddio
Journal:  Int J Mol Sci       Date:  2018-12-22       Impact factor: 5.923

Review 8.  Long non-coding RNAs regulate drug resistance in cancer.

Authors:  Kaisheng Liu; Lin Gao; Xiaoshi Ma; Juan-Juan Huang; Juan Chen; Leli Zeng; Charles R Ashby; Chang Zou; Zhe-Sheng Chen
Journal:  Mol Cancer       Date:  2020-03-12       Impact factor: 27.401

9.  LINC02273 drives breast cancer metastasis by epigenetically increasing AGR2 transcription.

Authors:  Bingqiu Xiu; Yayun Chi; Lei Liu; Weiru Chi; Qi Zhang; Jiajian Chen; Rong Guo; Jing Si; Lun Li; Jingyan Xue; Zhi-Ming Shao; Zhao-Hui Wu; Shenglin Huang; Jiong Wu
Journal:  Mol Cancer       Date:  2019-12-19       Impact factor: 27.401

Review 10.  Challenges of advanced hepatocellular carcinoma.

Authors:  Stefano Colagrande; Andrea L Inghilesi; Sami Aburas; Gian G Taliani; Cosimo Nardi; Fabio Marra
Journal:  World J Gastroenterol       Date:  2016-09-14       Impact factor: 5.742

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.